CN112159852A - Specific molecular marker, detection primer and kit for sex chromosomes of nibea albiflora and application of specific molecular marker, detection primer and kit - Google Patents
Specific molecular marker, detection primer and kit for sex chromosomes of nibea albiflora and application of specific molecular marker, detection primer and kit Download PDFInfo
- Publication number
- CN112159852A CN112159852A CN202011171045.7A CN202011171045A CN112159852A CN 112159852 A CN112159852 A CN 112159852A CN 202011171045 A CN202011171045 A CN 202011171045A CN 112159852 A CN112159852 A CN 112159852A
- Authority
- CN
- China
- Prior art keywords
- spotted maigre
- molecular marker
- sex
- chromosome
- detected
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific molecular marker, a detection primer, a kit and application of sex chromosomes of spotted maigre. The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, and the molecular marker exists on the X chromosome of the spotted maigre but is deleted on the Y chromosome. Female spotted maigre with the genetic sex of XX type has the nucleotide sequence shown in SEQ ID NO. 1, while male spotted maigre with the genetic sex of XY type only has the nucleotide sequence shown in SEQ ID NO. 1 on the X chromosome, and the nucleotide sequence shown in SEQ ID NO. 1 is deleted on the Y chromosome. In view of the XX/XY type sex determination system of the nibea albiflora, the molecular marker can simply, quickly, accurately and stably identify the genetic sex of embryos, larvae and adult fish in each colony of the nibea albiflora, and lays a foundation for realizing parthenocarpy breeding, cultivation and related genetics basic research of the nibea albiflora. Has important application value in sex control breeding and large-scale production of the nibea albiflora.
Description
Technical Field
The invention relates to the field of molecular markers, in particular to a specific molecular marker, a detection primer and a kit for sex chromosomes of spotted maigre and application thereof.
Background
The fish is one of main aquaculture objects in China, most fish varieties have sex difference in growth rate and individual size, for example, male individuals such as tilapia, pelteobagrus fulvidraco and the like grow more than 40% faster than female individuals, and female individuals of the varieties such as cynoglossus semilaevis, paralichthys olivaceus and the like grow 40% -100% faster than male individuals. The development of sex chromosome specific molecular markers is beneficial to the early development of genetic sex identification and sex control breeding of the fish varieties, meanwhile, the fish lack of the special-shaped sex chromosomes, and the development of the sex chromosome specific molecular markers has important scientific significance for the development of fish sex chromosome research.
The spotted maigre is one of the important mariculture objects in China, and is a high-quality economic fish with higher development value. The spotted maigre has obvious gender bimorph, the growth rate of a female individual is far faster than that of a male individual, the weight of the female individual of the spotted maigre of 15 months old is 1.31 times that of the male individual, the yield can be greatly improved on the premise of not increasing the culture scale by carrying out the full-female culture of the spotted maigre, and meanwhile, theoretical research in the field of gender determination mechanism can be enriched by analyzing the gender determination molecular mechanism of the spotted maigre.
In conclusion, the development of an economic, rapid and accurate method for identifying the genetic sex of the nibea albiflora is of great significance for carrying out sex control breeding and scientific research on genetic sex.
Disclosure of Invention
The invention aims to provide a molecular marker for identifying and identifying sex chromosomes of nibea albiflora, which is beneficial to quickly, simply, conveniently and accurately identifying the genetic sex of the nibea albiflora and establishes a foundation for smoothly carrying out sex control breeding work of the nibea albiflora and developing parthenocarpy culture.
In order to achieve the purpose, the invention provides a spotted maigre sex chromosome specific molecular marker which is characterized in that the nucleotide sequence of the molecular marker is a sequence shown as SEQ ID NO. 1, and the molecular marker exists on the X chromosome of spotted maigre but is deleted on the Y chromosome.
The invention provides a primer pair for detecting the molecular marker, which is characterized in that the primer pair is a nucleotide sequence shown in SEQ ID NO. 2-3.
Further, carrying out PCR amplification on genome DNA of the spotted maigre to be detected by utilizing the primers with the SEQ ID NO of 2-3, and detecting the length of an amplification fragment, wherein when an amplification product appears and the amplification fragment is only 879bp, the spotted maigre to be detected only contains an X chromosome, has a nucleotide sequence shown in SEQ ID NO of 1, and is the spotted maigre with female genetic sex; when the amplified fragments appear and are 879bp and 441bp, the spotted maigre to be detected contains a Y chromosome which lacks the nucleotide sequence shown in SEQ ID NO. 1 and is spotted maigre with male genetic sex.
The invention also provides a kit for detecting the molecular marker, which is characterized by comprising the primer pair.
The invention also protects the application of the molecular marker, the primer pair or the kit in the breeding of the nibea albiflora.
The invention also provides a method for identifying the gender of the spotted maigre, which is characterized in that the molecular marker is detected for the spotted maigre to be detected so as to determine the genetic gender of the spotted maigre to be detected.
Further, the method comprises:
carrying out PCR amplification on the genomic DNA of the spotted maigre to be detected by using the primer pair or the kit;
detecting the length of the amplified fragment, and
determining the genetic sex of the spotted maigre to be detected based on the length of the expanded fragment,
when the amplified fragment only has a 879bp amplified fragment, the spotted maigre to be detected only contains an X chromosome, has a nucleotide sequence shown as SEQ ID NO. 1, and is a spotted maigre with female genetic sex; when the amplified fragments are 879bp and 441bp, the spotted maigre to be detected contains a Y chromosome which lacks the nucleotide sequence shown in SEQ ID NO. 1 and is spotted maigre with male genetic sex.
Further, the length of the amplified fragment is detected by agarose gel electrophoresis or polyacrylamide gel electrophoresis.
The invention also provides an auxiliary breeding method of spotted maigre, which is characterized by comprising the following steps: through the method, the molecular marker is detected so as to determine the genetic sex of the spotted maigre to be detected.
The invention has the beneficial effects that: the genetic sex of different individuals in each group of the spotted maigre can be simply, quickly and stably identified, wherein the genetic sex comprises a culture group of the spotted maigre, a wild group in the east China sea and a wild group in the south China sea. The DNA molecular marker is applied to production practice, so that the genetic sex of the spotted maigre in various developmental stages can be effectively identified and identified, the identification of normal male, normal female, pseudo-male (physiological male), pseudo-female (physiological female) and super-male of the spotted maigre is facilitated, the development of the unisexual breeding technology of the spotted maigre is further promoted, the breeding benefit is further improved, and the economic benefit of spotted maigre breeding is increased. The molecular marker developed by the invention is also beneficial to the development of related scientific researches such as the determination of molecular mechanism of the sex of the spotted maigre and the like.
Drawings
FIG. 1 is a diagram showing the alignment analysis of the sequence differences of sex chromosomes X and Y of spotted maigre in this region.
FIG. 2 is a diagram of electrophoresis results of genetic SEX determination of 8 male fish and 8 female fish in Nibea albiflora culture population by applying YD-SEX-F/R primers.
FIG. 3 is a diagram of electrophoresis results of genetic SEX determination of 8 male fish and 8 female fish in the east-sea wild colony of spotted maigre by applying YD-SEX-F/R primers.
FIG. 4 is a diagram of electrophoresis results of genetic SEX determination of 8 male fish and 8 female fish in a southern sea wild colony of spotted maigre by applying YD-SEX-F/R primers.
Detailed Description
Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
Example 1 sex chromosome specific molecular marker of spotted maigre
By utilizing the transcriptome and genome data of the nibea albiflora, the relative gene male and female difference in the genome of the nibea albiflora is compared and analyzed, and the stable difference of the gene structures of the female fish and the male fish is found.
The existing research results show that the spotted maigre is an XY type chromosome system, and the results of genome sequence alignment analysis show that 438bp insertion deletion exists on an X chromosome and a Y chromosome in the spotted maigre genome shown in figure 1. As can be seen in FIG. 1, there is a 438bp insertion on chromosome X and a 438bp deletion on chromosome Y.
Example 2: detection of 8-tailed male fish and 8-tailed female fish in Nibea albiflora culture population
Cutting part of fin line of spotted maigre to be detected, putting into 95% alcohol solution, preserving at-20 ℃ for extracting genome DNA and identifying genetic sex, and dissecting gonad to observe physiological sex of each individual and recording. The result of sex determination was determined by the size of the amplified band.
A detection step:
(1) respectively taking partial tissues or cells of the spotted maigre to be detected, and extracting genome DNA;
(2) taking the genomic DNA extracted in the step (1) as a template, and carrying out PCR amplification by using YD-SEX-F/R primers (namely SEQ ID NO:2 and SEQ ID NO: 3);
YD-SEX-F:CACTTCTTGAGACCAGATTGTACAG SEQ ID NO:2；
YD-SEX-R:ACCTTGAAGTATTTCCGTGACAG SEQ ID NO:3。
PCR amplification System:
the PCR amplification reaction program is as follows: 5-10min at the temperature of above 95 ℃; denaturation at about 95 ℃ for 30s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 40s, and extension at 72 ℃ for 5-10min after 30-35 cycles; and finally storing at 10 ℃.
(3) And (3) detecting the PCR reaction product in the step (2) by using an agarose gel electrophoresis method, and judging the genetic sex of the detected individual according to the number and the size of bands in gel imaging.
The results are shown in FIG. 2, and it can be seen from FIG. 2 that a specific band 879bp on X chromosome and a specific band 441bp on Y chromosome are amplified in all male individuals of spotted maigre to be detected, while only the band 879bp on X chromosome is amplified in female individuals. Completely consistent with the actual situation.
In addition to the above verification, the applicant also identified the genetic sex of 100 spotted maigre for whole genome association analysis, which is consistent with the actual situation.
Example 3: detection of 8-tailed male fish and 8-tailed female fish in east-sea wild colony of nibea albiflora
Cutting part of fin line of spotted maigre to be detected, putting into 95% alcohol solution, preserving at-20 ℃ for extracting genome DNA and identifying genetic sex, and dissecting gonad to observe physiological sex of each individual and recording. The result of sex determination was determined by the size of the amplified band.
The procedure was as in example 1.
The results are shown in FIG. 3, and it can be seen from FIG. 3 that a specific band 879bp on X chromosome and a specific band 441bp on Y chromosome are amplified in all male individuals of spotted maigre to be detected, while only the band 879bp on X chromosome is amplified in female individuals. Completely consistent with the actual situation.
Example 4: detection of 8-tailed male fish and 8-tailed female fish in southern sea wild colony of nibea albiflora
Cutting part of fin line of spotted maigre to be detected, putting into 95% alcohol solution, preserving at-20 ℃ for extracting genome DNA and identifying genetic sex, and dissecting gonad to observe physiological sex of each individual and recording. The result of sex determination was determined by the size of the amplified band. The procedure was as in example 1.
The results are shown in FIG. 4, and it can be seen from FIG. 4 that a specific band 879bp on X chromosome and a specific band 441bp on Y chromosome are amplified in all male individuals of spotted maigre to be detected, while only the band 879bp on X chromosome is amplified in female individuals. Completely consistent with the actual situation.
Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made in the above embodiments by those of ordinary skill in the art without departing from the principle and spirit of the present invention.
SEQUENCE LISTING
<110> college university
<120> specific molecular marker, detection primer and kit for sex chromosomes of spotted maigre and application thereof
<130> JMDXL-20026-CNI
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 438
<212> DNA
<213> Nibea albiflora
<400> 1
tcacggttgt caggggcgac cggctgcctc tgccttgtcc ttctgtagct gctgctgccc 60
tgtgtacagc acaggggaga aagtgtcaca ggattggttt tccttgagct gcctctgcct 120
ccatgaatca tgccatccca taatagatca aatctgctcg gatcccaccg tgacacctcc 180
tggtggagag tgatggctgc tcgatacaga cggaaggcgc ggaagagtac agtacaagct 240
caagagtgaa gagggaaact tgaaaaactt tggatatgtg catacctgat gatgtcactt 300
tcttaaattt catatgatgc caccaagttt tacacacagt acctaatttg tatttgtact 360
ttgcaatctt tgcaagatca gattatacaa gatcagattg ccttcaagga attgtgggac 420
ggcatcacaa atatttgt 438
<210> 2
<211> 25
<212> DNA
<213> Artificial Synthesis
<400> 2
cacttcttga gaccagattg tacag 25
<210> 3
<211> 23
<212> DNA
<213> Artificial Synthesis
<400> 3
accttgaagt atttccgtga cag 23
Claims (9)
1. A spotted maigre sex chromosome specific molecular marker is characterized in that the nucleotide sequence of the molecular marker is a sequence shown as SEQ ID NO. 1, and the molecular marker exists on an X chromosome of spotted maigre but is deleted on a Y chromosome.
2. A primer pair for detecting the molecular marker of claim 1, wherein the primer pair is a nucleotide sequence shown as SEQ ID NO. 2-3.
3. The primer pair of claim 2, wherein the primer pair SEQ ID NO 2-3 is utilized to perform PCR amplification on genomic DNA of spotted maigre to be detected, the length of an amplified fragment is detected, and when an amplified product appears and the amplified fragment is only 879bp, the spotted maigre to be detected only contains an X chromosome, has a nucleotide sequence shown as SEQ ID NO 1, and is spotted maigre with female genetic sex; when the amplified fragments appear and are 879bp and 441bp, the spotted maigre to be detected contains a Y chromosome which lacks the nucleotide sequence shown in SEQ ID NO. 1 and is spotted maigre with male genetic sex.
4. A kit for detecting the molecular marker of claim 1, comprising the primer pair of claim 2 or 3.
5. Use of the molecular marker of claim 1, the primer pair of claim 2 or 3, or the kit of claim 4 for breeding Nibea albiflora.
6. A method for identifying the sex of spotted maigre, which is characterized in that the detection of the molecular marker in claim 1 is carried out on spotted maigre to be detected so as to determine the genetic sex of the spotted maigre to be detected.
7. The method of claim 6, wherein the method comprises:
performing PCR amplification on the genomic DNA of the spotted maigre to be detected by using the primer pair of claim 2 or 3 and the kit of claim 4;
detecting the length of the amplified fragment, and
determining the genetic sex of the spotted maigre to be detected based on the length of the expanded fragment,
when the amplified fragment only has a 879bp amplified fragment, the spotted maigre to be detected only contains an X chromosome, has a nucleotide sequence shown as SEQ ID NO. 1, and is a spotted maigre with female genetic sex; when the amplified fragments are 879bp and 441bp, the spotted maigre to be detected contains a Y chromosome which lacks the nucleotide sequence shown in SEQ ID NO. 1 and is spotted maigre with male genetic sex.
8. The method of claim 7, wherein the length of the amplified fragment is detected by agarose gel electrophoresis or polyacrylamide gel electrophoresis.
9. An auxiliary breeding method for nibea albiflora, which is characterized by comprising the following steps:
detecting the molecular marker of claim 1 by the method of any one of claims 6 to 8 to determine the genetic sex of the spotted maigre to be tested.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011171045.7A CN112159852B (en) | 2020-10-28 | 2020-10-28 | Specific molecular marker, detection primer and kit for sex chromosomes of nibea albiflora and application of specific molecular marker, detection primer and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011171045.7A CN112159852B (en) | 2020-10-28 | 2020-10-28 | Specific molecular marker, detection primer and kit for sex chromosomes of nibea albiflora and application of specific molecular marker, detection primer and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112159852A true CN112159852A (en) | 2021-01-01 |
| CN112159852B CN112159852B (en) | 2021-12-17 |
Family
ID=73866285
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011171045.7A Active CN112159852B (en) | 2020-10-28 | 2020-10-28 | Specific molecular marker, detection primer and kit for sex chromosomes of nibea albiflora and application of specific molecular marker, detection primer and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112159852B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110964798A (en) * | 2020-03-05 | 2020-04-07 | 东北农业大学 | Method for identifying northeast wood frog genetic sex by using TRAP molecular marker technology |
| CN116042857A (en) * | 2023-01-04 | 2023-05-02 | 厦门大学 | Combined molecular marker and primer for identifying genetic male of yellow river carp and application of combined molecular marker and primer |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107326077A (en) * | 2017-07-14 | 2017-11-07 | 集美大学 | A kind of molecular labeling for differentiating spotted maigre genetic sex and its application |
-
2020
- 2020-10-28 CN CN202011171045.7A patent/CN112159852B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107326077A (en) * | 2017-07-14 | 2017-11-07 | 集美大学 | A kind of molecular labeling for differentiating spotted maigre genetic sex and its application |
Non-Patent Citations (2)
| Title |
|---|
| SHA SUN等: "Genetic sex identification and the potential sex determination system in the yellow drum (Nibea albiflora)", 《AQUACULTURE》 * |
| 孙莎: "黄姑鱼性别特异分子标记开发及性别决定机制的初步研究", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110964798A (en) * | 2020-03-05 | 2020-04-07 | 东北农业大学 | Method for identifying northeast wood frog genetic sex by using TRAP molecular marker technology |
| CN110964798B (en) * | 2020-03-05 | 2023-07-07 | 东北农业大学 | Method for identifying genetic sex of rana chensinensis by using TRAP molecular marker technology |
| CN116042857A (en) * | 2023-01-04 | 2023-05-02 | 厦门大学 | Combined molecular marker and primer for identifying genetic male of yellow river carp and application of combined molecular marker and primer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112159852B (en) | 2021-12-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107326077B (en) | Molecular marker for identifying genetic sex of spotted maigre and application thereof | |
| CN108841945B (en) | PCR amplification primer, method and kit for rapidly identifying genetic sex of Chinese softshell turtles | |
| CN110607359B (en) | Patinopecten yessoensis female specific marker combination and application | |
| CN108192963B (en) | Specific molecular marker for accurately identifying genetic sex of scatophagus argus and primer thereof | |
| WO2016180009A1 (en) | Dna probe sequence for determining genetic sexes of litopenaeus vannamei and obtainment method | |
| CN111088370B (en) | Sex-specific molecular marker primer for Trachinotus ovatus, identification method and application of sex-specific molecular marker primer | |
| CN111471775B (en) | Specific DNA fragment SSM2 for sturgeon gender identification and application | |
| CN111394445B (en) | Indel marker for sex identification of channa maculata and application thereof | |
| CN112159852B (en) | Specific molecular marker, detection primer and kit for sex chromosomes of nibea albiflora and application of specific molecular marker, detection primer and kit | |
| CN104711343B (en) | A kind of SNP411871 mark associated with weight size with pteria martensii shell mould and primer and application | |
| CN106834469B (en) | Specific molecular marker of male gametophyte of kelp and application of specific molecular marker | |
| CN113862379B (en) | Leiocassis longirostris male sex specific molecular marker, amplification primer thereof and genetic sex identification method | |
| CN114657264A (en) | Clarias fuscus gender-specific molecular marker primer and application thereof | |
| CN108239675B (en) | Molecular marker TJcM02 for identifying melon unisexual flower and application thereof | |
| CN108165652B (en) | Specific molecular marker TGMI001 for identifying sex of torreya grandis at seedling stage | |
| CN108531636B (en) | Molecular marker TJcM01 for identifying melon unisexual flower and application thereof | |
| CN112266974B (en) | Primer and identification method for identifying asparagus gender | |
| CN114480601A (en) | Molecular marker, primer, method and application for identifying genetic sex of hippocampus kelloggi | |
| CN112029843A (en) | Specific molecular marker for identifying genetic sex of scatophagus argus and primers and application thereof | |
| CN111748639A (en) | Molecular marker for identifying sex of haliotis discus hannai and application thereof | |
| CN114717301B (en) | Molecular marker for identifying genetic sex of micropterus salmoides and primer pair thereof | |
| CN117947182B (en) | Specific marker, primer, identification method, kit and application for detecting insertion variation of intergenic region of oplegnathus fasciatus | |
| CN107385095B (en) | Primer for rapidly identifying genetic sex of oryzias latipes and application of primer | |
| CN114231608B (en) | Molecular marker for identifying genetic sex of Haliotis diversicolor and application thereof | |
| CN117802246A (en) | Molecular marker for identifying genetic sex of Nibea japonica and primer pair thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |