CN112175048A

CN112175048A - Antigenic peptide, antibody of infectious laryngotracheitis virus and preparation method thereof

Info

Publication number: CN112175048A
Application number: CN202011066791.XA
Authority: CN
Inventors: 谢晶; 康润敏; 于吉锋; 林毅; 曹冶; 肖璐; 李兴玉; 叶勇刚; 潘梦; 叶健强; 魏勇
Original assignee: SICHUAN ANIMAL HUSBANDRY SCIENCE RESEARCH INSTITUTE
Current assignee: SICHUAN ANIMAL HUSBANDRY SCIENCE RESEARCH INSTITUTE
Priority date: 2020-10-03
Filing date: 2020-10-03
Publication date: 2021-01-05

Abstract

The invention discloses an antigenic peptide, an antibody of infectious laryngotracheitis virus and a preparation method thereof, relates to the technical field of immunity, and particularly relates to the antigenic peptide which can be used for preparing the antibody of anti-infectious laryngotracheitis virus, and the prepared antibody can be specifically combined with the infectious laryngotracheitis virus, so that a way is provided for detecting the infectious laryngotracheitis virus.

Description

Antigenic peptide, antibody of infectious laryngotracheitis virus and preparation method thereof

Technical Field

The invention relates to the technical field of immunity, in particular to an antigenic peptide, an antibody of infectious laryngotracheitis virus and a preparation method thereof.

Background

Infectious laryngotracheitis virus (ILTV), the herpesviridae, is a polar respiratory infectious disease of chickens caused by viruses characterized by dyspnea, cough with exudation with blood, swelling of the laryngeal and tracheal mucosa, bleeding and pseudomembranous formation.

The infectious laryngotracheitis virus is cuboidal, the central part of the infectious laryngotracheitis virus consists of DNA, a layer of envelope containing lipid is arranged outside the infectious laryngotracheitis virus, the infectious laryngotracheitis virus is sensitive to ether, and the size of virus particles is 195-250 nm. The virus is present in large amounts in the tracheal tissue and its exudates of sick chickens, and is less frequent in the liver, spleen and blood.

The natural infection mainly affects chickens, and chickens of various ages can be infected, but most characteristic symptoms can be seen in adult chickens. Poor hygiene and feed management, such as lack of ventilation in chicken houses, excessive flock density, vitamin a deficiency, parasites and their subsequent transport, can induce and promote the spread of the disease.

Infectious laryngotracheitis usually erupts suddenly and spreads in chicken flocks quickly, the infection rate is about 90-100%, and the mortality rate is 5-70%.

At present, the diagnosis is carried out by clinical symptoms such as rhinorrhea, mouth breathing, wheezing, cough, coughing of mucus with blood, hemorrhagic tracheitis and the like and by combining the medical history of chicken flocks, and the diagnosis is difficult to be distinguished from other diseases such as infectious bronchitis, newcastle disease and mycoplasmosis, and has low diagnosis effectiveness.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide an antigenic peptide, an antibody of infectious laryngotracheitis virus and a preparation method thereof.

The invention is realized by the following steps:

in a first aspect, the embodiments provide an antigenic peptide comprising a sequence having an amino acid sequence as shown in SEQ ID No. 1.

In a second aspect, embodiments provide an isolated nucleic acid comprising a nucleic acid encoding an antigenic peptide as described in the previous embodiments.

In a third aspect, embodiments provide a recombinant vector comprising the isolated nucleic acid of the preceding embodiments.

In a fourth aspect, embodiments provide a host cell comprising a recombinant vector as described in the previous embodiments.

In a fifth aspect, embodiments provide a method for making an antibody against an infectious laryngotracheitis virus, comprising: animals were immunized with the antigenic peptides described in the previous examples.

In a sixth aspect, the embodiments provide an antibody against infectious laryngotracheitis virus, which is prepared by the method for preparing the antibody against infectious laryngotracheitis virus described in the previous embodiments.

In a seventh aspect, embodiments provide a reagent for detecting an infectious laryngotracheitis virus, comprising an antibody against an infectious laryngotracheitis virus as described in the preceding embodiments.

In an eighth aspect, embodiments provide a kit for detecting an infectious laryngotracheitis virus, which includes the reagents for detecting an infectious laryngotracheitis virus described in the previous embodiments.

In a ninth aspect, the embodiments provide the use of an antigenic peptide as described in the preceding embodiments or an isolated nucleic acid as described in the preceding embodiments in the manufacture of a kit for detecting an infectious laryngotracheitis virus.

The invention has the following beneficial effects:

the antigenic peptide can be used for preparing an antibody for resisting the infectious laryngotracheitis virus, and the prepared antibody can be specifically combined with the infectious laryngotracheitis virus, so that a new way is provided for detecting the infectious laryngotracheitis virus.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a standard curve chart in example 7.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

First, the embodiment provides an antigenic peptide comprising a sequence having an amino acid sequence as shown in SEQ ID No. 1.

The inventor finds that the antigen peptide can be used as an antigen for preparing an antibody of the infectious laryngotracheitis virus through a series of creative works.

Preferably, the amino acid sequence of the antigenic peptide is shown in SEQ ID No. 1.

The embodiments also provide an isolated nucleic acid comprising a nucleic acid encoding an antigenic peptide as described in any of the preceding embodiments.

The present embodiments also provide a recombinant vector comprising an isolated nucleic acid as described in any of the preceding embodiments.

Embodiments of the invention also provide a host cell comprising a recombinant vector as described in any of the preceding embodiments.

The embodiment of the invention also provides a preparation method of the antibody for resisting the infectious laryngotracheitis virus, which comprises the following steps: immunizing an animal with an antigenic peptide according to any of the preceding embodiments.

In some embodiments, the method of making comprises immunizing an animal with an antigenic peptide as described in any of the preceding embodiments.

Preferably, the antibody is a polyclonal antibody, a monoclonal antibody or an antibody fragment.

The specific preparation processes of polyclonal antibodies and monoclonal antibodies can be obtained by the prior art, and the antibodies prepared by the antigen peptide provided by the invention are all within the protection scope of the application.

The embodiment of the invention also provides an antibody against the infectious laryngotracheitis virus, which is prepared by the preparation method of the antibody against the infectious laryngotracheitis virus according to any embodiment.

In some embodiments, antibodies against infectious laryngotracheitis virus can serve as capture antibodies and/or detection antibodies. Specifically, capture antibodies in the sandwich method, antibodies coated on a solid phase carrier, also called "coated antibodies"; the detection antibody is an antibody for detecting an antigen in the sandwich method, and is usually labeled with biotin, which is also called "labeled antibody".

When the antibody is used for detecting the infectious laryngotracheitis virus in a sample to be detected, the sandwich method, the indirect method or the competitive method of ELISA can be used. When the sandwich method is adopted, the capture antibody can be coated on a solid phase carrier, and after a sample to be detected is added, the detection antibody is adopted for detection.

The embodiment of the invention also provides a reagent for detecting the infectious laryngotracheitis virus, which comprises the antibody against the infectious laryngotracheitis virus in any embodiment.

The embodiment of the invention also provides a kit for detecting the infectious laryngotracheitis virus, which comprises the reagent for detecting the infectious laryngotracheitis virus in the previous embodiment.

In alternative embodiments, the kit further comprises any one of the following reagents or articles: the kit comprises an enzyme label plate, a standard substance, horseradish peroxidase-labeled avidin, biotin-labeled antibody diluent, horseradish peroxidase-labeled avidin diluent, sample diluent, washing liquid, substrate solution and stop solution. The embodiments of the present invention also provide the use of the antigenic peptide of the preceding embodiments or the isolated nucleic acid of the preceding embodiments in the preparation of a kit for detecting an infectious laryngotracheitis virus.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

The present example provides an antigenic peptide, the amino acid sequence of which is shown as SEQ ID No.1, as follows.

5’-gaattccatgagatgtcgacggcagagtcgcagacgcccctattggacgtcaaaattgtagaggtgaagttttcaaacgatggcgaagtaacggcgacttgcgtttccaccgtcaaatctccctatagggtagaaactaattggaaagtagacctcgtagatgtaatggatgaaatttctgggaacagtcccgccggggtttttaacagtaatgagaaatggcagaaacagctgtactacagagtaaccgatggaagaacatcggtccagctaatgtgcctgtcgtgcacgagccattctccggaaccttactgtcttttcgacacgtctcttatagcgagggaaaaagatatcgcgccagagttatactttacctctgatccgcaaacggcatactgcacaataactctgccgtccggcgttgttccgagattcgaatggagccttaataatgtttcactgccggaatatttgacggccacgaccgttgtttcgcataccgctggccaaagtacagtgtggaagagcagcgcgagagcaggcgaggcgtggatttctggccggggaggcaatatatacgaatgcaccgtcctcatctcagacggcactcgcgttactacgcgaaaggagaggtgcttaacaaacacatggattgcggtggaaaacggtgctgctcaggcgcagctgtattca-3’。

Example 2

The embodiment provides an antibody for detecting infectious laryngotracheitis virus, which is prepared from an animal immunized with the antigen peptide provided in embodiment 1, and specifically comprises the following operation steps:

the material and the method are as follows:

cell: SP2/0 is a Balb/c mouse myeloma cell line for fusion.

Animals: balb/c mice were purchased at the research center for laboratory animals in Hubei province, class SPF grade, license number: SCXK (jaw) 2015-0018.

Reagent: the immunogen was the antigen peptide of example 1, PEG1450 was a product of MERCK, DMEM was a high-sugar medium supplied from Thermo, serum was a fetal calf serum of ilex, HAT and G were supplied from Sigma, enzyme-labeled secondary antibody (Rabbit Anti-Rat hold IgG) was supplied from Jackson, and the rest were commercial semi-finished products.

Preparation of hybridomas: immunizing Balb/c mice, adult females about 8 weeks, mixing antigen peptide with equal volume of complete adjuvant (priming) and incomplete adjuvant (boosting), emulsifying, fully mixing to a water-in-oil state, carrying out subcutaneous multipoint immunization, carrying out boosting for 2-3 times, carrying out 2 weeks at intervals of each immunization, carrying out titer detection, carrying out abdominal cavity impact within 1 week after the ratio is higher than 1:10000, and directly dissolving the antigen peptide with the immunization dose into PBS (shown in Table 1).

TABLE 1 immunization

The titer detection method comprises the following steps: the indirect method for detecting the serum titer comprises the following steps:

coating: coating 50 mu l of antigen peptide per well of a 96-well plate according to the concentration of 1 mu g/ml, and keeping the temperature at 37 ℃ for 2 hours or keeping the temperature at 4 ℃ overnight;

and (3) sealing: 2% BSA or 5% skim milk blocking solution 200. mu.l/well, 1 hour at 37 ℃ or overnight at 4 ℃, TBST washing 4 times;

a first antibody: the mouse serum that had been prepared previously was diluted with either a diluent or PBS according to the information shown in table 2.

TABLE 2 dilution

After incubation at 37 ℃ for 1 hour, the plate was washed 4 times, secondary antibody was added, Jackson secondary antibody was diluted 1:10000 with enzyme diluent at 100. mu.l/well, and incubated at 37 ℃ for 1 hour.

And (3) developing after washing the plate for 4 times: adding 100 mu L/hole of the substrate solution, and placing in a constant temperature box at 37 ℃ for 5-10 min;

terminating reaction and carrying out color comparison: adding 30 uL/hole stop solution to turn yellow; the absorbance at 450nm was measured with a microplate reader.

Fusing:

removing eyeball to kill after 3 days of last impact, collecting positive control blood, taking out spleen, preparing into single cell suspension, taking out SP2/0 cell in logarithmic phase, mixing with spleen cell at a certain ratio (1:5-1:10), allowing 50% PEG1450 to act for 1min, diluting with basal medium DMEM, stopping, centrifuging at low speed, gently suspending with HAT medium containing 20% fetal calf serum, mixing, and making into 2 × 10 suspension⁷Plating into a prepared feeder cell plate, and placing in 5% CO₂And culturing at 37 ℃. The method comprises the following specific steps:

1) spleen cells: mice were dissected, immunized spleens were removed, and lymphocytes in the spleens were isolated:

A. a1.5 ml sample tube (tube) was prepared in an ultraclean bench. 1ml of serum-free medium, two 3.5cm dish, 2ml of serum-free medium, two 15ml centrifuge tubes, 10ml of serum-free medium for one of them, surgical instruments (autoclaving), silk screen, pipette (1ml) and pipette tip.

B. The immunized BALB/c mice are taken, the eyeballs are removed for blood collection, and serum is separated to serve as positive control serum during antibody detection. At the same time, mice were sacrificed by cervical dislocation, soaked in 75% alcohol for 5 minutes, fixed on a wax dish, and then the skin on the spleen was cut off, the spleen was removed with forceps and placed in a 1.5ml tube.

C. The spleen was transferred to one of 3.5cm dish in a clean bench, fat and connective tissue on the spleen were removed, washed once, a silk net was laid on the dish lid, and the spleen was gently crushed and placed in the middle of the silk net. Folding the silk net twice, sucking the serum-free culture medium by a pipettor, gently blowing off, grinding by a grinding rod to enable the lymphocytes in the spleen to penetrate through the silk net to prepare single cell suspension, and collecting the single cell suspension in a 15ml centrifuge tube. Centrifuge at 1000rpm for 5 minutes.

2) SP2/0 preparation: taking tumor to separate and prepare single cell suspension, centrifuging at 1000rpm for 5min, then discarding supernatant, resuspending and mixing 10-20ml of DMEM (determined according to tumor size), separating by using lymphocyte separation liquid, wherein the volume ratio of the lymphocyte separation liquid to the DMEM is 1:1, slowly dropping the separation liquid into the resuspended cells, then centrifuging at 2500rpm for 15min, carefully placing on a super clean workbench, transferring the middle layer of milky halo to a new centrifuge tube by using a liquid transfer gun (preparing 30ml of DMEM in the tube in advance), centrifuging at 1000rpm for 5min, finally discarding supernatant, collecting cells in a 10cm culture dish, adjusting the state and expanding the culture by using 10% fetal calf serum, generally preparing 3-5 dishes on the same day of tumor of a mouse, centrifuging and expanding to 30 dishes on the next day, and then freezing and storing 30-35 tubes. In preparation for fusion, the following steps may be followed: resuscitating on the first day; on the next day, the cells were passaged according to the number of fusions, 5 dishes/1 fusion; observing the cell state about two days later, and collecting cells for fusion if the cell state reaches logarithmic phase; preparing feeder layer cells: taking the spleen of a healthy BALB/c mouse under the aseptic condition, preparing a single spleen cell suspension by using HAT culture medium containing 20% fetal bovine serum, and paving the single spleen cell suspension into a 96-well plate in advance according to the number of the plates; stopping liquid: the basal medium DMEM20ml was placed in a 37 degree water bath for incubation.

Cell establishment:

1) detecting a fusion plate:

and (3) starting detection (the detection method is referred to as an attached table ELISA method) when the cells of the liquid change of the fusion plate grow to more than 1 ten thousand cells with medium size, and selecting a positive hole (generally OD450 is more than or equal to 0.5) as a subclone after the ELISA quality control is qualified (namely the negative control is less than 0.2 and the positive control is more than 1.0).

2) Subcloning method and detection:

and (3) selecting holes with high detection positive values in the fusion plate for limited dilution, counting 60% of the number of the monoclonal holes in each plate as subclones, selecting the monoclonal holes with high positive values for limited dilution each time, performing ELISA detection for 5-7 days by each subclone, and performing amplification culture until finally screening monoclonal cell strains capable of stably secreting positive antibodies.

3) Establishing a cell strain:

and (3) expanding and culturing the cell strains which are screened in the subcloning stage and stably secrete positive antibodies in a 24-well plate, collecting supernatant after expansion for antigen detection, verifying the stability by adopting ELISA gradient dilution and WB, collecting cells in a culture dish with the expansion length being more than 10cm, collecting the supernatant again, detecting the titer of the antibodies, selecting higher 1-3 cell strains, culturing the cell strains in a cell bottle, and freezing and storing the cell strains.

4) And (3) freezing and identifying cell strains:

after the cell strain is completely frozen, one cell in the same batch must be recovered for identification, and the identification standard is as follows: firstly, resuscitating the number of living cells to be more than or equal to 100 ten thousand cells/branch; ② viable cells in the viable cells are more than or equal to 50 ten thousand per strain; ③ the revived cells can not have other microorganisms (such as bacteria, fungi, mycoplasma, etc.) except the cells of the cell strain; fourthly, after the cells are revived to grow to a certain number, the grown cells are selected to be used as a monoclonal counting plate, and whether the monoclonal antibody secretion ability is full positive or has antibody secretion is detected; fifthly, the cell culture supernatant is also used for ELISA to determine whether positive antibodies are secreted and simultaneously identify Western blotting.

5) Preparing ascites:

ascites is prepared by intraperitoneal injection of mice with pristane or liquid paraffin, and the hybridoma cells are inoculated into the abdominal cavities of the mice after one week. After cell line is fixed, 10% fetal calf serum culture medium is selected for enlarged culture, and when the cell density reaches 1 × 10⁶-2×10⁶At/ml, the pellet was collected by centrifugation at 800rpm, resuspended in PBS, and then intraperitoneally injected into mice (liquid paraffin), and after 7 to 10 days, ascites were collected and prepared for purification.

Antibody purification:

the collected ascites is purified by Protein G-agarose affinity chromatography column after being pretreated, and the specific steps are as follows:

1) preparing a buffer solution: the starting buffer is pH7.0, 20mmol/L phosphate buffer; the elution buffer was pH2.7, 0.1mmol/L glycine hydrochloric acid.

2) Preparing a collecting pipe: take 1.5ml centrifuge tube, add 70. mu.l of Tris-HCl (1 mol/L) with pH9.0 to each centrifuge tube.

3) Sample preparation: the resulting sample, precipitated with 50% SAS, was dialyzed overnight against the starting buffer and filtered through a 0.22m microfiltration membrane.

4) And (3) purification process: the Protein G-Sepharose affinity column (HiTrap Protein G1 ml, Pharmacia Biotech) was equilibrated with enough starting buffer (8-10 ml). Taking 15-25 ml of a sample to be purified (each milliliter of the sample contains 10.2-21.1 mg of protein) to be loaded on a column at a flow rate of 0.5ml/min, then sequentially washing with 7-8 ml of an initial buffer solution, 6-7 ml of an elution buffer solution and 5ml of the initial buffer solution at the same flow rate, and collecting 1ml of eluent in each tube. And (3) purity and activity identification: the purity of the purified McAb was confirmed by SDS-PAGE.

Antibody specificity verification:

1) indirect ELISA:

for the antibody, an indirect ELISA method was used, and the procedure was verified as follows:

coating: coating the recombinant protein and the virus respectively at the concentration of 2 mu g/ml on a 96-well plate, wherein each well is 50 mu l, and the temperature is 37 ℃ for 2 hours or 4 ℃ overnight;

sealing: 2% BSA or 5% skim milk blocking solution 200. mu.l/well, 1 hour at 37 ℃ or overnight at 4 ℃, TBST washing 4 times;

③ first anti: diluting the purified antibody according to a certain proportion, adding the diluted antibody into a 96-well plate, incubating for 1 hour at 37 ℃ in a way of 100 mu l/well;

fourthly, secondary antibody: the primary antibody was incubated with TBST 4 times, and an enzyme-labeled secondary antibody was added thereto at 100. mu.l/well, followed by incubation at 37 ℃ for 1 hour.

Color development: and (4) washing the incubated secondary antibody with TBST for 4 times, adding 100 mu L/hole of the substrate solution, and placing the mixture in a constant temperature box at 37 ℃ for 5-10 min.

Sixthly, reaction termination and color comparison: adding 30 uL/well stop solution, changing color to yellow and measuring the light absorption value at 450nm by using an enzyme-labeling instrument.

Western Blot：

Preparation of polyacrylamide gel:

1) preparing a 15% separating gel solution: 2.3ml of deionized water, 5ml of 30% acrylamide, 2.5ml of Tris (pH 8.8), 100. mu.L of 10% ammonium persulfate and 100. mu. L, TEMED 6. mu.L of 10% SDS (after TEMED is added, the separation gel immediately starts to polymerize, so the separation gel is quickly and uniformly mixed immediately);

2) quickly adding a separating glue solution into the gap between the two glass plates, reserving a space for filling the concentrated glue, and carefully covering a layer of isopropanol on the separating glue solution;

3) after the separation gel is completely polymerized, draining the liquid on the gel as far as possible, and then completely sucking the residual liquid by using the edge of a paper towel;

4) preparing a concentrated gel solution with the concentration of 5 percent: 2.7ml of deionized water, 500 mu L of 30% acrylamide 670 mu L, PH 8.8.8 Tris, 40 mu L of 10% ammonium persulfate and 40 mu L, TEMED 6 mu L of 10% SDS are sequentially added (after TEMED is added, the separation gel immediately starts to polymerize, so the separation gel is quickly and uniformly mixed immediately);

5) pouring the concentrated gel directly on the polymerized separating gel, and immediately inserting a clean comb (carefully avoiding air bubbles) into the concentrated gel solution;

6) after the gel was polymerized completely, the comb was carefully removed and the protein electrophoresis buffer was added to the electrophoresis tank.

Preparation of a sample:

1) the cells were cultured to 10⁷Collecting cells into a 15ml centrifuge tube, centrifuging at 2000rpm for 5min, and removing supernatant;

2) washing the culture medium twice, centrifuging at 2000rpm for 5min, and removing the supernatant;

3) after collecting cells, 1ml PBS, 0.1% NP40 was added and lysed on ice for 10 min;

4) centrifuging at 10000rpm for 5min, collecting supernatant, adding equal volume of 2 × loading buffer (protein loading buffer), boiling in water for 5min, packaging, and storing at-20 deg.C.

Electrophoresis:

1) mixing a sample to be detected (10. mu.L) with a 2 × (or 6 ×) loading buffer (10. mu.L), slowly adding 15. mu.L of the mixture into a sample tank by using a pipette gun, and pre-staining 10. mu.L of a marker in general;

2) turning on a power supply, and adopting a voltage of 200V to carry out electrophoresis until the bromophenol blue loading buffer solution migrates to the bottom of the gel in the gel;

3) cutting off power supply, taking out gel, soaking the gel in R250 Coomassie brilliant blue, dyeing, and boiling for 5 min;

4) taking out the dyed gel, soaking the gel in tap water for decolorization, boiling for about 20min, and observing the decolorized protein bands.

Film transfer:

1) taking the glue, cutting the glue into a proper size, and immersing the glue into a film buffer;

2) soaking the PVDF membrane in methanol for 1min, transferring into a membrane transfer buffer, and soaking filter paper into the membrane transfer buffer (the PVDF membrane and the filter paper are cut into the same size as the glue);

3) leaching the graphite electrode by using a membrane conversion buffer solution, laying two pieces of filter paper, and dripping a little of the membrane conversion buffer solution;

4) spreading a membrane, and dripping a small amount of membrane transfer buffer solution; spreading glue, and dripping a little of membrane transfer buffer (taking care not to generate bubbles);

5) finally, laying two pieces of filter paper, and dripping a little of membrane buffer;

6) covering the electrode, and adjusting the voltage to the maximum value at 1.5mA/cm²The gel volume is transferred to the membrane for 1.5h (the load voltage is not suitable to exceed 1V/cm)²)。

And (3) sealing:

1) the membrane was removed and washed three times with PBST, 5min each time (shaking on a horizontal shaker);

2) taking out the membrane, and immersing in a confining liquid at 37 ℃ and overnight at 2h or 4 ℃ (the confining liquid is 1% casein or 2% OVA);

binding of antibody:

2) the membrane was removed and soaked in primary antibody dilution diluted with 1% casein at 37 ℃, 1h (typically primary antibody dilution 1:1000) (ii) a

3) The membrane was removed and washed three times with PBST, 5min each time (shaking on a horizontal shaker);

4) taking out the membrane, soaking in a secondary antibody diluent diluted with 1% casein at 37 deg.C for 1 hr;

(goat anti-mouse-HRP 1: 3000-1: 5000, goat anti-rabbit-HRP 1: 15000).

Exposure:

1) diluting A, B luminous liquid in equal proportion, mixing (each 500ml), placing the film on a preservative film, uniformly dripping the AB mixed liquid on the film, covering the preservative film, and standing for 1 min;

2) opening the preservative film, sucking residual liquid on the surface by using filter paper, and fixing the preservative film in a cassette;

3) placing the cassette in a dark room, taking out the film, quickly placing the film on the inner film of the cassette, closing the cassette, and exposing according to the intensity of the visible fluorescence (the exposure time is 1min, and if the strip is weak, the sheeting can be selected overnight);

4) opening the cassette, taking out the film, and immediately and completely immersing the film in the developing solution for 1 min;

5) and taking out the film, soaking the film into the fixing solution for 1min after rinsing with deionized water, taking out the film, rinsing with deionized water, drying, calibrating a Marker, and analyzing an experimental result.

Example 3

The embodiment provides a kit for detecting infectious laryngotracheitis virus, which comprises the following components.

Microplate (Assay plate): 12X 8 holes;

standard (Standard): 2 bottles (lyophilized);

biotin-labeled detection antibody (Biotin-antibody, antibody prepared by the method in example 2): 1X 120. mu.L/bottle (100X);

horse radish peroxidase-labeled avidin (HRP-avidin): 1X 120. mu.L/bottle (100X);

biotin-labeled antibody Diluent (Biotin-antibody Diluent): 1 × 15 mL/bottle;

horse radish peroxidase-labeled avidin dilution (HRP-avidin dilution): 1 × 15 mL/bottle;

sample dilution (Sample Diluent): 1 × 50 mL/bottle;

concentrated Wash (Wash Buffer): 1 × 20 mL/bottle (25 ×);

substrate solution (TMB Substrate): 1 × 10 mL/bottle;

stop Solution (Stop Solution): 1 × 10 mL/bottle;

plate pasting: 4.

reagent configuration

And (3) standard substance: one standard was removed from the kit and centrifuged at 10000rpm for 30 s. Dissolving with 1mL of sample diluent, repeatedly sucking and beating the bottom of the freezing storage tube for 5 times by using a gun head to assist the dissolution, fully and uniformly mixing to obtain a standard product S7(1000ng/mL), and standing for later use.

7 1.5mL centrifuge tubes (the concentrations of the standard substances corresponding to S6-S0 are 500ng/mL, 250ng/mL, 125ng/mL, 62.5ng/mL, 31.25ng/mL, 15.625ng/mL and 0 in sequence) are arranged in sequence, 250 microliter of sample diluent is added into each centrifuge tube, 250 microliter of the standard substance S7 is sucked into the first centrifuge tube (S6), and the mixture is lightly blown and beaten and mixed evenly. Suck 250 μ L from S6 into a second EP tube (S5), gently blow and mix, and so on to dilute the standard by multiple times, S0 is the sample diluent.

Washing liquid working solution: the concentrated washing solution is diluted by deionized water according to the proportion of 1: 25. If the dosage tube is used, 240mL of deionized water is measured, poured into a beaker or other clean container, 10mL of concentrated washing solution is measured, added uniformly, stirred and mixed uniformly, and prepared before use. The concentrated washing solution can be salted out when stored at low temperature, and can be heated in a water bath to assist dissolution when diluted.

Biotin-labeled antibody working solution: the biotin-labeled antibody solution was diluted 1:100 times with a biotin-labeled antibody diluent. For example, 10. mu.L of biotin-labeled antibody is mixed with 990. mu.L of biotin-labeled antibody dilution, and the mixture is gently mixed and prepared within 10 minutes before use.

Horse radish peroxidase-labeled avidin working solution: and diluting the horse radish peroxidase labeled avidin with a horse radish peroxidase labeled avidin diluent at a ratio of 1: 100. For example, 10. mu.L of horse radish peroxidase labeled avidin and 990. mu.L of horse radish peroxidase labeled avidin diluent are mixed gently and mixed well within 10min before use.

Example 4

Sample collection and preservation

1. Serum: the whole blood specimen is required to be placed at room temperature for 2h or at 4 ℃ overnight, then centrifuged at 1000 Xg for 15min at 2-8 ℃, and the supernatant is taken for immediate detection; or subpackaging, and storing at-20 deg.C or-80 deg.C, but avoiding repeated freeze thawing; the thawed sample should be centrifuged again and then examined.

2. Plasma: EDTA or heparin can be used as anticoagulant, the collected sample is centrifuged for 15min at 1000 Xg and 2-8 ℃ within 30min, the supernatant can be immediately detected or subpackaged, and the sample is preserved at-20 ℃ or-80 ℃ without repeated freeze thawing; the thawed sample should be centrifuged again and then examined.

3. Cell culture supernatant: centrifuging the sample at 2-8 deg.C for 15min at 1000 Xg, collecting supernatant, and immediately performing experiment or subpackaging and storing at-20 deg.C or-80 deg.C to avoid repeated freeze thawing.

4. Urine: collecting urine with a sterile tube, centrifuging at 2-8 deg.C and 1000 Xg for 15min, collecting supernatant, and storing at-20 deg.C or-80 deg.C after the supernatant is immediately used in experiment or subpackaged; repeated freeze thawing is avoided. Centrifugation was performed again prior to the assay to remove some of the sediment that may have occurred during sample storage.

5. Tissue lysate: 100mg of the tissue was washed with 1 XPBS to remove blood stains. Cut into small pieces and put into a tissue grinder (homogenizer tube), 1mL of 1 XPBS was added to prepare a homogenate, which was then left at-20 ℃ overnight. After cell membranes are destroyed by repeated freeze thawing for 2 times, the tissue homogenate is centrifuged for 5min at 5000 Xg at 2-8 ℃ to obtain supernatant. Taking appropriate amount of supernatant, and immediately performing experiment, or separately storing at-20 deg.C or-80 deg.C. Centrifuging the unfrozen sample again, and then detecting; repeated freeze thawing is avoided.

6. Saliva sample: soaking a cotton swab sample in 3ml of PBS (phosphate buffer solution) at 4 ℃ overnight, squeezing the head of the cotton swab by using a pair of tweezers to squeeze out liquid in the cotton swab as much as possible, removing the cotton swab, centrifuging at 3000rpm for 10min, and taking supernatant to be measured.

Note: hemolysis of the sample affects the final assay result, and therefore, it is not suitable for such assay.

Example 5

This example provides a method for detecting an infectious laryngotracheitis virus, using the kit provided in example 3, comprising: and sequentially adding a specimen/standard substance, a biotinylated detection antibody and HRP-labeled avidin into the micropores coated with the capture antibody, washing and developing with a substrate solution. The substrate liquid is converted into blue color under the catalysis of peroxidase and is converted into final yellow color under the action of acid. The shade of the color was positively correlated with laryngotracheal virus in the sample.

The method specifically comprises the following steps.

(1) Coating the capture antibody (prepared by the method provided by the embodiment 2) on a 96-well enzyme label plate to prepare a solid phase carrier, wherein the coating concentration is 2 mu g/ml, and the coating concentration is at 37 ℃, 2h or 4 ℃ overnight;

(2) adopting 5% skimmed milk as sealing solution, 200 μ l/hole, standing overnight at 37 deg.C or 4 deg.C, and washing with washing buffer (TBST) for 4 times;

(3) adding standard substances and/or samples to be tested with different concentrations (such as S7-S0: 5. mu.g/ml, 2.5. mu.g/ml, 1.25. mu.g/ml, 0.625. mu.g/ml, 0.3125. mu.g/ml, 0.15625. mu.g/ml and 0.078125. mu.g/ml) into the micro-wells, 100. mu.L/well, 37 ℃ for 2 h;

(4) adding the biotin-labeled detection antibody into 96 holes according to a dilution ratio, wherein the concentration of the biotin-labeled detection antibody is 90 mu L/hole, and the temperature is 37 ℃ for 1 h;

(5) HRP-labeled avidin (HRP-avidin) was added to the microwells using a concentration of 1:4000, 90 mu L/hole, 37 ℃, 1 h;

(6) adding substrate solution (TMB) into the micropore with a volume of 90 μ L/hole, standing at 37 deg.C for 10 min;

(7) adding stop solution according to 30 mu L/hole, and measuring the light absorption value of 450nm by using an enzyme-labeling instrument.

Example 6

Set 2 experimental groups, and both group 1 and group 2 tested standards at different concentrations according to the method of example 5, with the difference between the capture antibody and the detection antibody.

Group 1:2 of the antibodies (1D8 antibody and 1G3, 2. mu.g/mL CB-packet) prepared in example 2 were used as capture antibodies, and 2 of the antibodies (1E3 antibody and 1C6 antibody; 1:1000) prepared in example 2 were used as detection antibodies;

group 2: capture antibody was used (1E3 and 1C6, 2 μ G/mL CB direct package), detection antibody was used 1D8 and 1G 3; 1:1000).

The test results of group 1 are shown in Table 3, and the test results of group 2 are shown in Table 4.

TABLE 3 test results

TABLE 4 test results

Concentration of standard substance	OD1 value	OD2 value	Mean OD
				5μg/ml	3.2436	3.1935	3.2186
2.5μg/ml	2.8741	2.7965	2.8353
				1.25μg/ml	2.2236	2.1847	2.2042
0.625μg/ml	1.5418	1.5961	1.5690
				0.3125μg/ml	0.8641	0.8429	0.8535
0.15625μg/ml	0.3915	0.3848	0.3882
				0.078125μg/ml	0.1927	0.1869	0.1898
0μg/ml	0.1879	0.1746	0.1813

As can be seen from the results in tables 3 and 4, the detection results in group 1 were superior to those in group 2, i.e., when the 1D8 antibody was used as the capture antibody and the 1E3 antibody was used as the capture antibody, the detection sensitivity and the test value were better.

Setting of a standard curve:

chessboard titration experiments were performed according to the method described in panel 1 above, using different coating concentrations of the coating antibodies (1D8 and 1G3), the concentrations of the detection antibodies (1E3 and 1C6), and the concentration of HRP-avidin.

Specifically, the antibodies to be tested were coated at 1. mu.g/ml, 2. mu.g/ml and 4. mu.g/ml as indicated in Table 4, and the ratio of the detection antibody 1E3 was set to 1: 1000. 1: 2000; 1:4000 and 1: 8000, please refer to table 5 for the setting conditions and the corresponding test results.

TABLE 5 chessboard titration results

And (5) adjusting a standard curve.

Different concentrations of coating antibody (1D8 and 1G 32. mu.g/ml) and detection antibody (1E3 and 1C6) were set, and the standard curve was optimized, see Table 6.

TABLE 6 test results

From the test results in table 6, the calibration curve is better, the detection sensitivity of the calibration curve is higher, the calibration curve is continuously adjusted downwards, the highest point is adjusted downwards to 1 μ g/ml, and the calibration is performed again, please refer to table 7.

TABLE 7 test results

As can be seen from Table 7, the calibration curve is good, R²>0.99, zero well background was also low.

The dilution ratio of each parameter of the standard curve was preliminarily confirmed, and the parameters of the standard curve were confirmed for the last time, the coating concentration of the coated antibody (1D8 and 1G3) was set to 2 μ G/ml, and the dilution ratio of the test antibody (1E3 and 1C6) was set to 1:4000, concentration of HRP set to 1:4000, please refer to table 8 for the detection results.

TABLE 8 test results

Combining the standard curve property and the sample measuring result, selecting a coating antibody with the concentration of 2 mu g/ml for coating, and detecting the optimal effect of the detection antibody under the condition of dilution of 1: 4000.

Example 7

The stability of the antibody prepared by the preparation method of example 2 was examined.

2 sets of the coated plates (coated with 1D8 and 1G3, 2 mug/ml coating), the standard substance (freeze-dried powder) and the intermediate concentration assay antibody (1E3 and 1C6, 1:4000) are respectively placed in an incubator at 37 ℃, and one set is taken out after 4 days and one set is taken out after 7 days.

The comparison of the thermally destroyed 2 sets of materials with the 4 ℃ placed materials was performed according to the method provided in example 5 (group 1) and the rate of decrease in OD was calculated, see Table 9.

TABLE 9 stability test results

The thermal stability is reduced by less than 30 percent in 4 days, which proves that the thermal stability of the antibody is qualified.

Precision verification (batch within batch interval)

A. Intra-batch coefficient of variation: the requirement is less than or equal to 8 percent;

the method comprises the following steps: the high, medium and low concentrations are tested 24 parts each, and the standard deviation/average value multiplied by 100 percent is used as the coefficient of variation value.

B. Inter-batch coefficient of variation: the requirement is less than or equal to 10 percent;

The detection method comprises the following steps: the coating concentration of the coating antibody (1D8 and 1G3) was set to 2 μ G/ml, and the dilution ratio of the test antibody (1E3 and 1C6) was set to 1:4000, concentration of HRP set to 1: 4000. for the results of the inter-lot partial testing, see tables 10 and 11.

TABLE 10 in-batch test results

TABLE 11 results of the inter-batch assays

The results of the labeling are shown in FIG. 1. In FIG. 1, the ratio functional: y ═ a + bx)/(1+ cx + dx²)；coefficient data：

a＝-1.172669829；

b＝143.9440102；

c＝0.004963373；

d＝-0.068269255。

From the results of the tests, it was found that the intra-lot to intra-lot difference CV% was < 8% and the inter-lot difference CV% was < 10%.

The lowest detection limit is:

generally satisfying 1/2 at the lowest concentration of the standard curve. The formula: the mean value plus 2-fold standard deviation was determined for 20 blank samples. Detection range: 15.625-1000 ng/ml. The detection sensitivity of the antibody prepared by the preparation method of example 2 was 8.42 ng/ml.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> institute of science of livestock husbandry of Sichuan province

<120> an antigenic peptide, an antibody of infectious laryngotracheitis virus and a preparation method thereof

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 693

<212> DNA

<213> Artificial sequence

<400> 1

gaattccatg agatgtcgac ggcagagtcg cagacgcccc tattggacgt caaaattgta 60

gaggtgaagt tttcaaacga tggcgaagta acggcgactt gcgtttccac cgtcaaatct 120

ccctataggg tagaaactaa ttggaaagta gacctcgtag atgtaatgga tgaaatttct 180

gggaacagtc ccgccggggt ttttaacagt aatgagaaat ggcagaaaca gctgtactac 240

agagtaaccg atggaagaac atcggtccag ctaatgtgcc tgtcgtgcac gagccattct 300

ccggaacctt actgtctttt cgacacgtct cttatagcga gggaaaaaga tatcgcgcca 360

gagttatact ttacctctga tccgcaaacg gcatactgca caataactct gccgtccggc 420

gttgttccga gattcgaatg gagccttaat aatgtttcac tgccggaata tttgacggcc 480

acgaccgttg tttcgcatac cgctggccaa agtacagtgt ggaagagcag cgcgagagca 540

ggcgaggcgt ggatttctgg ccggggaggc aatatatacg aatgcaccgt cctcatctca 600

gacggcactc gcgttactac gcgaaaggag aggtgcttaa caaacacatg gattgcggtg 660

gaaaacggtg ctgctcaggc gcagctgtat tca 693

Claims

1. An antigenic peptide, characterized in that it comprises a sequence whose amino acid sequence is shown in SEQ ID No. 1.

2. An isolated nucleic acid comprising a nucleic acid encoding the antigenic peptide of claim 1.

3. A recombinant vector comprising the isolated nucleic acid of claim 2.

4. A host cell comprising the recombinant vector of claim 3.

5. A method for producing an antibody against an infectious laryngotracheitis virus, comprising: immunizing an animal with the antigenic peptide of claim 1.

6. The method of producing an antibody against infectious laryngotracheitis virus according to claim 5, comprising immunizing an animal with the antigenic peptide of claim 1;

7. An antibody against infectious laryngotracheitis virus, which is produced by the method for producing an antibody against infectious laryngotracheitis virus according to claim 6.

8. An agent for detecting an infectious laryngotracheitis virus, comprising the antibody against an infectious laryngotracheitis virus according to claim 7.

9. A kit for detecting an infectious laryngotracheitis virus, comprising the reagent for detecting an infectious laryngotracheitis virus according to claim 8.

10. Use of the antigenic peptide of claim 1 or the isolated nucleic acid of claim 2 in the preparation of a kit for detecting an infectious laryngotracheitis virus.