CN112175843A - Aureobasidium pullulans with improved beta-glucan yield and application thereof - Google Patents
Aureobasidium pullulans with improved beta-glucan yield and application thereof Download PDFInfo
- Publication number
- CN112175843A CN112175843A CN202011086751.1A CN202011086751A CN112175843A CN 112175843 A CN112175843 A CN 112175843A CN 202011086751 A CN202011086751 A CN 202011086751A CN 112175843 A CN112175843 A CN 112175843A
- Authority
- CN
- China
- Prior art keywords
- aureobasidium pullulans
- glucan
- beta
- fermentation
- pullulans
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
- C12P19/08—Dextran
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Mycology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicinal Chemistry (AREA)
- Botany (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses aureobasidium pullulans with improved beta-glucan yield and application thereof, belonging to the technical field of microorganisms. The aureobasidium pullulans of the invention is preserved in China general microbiological culture Collection center of China general microbiological culture Collection center at 03.06.2020, with the preservation number of CGMCC No.19650 and the preservation address of No. 3 Hospital No.1 of Xilu, Beijing, Chaoyang, respectively. Compared with the original strain, the aureobasidium pullulans of the invention has the advantages that the intracellular UDPG content is increased, and the yield of beta-glucan is increased by 2-3 times.
Description
Technical Field
The invention relates to aureobasidium pullulans with improved beta-glucan yield and application thereof, belonging to the technical field of microorganisms.
Background
Beta-1, 3-glucan (beta-glucan) is an important bioactive polysaccharide, widely distributed in plants, bacteria and fungi, and has important nutritional value and biological function. In recent years, β -glucan has been receiving more and more attention in the fields of medicines, foods, cosmetics, feed additives, and the like, and studies on the activity, application, and the like of β -glucan have been increasing year by year. The beta-glucan has various biological activities, and the immunoregulation function is the most basic function of the beta-glucan, can stimulate the innate immune system and improve the immunity, thereby greatly improving the antibacterial and antiviral abilities, and being used for the research of tumor immunotherapy; the beta-glucan is used as a natural immunostimulant and can be prepared into a vaccine adjuvant to improve the sensitivity of an immune system to a vaccine antigen; beta-glucans may also promote wound healing and the us and european union have approved beta-glucans for use in products for promoting wound healing and the treatment of burns. The beta-glucan has the performances of high viscosity, high water holding capacity, emulsion stability and the like, is often used as a thickening agent, a water holding agent, an adhesive and an emulsion stabilizer in the food industry to be applied to foods such as seasonings, desserts and the like, and improves the texture and structure characteristics of the foods; in addition, the beta-glucan has the functions of reducing blood sugar and blood fat and regulating cognition, so that the beta-glucan can be developed as a functional food. In the cosmetic industry, the beta-glucan has the performances of anticoagulation, antioxidation, cell proliferation promotion, bacteriostasis and water absorption, and can have various functions of moisturizing, aging delaying, epithelial fibroblastic proliferation promotion, skin color beautifying and the like. Beta-glucan is used as a good natural immunopotentiator, can improve the health condition of animals, has a certain adsorption effect on heavy metals and toxins, is used as a feed additive, and is widely used in aquaculture and feed industry.
The production of beta-glucan is usually carried out by chemical, physical and enzymatic methods, and the raw materials mainly comprise plants, fungi, yeast and algae, wherein the content of the raw materials in yeast cell walls is highest. In recent years, the production of beta-glucan by fermentation using Aureobasidium pullulans (Aureobasidium pullulans) has become a trend. Under aerobic conditions, aureobasidium pullulans converts glucose to uridine diphosphate glucose (UDPG), which in turn is a common precursor for the biosynthesis of β -glucan and pullulan. In order to increase the yield of β -glucan, it is necessary to increase the supply of intracellular UDPG on the one hand, and to increase the activity of β -glucan synthase and decrease the activity of pullulan synthase on the other hand. Today, the study of the synthesis of beta-glucan by Aureobasidium pullulans is still in its infancy. Kang et al knocked out pullulan synthase gene (pul) in wild type strain A. pullulans IMS822KCTC11179BP to obtain mutant strain NP1221, compared with the wild type strain, the mutant strain does not produce pullulan polysaccharide in the fermentation process, only synthesizes beta-glucan, and the yield after 168h is 2.5 g/L. Hirabayashi et al produced β -glucan by fermentation using a. pullulans ATCC 20524, and studied the chemical structure thereof. In addition, Singh and Saini have mentioned in the study that sodium nitrate as a nitrogen source can promote the synthesis of beta-1, 3-glucan. Since the biosynthesis mechanism of β -glucan has not been resolved so far, how to further increase the content of UDPG, a precursor substance, and achieve an increase in β -glucan yield, remains to be further studied.
The yield of the beta-glucan can be improved by adopting a traditional fermentation optimization method, but the yield is still low, and the fermentation production efficiency is not high. The mutant strain bred by adopting a genetic engineering technical means has a certain effect on eliminating the byproduct pullulan, but has a positive effect on improving the yield of the beta-glucan. Therefore, the method adopts the method of agrobacterium tumefaciens mediation to carry out genetic modification on the aureobasidium pullulans, thereby fundamentally enhancing the biosynthesis pathway of the beta-glucan, improving the supply of intracellular precursor UDPG and finally achieving the purpose of improving the yield of the beta-glucan produced by the aureobasidium pullulans.
Disclosure of Invention
In order to solve the problems, the invention adopts an agrobacterium tumefaciens mediated method to carry out genetic transformation on aureobasidium pullulans, establishes a T-DNA mutation library, screens an aureobasidium pullulans mutant strain with stable genetic property on a flat plate containing hygromycin and chloramphenicol, and realizes the aim of high yield of beta-glucan by batch fermentation culture.
The invention aims to provide Aureobasidium pullulans with improved beta-glucan yield, which is classified and named as Aureobasidium pullulans and is preserved in China general microbiological culture collection center of China general microbiological culture Collection management Committee in 2020 and 03 months with the preservation number of CGMCC No.19650 and the preservation address of No. 3 of West Lu No.1 of the sunward district in Beijing.
The second purpose of the invention is to provide the method for breeding the aureobasidium pullulans, which is to adopt agrobacterium tumefaciens to mediate the aureobasidium pullulans for genetic transformation and screen the aureobasidium pullulans on a plate containing hygromycin and chloramphenicol to obtain the aureobasidium pullulans.
The third purpose of the invention is to provide the application of the aureobasidium pullulans in the fermentation production of beta-glucan.
Further, the application comprises the steps of inoculating aureobasidium pullulans into a seed culture medium for culture to obtain a seed solution, and then inoculating the seed solution into a fermentation culture medium for fermentation culture to produce the beta-glucan.
Further, the formula of the seed culture medium is 220g/L of potato and 18-22g/L of glucose.
Further, the formula of the fermentation medium is 40-120g/L of glucose, 2-4g/L of yeast powder, (NH)4)2SO4 0.5-0.7g/L，K2HPO4 1-3g/L，NaCl 0.5-1.5g/L，MgSO4·7H2O 0.1-0.3g/L。
Further, the fermentation culture is batch fermentation.
The fourth purpose of the invention is to provide a microbial agent, wherein the microbial agent comprises the aureobasidium pullulans.
Further, the microbial agent is a solid microbial agent.
Further, the microbial agent is a liquid microbial agent.
The invention has the beneficial effects that:
the aureobasidium pullulans of the invention is preserved in China general microbiological culture Collection center of China general microbiological culture Collection center at 03.06.2020, with the preservation number of CGMCC No.19650 and the preservation address of No. 3 Hospital No.1 of Xilu, Beijing, Chaoyang, respectively. Compared with the original strain, the aureobasidium pullulans of the invention has the advantages that the intracellular UDPG content is increased, and the yield of beta-glucan is increased by 2-3 times.
Biological material preservation:
aureobasidium pullulans (Aureobasidium pullulans) is preserved in China general microbiological culture Collection center (CGMCC) No.19650 at 03.06.2020, with the preservation number of No. 3 Hospital No.1, Beijing, Naja, Kyoho.
Drawings
FIG. 1 is a diagram showing the results of PCR verification of the original strain (WT) and the mutant strain (56 #).
Detailed Description
The present invention is further described below in conjunction with specific examples to enable those skilled in the art to better understand the present invention and to practice it, but the examples are not intended to limit the present invention.
The starting strain is Aureobasidium pullulans (Aureobasidium pullulans CCTCC M2012259).
Mutant strain is A.pullulans 56 #. The mutant strain is preserved in China general microbiological culture Collection center (CGMCC) at 03.06.2020, with the preservation number of CGMCC 19650.
Agrobacterium tumefaciens (Agrobacterium tumefaciens AGL-1), stored by the institute of microbiological engineering, university of Suzhou.
YEB Medium: yeast extract 10g/L, peptone 5g/L, sucrose 5g/L, MgSO4·7H2O0.5g/L。
YCK culture medium: yeast extract 10g/L, peptone 5g/L, sucrose 5g/L, MgSO4·7H2O0.5g/L, kanamycin 50mg/L, carbenicillin 50mg/L, hygromycin 100 mg/L.
IM medium: glucose 1.8g/L, K2HPO4 0.3g/L，NaCl 0.3g/L，MgSO4·7H2O0.3 g/L, MES 7.8g/L, acetosyringone 75 μmol/L, pH 5.3.
M-100 medium: glucose 20g/L, yeast extract 6.7g/L, (NH)4)2SO40.1g/L, adenine 0.07g/L, tyrosine 0.1g/L, histidine 0.08g/L, leucine 0.1g/L, pH 6.0.
Seed culture medium: 200g/L of potato, 20g/L of glucose and natural pH value.
Fermentation medium: 50g/L or 100g/L of glucose, 3g/L of yeast powder, (NH)4)2SO4 0.6g/L，K2HPO4 2g/L，NaCl 1g/L，MgSO4·7H2O 0.2g/L，pH 6.5。
Determination of dry cell mass and glucan yield: 20mL of fermentation liquid is taken, inactivated in 80 ℃ water bath for 15min, cooled to room temperature and then centrifuged at 12000 rpm for 10 min. The precipitate was washed 3 times with distilled water and the cells and dextran were separated with acetone. After collection, the mixture is dried at 70 ℃ until the mass is constant.
Determination of intracellular UDPG content: taking 5mL of fermentation liquor, centrifuging at 4 ℃ and 12000 rpm for 10min, washing with physiological saline for 2 times, resuspending wet cells in 5mL of 0.2mol/L phosphate buffer solution (pH7.0), ultrasonically crushing for 10min (crushing for 10s at an interval of 10s), and centrifuging at 4 ℃ and 12000 rpm for 20min to obtain supernatant, namely cell-free extract, which is used for determining the content of intracellular UDPG. UDPG was measured by HPLC. The chromatographic column is a Supelcosil LC-18-DB column (4.6 mm. times.250 mm), the mobile phase is 40mmol/L triethylamine-acetic acid buffer solution (pH 6.0), the flow rate is 1mL/min, the column temperature is 22 ℃, and the detection wavelength is 254 nm.
Example 1: construction of Aureobasidium pullulans mutant strains
1 preparation of Agrobacterium tumefaciens competent cells
(1) Inoculating agrobacterium tumefaciens on a YEB agar plate, and culturing at 30 ℃ for 24 h;
(2) selecting single colony, inoculating in 3mL YEB (containing kanamycin) test tube, and shake culturing at 30 deg.C and 200rpm overnight;
(3) 1mL of overnight-cultured bacterial liquid was inoculated into a 30mL YEB (kanamycin-containing) flask, and the mixture was shake-cultured at 30 ℃ and 200rpm for 5 to 8 hours to grow the cells to the logarithmic phase (OD)6000.4-0.6), placing the triangular flask on ice for 30 min;
(4) subpackaging the precooled bacterial liquid by using a 50mL precooled centrifugal tube;
(5) centrifuging at 4 deg.C and 4000rpm for 5min, collecting thallus, and removing supernatant;
(6) with 6mL precooled 20mmol/L CaCl2Washing, centrifuging at 4 deg.C and 4000rpm for 5min, and removing supernatant;
(7) then 3mL of precooled 20mmol/L CaCl2Washing thallus, mixing thallus, standing on ice for 30min, centrifuging at 4 deg.C and 4000rpm for 5min, and removing supernatant;
(8) every 30mL of the bacterial liquid is treated with 1.5mL of 20mmol/L CaCl containing 50% of glycerol2(precooling) and re-suspending the thalli, subpackaging in precooled 1.5mL EP tubes, quickly freezing for 5min by liquid nitrogen, and storing in a refrigerator at minus 80 ℃.
2 transforming the plasmid vector into agrobacterium tumefaciens competent cells
(1) Taking out Agrobacterium tumefaciens competent cells from a refrigerator at the temperature of minus 80 ℃, unfreezing the Agrobacterium tumefaciens competent cells on ice for 10min, adding 5 mu L of plasmid, and flicking and uniformly mixing;
(2) freezing with liquid nitrogen for 5min, and immediately heat-shocking at 37 deg.C for 5 min;
(3) ice-cooling for 3min, standing at room temperature for 2min, adding 450 μ L YEB (containing no antibiotic), and culturing at 30 deg.C and 200rpm for 2 h;
(4) centrifuging at 4000rpm for 1min, removing part of the supernatant, mixing the rest 100-200 μ L, uniformly coating on YCK plate, and performing inverted culture at 30 deg.C for 2 days.
3 Agrobacterium tumefaciens mediated transformation of Aureobasidium pullulans
(1) Picking single colony on YCK plate, culturing Agrobacterium tumefaciens to logarithmic growth phase OD in 5mL YCK culture medium660Centrifuging to 0.7-0.8 ℃, collecting thalli at 4 ℃, washing with IM liquid culture medium on ice and suspending to OD660About 0.2, and culturing for 8h for later use;
(2) aureobasidium pullulans seeds were inoculated on YPD plates and cultured upside down at 30 ℃ for 2 days. Single colonies were picked and cultured in 5mL YPD medium to logarithmic growth phase, OD600About 0.8 to about 1.0.
(3) The aureobasidium pullulans was filtered with 8 layers of mirror-wiping filter paper and diluted 10 times with sterile water.
(4) Uniformly mixing 100 mu L of diluted aureobasidium pullulans with 100 mu L of agrobacterium tumefaciens for standby culture, uniformly coating the mixture on an IM agar plate with a water-phase microporous filter membrane paved on the surface, co-culturing for 60h at 22 ℃, transferring the microporous filter membrane to an M100 agar plate with proper screening pressure (200mg/L chloramphenicol and 100mg/L hygromycin B), and culturing for 3-6 d at 25 ℃ until transformants appear;
(5) and (3) picking the transformants on the filter membrane to an M100 liquid culture medium containing 3mL double screening pressure (400mg/L chloramphenicol and 200mg/L hygromycin B) to culture for 1-2 d, and extracting the genome. By usingThe primers Hyg-for (GAAAAAGCCTGAACTCACCGC), Hyg-rev (CTATTTCTTTGCCCTCGGACG) were subjected to PCR verification, and the verification results are shown in FIG. 1. The results show that mutant 56#There was a band near 1kb, the size of which was consistent with the target band (1020bp), while the starting strain (WT) had no band.
And sequencing the obtained PCR fragment, wherein the sequencing result shows that in the mutant strain 56#, the Hyg fragment is successfully integrated into the genome of A.pullulans and no mutation occurs. Therefore, the mutant strain is a positive clone which is successfully constructed, and is preserved in China general microbiological culture Collection center on 03.06.2020, with the preservation number of CGMCC No.19650 and the preservation address of No. 3 Hospital No.1 of Xilu, Beijing, Chaoyang.
Example 2: starting strain A. pullulans CCTCC M2012259 and mutant strain A. pullulans CGMCC 19650 are fermented in a shake flask
Seed culture:
the strain (1mL) preserved in an ultra-low temperature refrigerator at-70 ℃ is inoculated into a triangular flask containing 50mL of seed culture medium, and is subjected to shake cultivation at 30 ℃ and 200rpm for 24 hours to obtain a seed solution.
And (3) shaking flask fermentation:
inoculating the seed solution into a fermentation medium according to the inoculation amount of 10% (v/v), and performing shake culture at 30 ℃ and 200rpm for 72 h. Wherein the glucose content in the fermentation medium is 50 g/L.
Starting strain A. pullulans CCTCC M2012259 experiment result: dry cell weight: 8.85-9.23 g/L; yield of β -glucan: 2.02-2.28 g/L; the content of intracellular UDPG is 4.36-4.57 mg/g.
Mutant A. pullulans CGMCC 19650 experiment result: dry cell weight: 13.99-14.55 g/L; yield of β -glucan: 4.31-4.53 g/L; the content of intracellular UDPG is 8.26-8.84 mg/g.
Example 3: starting strain A. pullulans CCTCC M2012259 and mutant strain A. pullulans CGMCC 19650 are fermented in batches
The starting strain A.pullulans CCTCC M2012259 and the mutant strain A.pullulans CGMCC 19650 are used for batch fermentation culture, and the fermentation conditions are as follows: inoculating the seed liquid with 10% (v/v) of inoculum size to 3L fermentation mediumThe culture was carried out in a 5L fermenter with nutrient medium at 30 ℃ and 400rpm with 3L/min aeration for 72 h. The pH was monitored in situ using a Mettler electrode and was measured by automatic feeding of 3mol/L H2SO4Or 3mol/L NaOH solution is used for adjusting the pH value to 3.80 +/-0.02. Wherein the glucose content in the fermentation medium is 50 g/L.
Starting strain A. pullulans CCTCC M2012259 experiment result: dry cell weight: 9.01-9.35 g/L; yield of β -glucan: 2.42-2.81 g/L; the content of intracellular UDPG is 4.60-4.64 mg/g.
Mutant A. pullulans CGMCC 19650 experiment result: dry cell weight: 13.33-13.75 g/L; yield of β -glucan: 4.56-4.77 g/L; the content of intracellular UDPG is 8.54-8.66 mg/g.
Example 4: starting strain A. pullulans CCTCC M2012259 and mutant strain A. pullulans CGMCC 19650 are fermented in batches
According to the fermentation conditions described in example 3, the glucose content in the fermentation medium was 100g/L, and batch fermentation was carried out for 120h using the starting strain A.pullulans CCTCC M2012259 and the mutant strain A.pullulans CGMCC 19650.
Starting strain A. pullulans CCTCC M2012259 experiment result: dry cell weight: 8.68-9.19 g/L; yield of β -glucan: 2.36-2.64 g/L; the content of intracellular UDPG is 5.37-5.49 mg/g.
Mutant A. pullulans CGMCC 19650 experiment result: dry cell weight: 19.65-19.98 g/L; yield of β -glucan: 6.58-6.92 g/L; the content of intracellular UDPG is 8.72-8.76 mg/g.
The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.
Claims (10)
1. The Aureobasidium pullulans with the improved beta-glucan yield is characterized in that the Aureobasidium pullulans is classified and named as Aureobasidium pullulans, is preserved in China general microbiological culture Collection center on 03 months in 2020, with the preservation number of CGMCC No.19650 and the preservation address of No. 3 Siro-1 of the sunward area in Beijing.
2. A method for selectively breeding Aureobasidium pullulans according to claim 1, wherein the method comprises the steps of carrying out genetic transformation on the Aureobasidium pullulans mediated by Agrobacterium tumefaciens, and screening the Aureobasidium pullulans on a plate containing hygromycin and chloramphenicol.
3. Use of aureobasidium pullulans according to claim 1 for the fermentative production of β -glucan.
4. The application of claim 3, wherein the application comprises inoculating aureobasidium pullulans into a seed culture medium for culture to obtain a seed solution, and inoculating the seed solution into a fermentation culture medium for fermentation culture to produce the beta-glucan.
5. The use as claimed in claim 4, wherein the seed culture medium is prepared from potato at 220g/L and glucose at 18-22 g/L.
6. The use of claim 4, wherein the fermentation medium comprises glucose 40-120g/L, yeast powder 2-4g/L, (NH)4)2SO4 0.5-0.7g/L，K2HPO4 1-3g/L，NaCl 0.5-1.5g/L，MgSO4·7H2O 0.1-0.3g/L。
7. The use according to claim 4, wherein the fermentation culture is a batch fermentation.
8. A microbial inoculant comprising the aureobasidium pullulans of claim 1.
9. The microbial inoculant according to claim 8, wherein the microbial inoculant is a solid inoculant.
10. The microbial inoculant according to claim 8, wherein the microbial inoculant is a liquid inoculant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011086751.1A CN112175843B (en) | 2020-10-12 | 2020-10-12 | Aureobasidium pullulans with improved beta-glucan yield and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011086751.1A CN112175843B (en) | 2020-10-12 | 2020-10-12 | Aureobasidium pullulans with improved beta-glucan yield and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112175843A true CN112175843A (en) | 2021-01-05 |
| CN112175843B CN112175843B (en) | 2022-02-01 |
Family
ID=73951130
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011086751.1A Active CN112175843B (en) | 2020-10-12 | 2020-10-12 | Aureobasidium pullulans with improved beta-glucan yield and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112175843B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114015579A (en) * | 2021-08-24 | 2022-02-08 | 天津科技大学 | Aureobasidium pullulans capable of producing beta-glucan in high yield and application of aureobasidium pullulans |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9938550B1 (en) * | 2016-11-30 | 2018-04-10 | Food Industry Research And Development Institute | Aureobasidium pullulans, culturing medium and method for producing β-glucan, a culture of Aureobasidium pullulans and a composition comprising the same |
-
2020
- 2020-10-12 CN CN202011086751.1A patent/CN112175843B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9938550B1 (en) * | 2016-11-30 | 2018-04-10 | Food Industry Research And Development Institute | Aureobasidium pullulans, culturing medium and method for producing β-glucan, a culture of Aureobasidium pullulans and a composition comprising the same |
| CN108118003A (en) * | 2016-11-30 | 2018-06-05 | 财团法人食品工业发展研究所 | Black yeast, culture medium and method for producing β -glucan, and black yeast culture and composition |
Non-Patent Citations (2)
| Title |
|---|
| D WANG等: "Enhanced β-glucan and pullulan production by Aureobasidium pullulans with zinc sulfate supplementation", 《APPL MICROBIOL BIOTECHNOL》 * |
| 朱灿灿: "出芽短梗霉生物合成胞外多糖及其机制研究", 《中国优秀博硕士学位论文全文数据库工程科技Ⅰ辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114015579A (en) * | 2021-08-24 | 2022-02-08 | 天津科技大学 | Aureobasidium pullulans capable of producing beta-glucan in high yield and application of aureobasidium pullulans |
| CN114015579B (en) * | 2021-08-24 | 2023-03-03 | 天津科技大学 | Aureobasidium pullulans capable of producing beta-glucan in high yield and application of aureobasidium pullulans |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112175843B (en) | 2022-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11149048B2 (en) | High-purity D-psicose preparation method | |
| Yang et al. | The influence of environmental conditions on polysaccharide formation by Ganoderma lucidum in submerged cultures | |
| WO2018099366A1 (en) | Bacillus subtilis, culture method therefor and application thereof | |
| CN111484954B (en) | Pseudomonas nigricans for producing alginate lyase | |
| CN110257410B (en) | Gene for encoding algin lyase | |
| CN112175843B (en) | Aureobasidium pullulans with improved beta-glucan yield and application thereof | |
| CN107557407B (en) | Method for regulating and controlling molecular weight of schizophyllan of schizophyllum commune fermentation product | |
| CN102268385A (en) | Arthrobacter for producing cyclic adenosine monophosphate through fermentation and application thereof | |
| CN114540231B (en) | Pediococcus acidilactici for promoting production of flavor substances in fermented food and application thereof | |
| CN112094752A (en) | Method for producing ultra-low molecular weight pullulan by fermenting aureobasidium pullulans | |
| WO2020088458A1 (en) | Method for liquid culture of agaricus bitorquis(quel.)sacc. production mycelium | |
| CN110777135A (en) | Fermentation method for high yield of β -glucan based on sparassis crispa | |
| CN105420160B (en) | A kind of Curdlan producing bacterial strain and its application | |
| CN107488607B (en) | Separation identification and application of bacterial cellulose producing strain | |
| CN115404169A (en) | Cladosporium sp | |
| CN106479899B (en) | A kind of cordyceps militaris link bacterial strain and its preparing the application in cordycepin | |
| CN105441334B (en) | Produce bacterial strain and its application of grifolan | |
| Ramya et al. | Studies on the production and optimization of levan from Bacillus sp | |
| CN111117896A (en) | Cordyceps militaris and application thereof in cordycepin production | |
| CN106319004B (en) | Fermentation medium capable of increasing output of nosiheptide and culture method | |
| CN110903985B (en) | Extracellular polysaccharide with antioxidant and moisturizing activities generated by beauveria bassiana T2-2 and application thereof | |
| WO2012103800A1 (en) | Method for preparing cyclic lipopeptide compound | |
| CN110184231B (en) | Recombinant bacillus subtilis for extracellularly secreting PNAG polysaccharide and application thereof | |
| CN109731015B (en) | Immunity enhancer based on hirsutella sinensis and preparation method | |
| CN107267420B (en) | High-yield β -1, 3-glucan bacillus subtilis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |