CN112159808A

CN112159808A - Promoter, expression vector of mammalian cell, expression system and application

Info

Publication number: CN112159808A
Application number: CN202010722013.5A
Authority: CN
Inventors: 许佃文; 王建华; 杨献军
Original assignee: Henan Punuoyi Biological Product Research Institute Co ltd; Yunxing Fengshang Shandong Biotechnology Co ltd
Current assignee: Henan Punuoyi Biological Product Research Institute Co ltd; Yunxing Fengshang Shandong Biotechnology Co ltd
Priority date: 2020-07-24
Filing date: 2020-07-24
Publication date: 2021-01-01

Abstract

The invention is applicable to the technical field of genetic engineering, and provides a promoter, an expression vector of a mammalian cell, an expression system and application, wherein the nucleotide sequence of the promoter is shown as a sequence table SEQ ID NO. 2 or SEQ ID NO. 3. The artificially synthesized promoter provided by the embodiment of the invention can be used for constructing an expression vector of mammalian cells so as to drive an exogenous gene to perform efficient, continuous and stable expression; the expression vector is applied to an expression system of target proteins of mammalian cells, so that the expression level of the target proteins of the mammalian cells can be obviously improved, and the aim of reducing the production cost is fulfilled.

Description

Promoter, expression vector of mammalian cell, expression system and application

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a promoter, an expression vector of a mammalian cell, an expression system and application.

Background

In recent years, biopharmaceuticals have been identified in various countries of the world as key technologies and emerging industries for the technological development of the 21 st century. The production of medicinal protein with important value by using exogenous protein expression system is the core content and research hotspot of modern biotechnology industry. Host systems currently used for expressing recombinant protein drugs include microorganisms, insect cells, and mammalian cells, among others. Since mammalian cells can perform correct folding, assembly, post-translational modification and other effects on recombinant proteins, so that the recombinant proteins have the advantages of being closer to the molecular structure of human-derived proteins, the mammalian cells have become the main expression hosts of protein drugs for clinical treatment, and the most widely used mammalian cells are Chinese Hamster Ovary (CHO) cells. However, compared with expression systems such as Escherichia coli, the expression level of mammalian cells is still low, the time required for obtaining high-expression engineering cell strains is long, the cost of large-scale cell culture is high, and the like, so that the cost of producing protein drugs by mammalian cells is high. There is a need for improving mammalian cell expression systems, further increasing the expression level of recombinant proteins, enhancing the stability of cell lines, reducing production costs, and ensuring product quality and safety.

The components of an effective mammalian cell expression vector include a promoter, an enhancer, a polyA sequence, a selectable marker, an origin of replication, a gene of interest, an enhancer, and the like. The promoter is an important regulatory element for gene expression, and is a DNA regulatory sequence which can be specifically recognized and bound by RNA polymerase and can correctly and effectively initiate transcription, and is generally positioned in the upstream region of 5' end of gene. Promoters commonly used for the production of recombinant proteins in mammalian cells are the human cytomegalovirus major early enhancer/promoter, simian virus 40 early promoter, CMV enhancer/chicken β -actin promoter, human elongation factor-1 α promoter, and chinese hamster elongation factor-1 α promoter. Among them, the CMV promoter is commonly used in the construction of recombinant protein expression vectors for mammalian cells, but is susceptible to epigenetic silencing, resulting in a gradual decay of expression levels as cell culture times extend.

Therefore, there is a need to find a new synthetic promoter to replace the promoter of the existing mammalian cell expression vector.

Disclosure of Invention

An object of the embodiments of the present invention is to provide a promoter, which is intended to solve the problems set forth in the background art.

The embodiment of the invention is realized by that the nucleotide sequence of the promoter is shown as SEQ ID NO. 2 or SEQ ID NO. 3 of a sequence table.

As a preferable scheme of the embodiment of the invention, the nucleotide sequence of the promoter is shown as SEQ ID NO. 3 of the sequence table.

Another object of the embodiments of the present invention is to provide an expression vector for mammalian cells, which contains the above-mentioned promoter.

As another preferable scheme of the embodiment of the invention, the construction method of the expression vector comprises the following steps:

taking a starting carrier;

and replacing the original promoter sequence of the starting vector with the promoter to obtain the expression vector.

As another preferable scheme of the embodiment of the invention, the starting vector is one of pRC/CMV, pIRES-neo2, pIRES-neo3, pEGFP-C1, pcDNA1.1 and pCHO1.0.

Another objective of embodiments of the present invention is to provide an expression system, wherein the construction method includes the following steps:

inserting an exogenous target gene into the downstream of the promoter of the expression vector to construct a recombinant expression vector;

and transferring the recombinant expression vector into a host cell, and screening to obtain the expression system.

As another preferred embodiment of the present invention, the host cell is one of CHO, HEK293, BHK and C127.

As another preferred embodiment of the present invention, the host cell is CHO.

Another objective of the embodiments of the present invention is to provide an application of the above expression vector in the preparation of target proteins of mammalian cells.

Another object of the embodiments of the present invention is to provide an application of the above expression system in the preparation of target proteins of mammalian cells.

The promoter provided by the embodiment of the invention can be used for constructing an expression vector of a mammalian cell so as to drive an exogenous gene to perform efficient, continuous and stable expression; the expression vector is applied to an expression system of target proteins of mammalian cells, so that the expression level of the target proteins of the mammalian cells can be obviously improved, and the aim of reducing the production cost is fulfilled.

Drawings

FIG. 1 is a plasmid map of expression vector pRC/CMV.

FIG. 2 reflects the expression level of EGFP from the CMV promoter and promoter provided by the examples of the present invention under transient expression.

FIG. 3 reflects the expression level of EGFP from the CMV promoter and promoter provided by the examples of the present invention under stable expression.

FIG. 4 reflects the EPO expression level of the promoters provided by the examples of the present invention with the CMV promoter in case of transient expression.

FIG. 5 reflects the EPO expression level of the promoters provided by the examples of the present invention with the CMV promoter under stable expression.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Example 1

This example provides a promoter that is a sequence synthesized by man; the promoter is characterized in that an initiator region (Inr) sequence (TCAGAT) is added on the basis of a TATA box with a TATATAAG sequence in a pRc/CMV promoter sequence, specifically, the promoter is marked as promoter-1, and the nucleotide sequence of the promoter is shown as a sequence table SEQ ID NO:2, specifically: AGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAA are provided.

Wherein, the nucleotide sequence of the pRc/CMV promoter sequence is shown in a sequence table SEQ ID NO:1, and specifically comprises the following steps: AGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTAACTGGCTTATCGAAAT are provided.

Example 2

This example provides a promoter that is a sequence synthesized by man; the promoter is characterized in that an initiator region (Inr) sequence (TCAGAT) is added on the basis of a TATA box with a TATATAAG sequence in a pRc/CMV promoter sequence, a Downstream Promoter Element (DPE) with a sequence of CGAGCCGAGTGGTTGT is added, specifically, the promoter is marked as promoter-2, and the nucleotide sequence of the promoter is shown as a sequence table SEQ ID NO:3, and specifically: AGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGTCGAGCCGAGTGGTTGTGCCTCCATAGAA are provided.

Example 3

This example provides two expression vectors for mammalian cells, which are constructed as follows:

s1, taking two groups of pRC/CMV as starting vectors, wherein the plasmid map of the pRC/CMV is shown in figure 1.

S2, cloning the promoter-1 and the promoter-2 provided by the above examples 1-2 on an expression vector pRC/CMV by adopting a seamless cloning technology respectively to replace a CMV promoter sequence of the pRC/CMV vector, thereby constructing two groups of expression vectors which are named as pRC/SCMV-1 and pRC/SCMV-2 respectively.

It should be noted that, the starting vector may be one of pIRES-neo, pIRES-neo2, pIRES-neo3, pEGFP-C1, pcDNA1.1 and pCHO1.0, but is not limited thereto, and the construction method is the same as the above method.

Example 4

This embodiment provides a use of the above expression vector, comprising: before or after the promoter sequence is inserted, cloning and inserting the exogenous gene into the expression vector to obtain a recombinant expression vector; transfecting the recombinant expression vector into a host cell of a mammal, and culturing the cell of the mammal to obtain an expression system for expressing the target protein. The specific construction method of the expression system comprises the following steps:

s1, PCR amplification of EGFP gene: primers P1 and P2 (for amplifying 720bp EGFP gene DNA) are designed by referring to an Enhanced Green Fluorescent Protein (EGFP) gene sequence (GenBank: U55763.1, bases 613-1332) of a pEGFP-C1 vector, HindIII and Not I enzyme cutting sites are respectively introduced into the 5' ends of the primers, and the primer sequences are shown as follows (enzyme cutting sites are underlined):

p1: 5'-CCGAAGCTTATGGTGAGCAAGGGCGAGGAG-3' (shown in SEQ ID NO:4 of the sequence listing);

p2: 5'-CTAGCGGCCGCGGACTTGTACAGCTCGTCCATGC-3' (shown in SEQ ID NO:5 of the sequence Listing).

EGFP gene was amplified using pEGFP-C1 plasmid (available from Clontech, USA) as a template and primers P1 and P2, and the reaction system is shown in Table 1 below.

TABLE 1

PCR reaction system	Concentration of reagent	Final concentration	Volume (μ L)
				10×PCR buffer	10×	1×	2.5
Primer P1	10μmol/L	0.4μmol/L	1.0
				Primer P2	10μmol/L	0.4μmol/L	1.0
dNTP	25μmol/L	200μmol/L	2.0
				Template DNA	100ng/μL	4.0ng/μL	1.0
Taq enzyme	5U/μL	0.1U/μL	0.5
				ddH₂O	/	/	17

The reaction procedure was as follows: 95 ℃ for 3min, 94 ℃ for 40s, 56-60 ℃ for 30s, 72 ℃ for 40s, 4 cycles per annealing temperature, finally 55 ℃ for 1min, 30 cycles, and 72 ℃ for 3 min.

And (4) recovering the PCR amplification product by agarose gel electrophoresis, and purifying the PCR amplification product to be sent to a biological company for sequencing verification. The result shows that the amplified DNA fragment is completely consistent with the EGFP sequence published by GenBank.

S2, constructing an expression vector containing an EGFP sequence: PCR amplification products of EGFP were double digested with HindIII and Not I (correct sequence verified by sequencing), while plasmid DNAs of pRC/CMV, pRC/SCMV-1 and pRC/SCMV-2 were double digested with HindIII and Not I. And identifying the enzyme digestion result by agarose gel electrophoresis, and recovering the EGFP sequence fragment and pRC/CMV, pRC/SCMV-1 and pRC/SCMV-2 linear plasmid DNA after enzyme digestion by gel.

The EGFP sequence is cut by the enzyme system: 10 XK buffer 1. mu.L + BSA, 10U/. mu.L HindIII, Not I enzymes 0.5. mu.L each, 1.289. mu.g/. mu.L EGFP amplification product 0.78. mu.L, make up water to 20. mu.L. After mixing well, incubate at 37 ℃ for 6 h.

The enzyme cutting system of the plasmid is as follows: 10 XK buffer 1. mu.L + BSA, 10U/. mu.L HindIII, Not I enzyme 0.5. mu.L each, 0.81. mu.g/. mu.L plasmids pRC/CMV, pRC/SCMV-1, pRC/SCMV-21.23. mu.L, and make up water to 20. mu.L. After mixing well, incubate at 37 ℃ for 3 h.

The cut EGFP sequence fragment and pRC/CMV, pRC/SCMV-1 and pRC/SCMV-2 linear plasmid DNA are taken and connected by T4 ligase (the connector system is 2 Xquick Ligation Buffer 10 uL, pRC/CMV, pRC/SCMV-1 and pRC/SCMV-2 linear plasmid DNA 200ng, the cut EGFP sequence fragment is 87.2ng and 350U/. mu. L T4 ligase 1 uL, water is supplemented to 20 uL), and the Ligation is carried out at 16 ℃ overnight. Adding the ligation product to E.coliE.coliJM109 was transformed with a competent bacterial suspension, 100. mu.L of the transformed bacterial suspension was inoculated on an LB solid plate containing ampicillin, cultured overnight at 37 ℃ and single colony was picked for subculture by shake culture. Extracting bacterial plasmids, carrying out enzyme digestion verification on the recombinant plasmids, selecting the plasmids with correct enzyme digestion identification, carrying out sequencing verification, and naming the vectors with completely correct target gene sequences as pRC/CMV-EGFP, pRC/SCMV-1-EGFP and pRC/SCMV-2-EGFP.

S3, constructing an expression system of the mammalian cell: taking CHO host cell at 37 deg.C and 5% CO₂Under the condition, the culture is carried out in a DMEM medium containing 10% inactivated fetal bovine serum. CHO cells (3X 10) were seeded in 6-well plates⁶/well), cells reached about 90% confluence after 24 hours of plating. Using Lip3000 (Lipofectamine 3000) as a transfection reagent, expression vectors pRC/CMV-EGFP, pRC/SCMV-1-EGFP and pRC/SCMV-2-EGFP were transfected into CHO cells respectively. With a concentration of 800. mu.g/mThe cells are cultured by the culture medium of the G418 of L, the concentration of the G418 is reduced when all normal CHO cells (untransfected cells) die, the culture medium containing the G418 of 500 mu G/mL is used for maintaining the growth of the polyclonal cells, and after two weeks, a stably transfected polyclonal CHO cell strain is obtained, namely the expression system.

The host cell may be one of HEK293, BHK and C127, but is not limited thereto.

Example 5

This embodiment provides another expression system construction method, which includes the steps of:

s1, PCR amplification of human EPO gene: primers P4 and P5 (used for amplifying 582bp human EPO gene DNA) are designed according to human EPO sequences (GenBank: KF178447.1, 10 th-591 th bases), HindIII and Not I enzyme cutting sites are respectively introduced into the 5' ends of the primers, and the primer sequences are as follows (the underlines are the enzyme cutting sites):

p3: 5'-CCGAAGCTTATGGGGGTGCACGAA-3' (shown in SEQ ID NO:6 of the sequence Listing);

p4: 5'-CTAGCGGCCGCAACTCTGTCCCCTGTCCTG-3' (shown in SEQ ID NO:7 of the sequence Listing).

Human peripheral blood genomic DNA was extracted and used as a template for PCR amplification to amplify the human EPO gene using primers P3 and P4, and the reaction system and reaction conditions were substantially the same as in example 4 above, except that P1 and P2 in Table 1 were replaced with P3 and P4.

And (4) recovering the PCR amplification product by agarose gel electrophoresis, and purifying the PCR amplification product to be sent to a biological company for sequencing verification. The results show that the amplified DNA fragment is completely consistent with the human EPO sequence published by GenBank.

S2, constructing an expression vector containing an EPO sequence: PCR amplification products of the human EPO sequence were double-digested with HindIII and Not I (correct sequence verified by sequencing), and plasmid DNAs of pRC/CMV, pRC/SCMV-1 and pRC/SCMV-2 were double-digested with HindIII and Not I. And identifying the enzyme digestion result by agarose gel electrophoresis, and recovering the human EPO sequence fragment after enzyme digestion and pRC/CMV, pRC/SCMV-1 and pRC/SCMV-2 linear plasmid DNA after the enzyme digestion by gel.

The human EPO sequence has the enzyme cutting system: 10 XK buffer + BSA 1. mu.L, 10U/. mu.L HindIII, Not I enzyme each 0.5. mu.L, 0.78. mu.g/. mu.L EPO amplification product 1.39. mu.L, make up water to 20. mu.L. After mixing well, incubate at 37 ℃ for 6 h.

The enzyme cutting system of the plasmid is as follows: 10 XK buffer + BSA 1. mu.L, 10U/. mu.L HindIII, Not I enzyme 0.5. mu.L each, 0.854. mu.g/. mu.L plasmids pRC/CMV, pRC/SCMV-1, pRC/SCMV-21.17. mu.L, and make up water to 20. mu.L. After mixing well, incubate at 37 ℃ for 3 h.

The digested human EPO sequence fragment and pRC/CMV, pRC/SCMV-1 and pRC/SCMV-2 linear plasmid DNA are taken and connected by T4 ligase (the connector system is: 2 Xquick Ligation Buffer 10 uL, pRC/CMV, pRC/SCMV-1 and pRC/SCMV-2 linear plasmid DNA 200ng, the digested EPO sequence fragment is 70.5ng, 350U/. mu. L T4 ligase 1 uL, water is supplemented to 20 uL), and the Ligation is carried out at 16 ℃ overnight. Adding the ligation product into E.coli JM109 competent bacterial suspension for transformation, inoculating 100 mu L of transformed bacterial liquid on an LB solid culture plate containing ampicillin, culturing overnight at 37 ℃, and selecting a single colony for shake culture and subculture. Extracting bacterial plasmids, carrying out restriction enzyme verification on recombinant plasmids, selecting plasmids with correct restriction enzyme identification, carrying out sequencing verification, and naming the vectors with completely correct target gene sequences as pRC/CMV-EPO, pRC/SCMV-1-EPO and pRC/SCMV-2-EPO.

S3, constructing a mammalian cell expression system: taking CHO host cell at 37 deg.C and 5% CO₂Under the condition, the culture is carried out in a DMEM medium containing 10% inactivated fetal bovine serum. CHO cells (3X 10) were seeded in 6-well plates⁶/well), cells reached about 90% confluence after 24 hours of plating. Using Lip3000 (Lipofectamine 3000) as a transfection reagent, expression vectors pRC/CMV-EPO, pRC/SCMV-1-EPO and pRC/SCMV-2-EPO were transfected into CHO cells. Culturing the cells by using a culture medium containing G418 with the concentration of 800 mu G/mL, reducing the concentration of G418 when all normal CHO cells (untransfected cells) die, maintaining the growth of the polyclonal cells by using a culture medium containing 500 mu G/mL of G418, and obtaining a stably transfected polyclonal CHO cell strain which is the expression system after two weeks. The host cell may be one of HEK293, BHK and C127, but is not limited thereto.

Test example:

firstly, the influence of the promoter on the transient expression of an exogenous EGFP gene:

CHO cells were selected at 37 ℃ and 5% CO₂Under the condition, the culture is carried out in a DMEM medium containing 10% inactivated fetal bovine serum. CHO cells (3X 10) were seeded in 6-well plates⁶/well), cells reached about 90% confluence after 24 hours of plating. Using Lip3000 (Lipofectamine 3000) as a transfection reagent, expression vectors pRC/CMV-EGFP (control group), pRC/SCMV-1-EGFP (promoter-1) and pRC/SCMV-2-EGFP (promoter-2) were transfected into CHO cells. The medium was changed to serum-free medium for culture. Counting the cells every day, collecting the cells with the cell apoptosis number higher than 50% in 5-6 days for flow cytometry detection, and analyzing the influence of a promoter sequence on the transient expression of the EGFP gene, wherein the test result is shown in figure 2.

As shown in the attached figure 2, compared with a pRC/CMV control vector, the promoter-1 sequence and the promoter-2 expression vector synthesized by the embodiment of the invention can obviously improve the transient expression level of the EGFP gene. The promoter-2 has more obvious influence on improving the transgenic expression, the increase multiple reaches 2.54 times, and the promoter-1 can improve the transgenic expression by 1.29 times. All data are statistical data of triplicate experiments.

Secondly, the influence of the promoter on the stable expression of the exogenous EGFP gene:

the cells obtained in the first experiment were cultured in a medium containing G418 at a concentration of 800. mu.g/mL, and the concentration of G418 was reduced when all normal CHO cells (untransfected cells) died, and the growth of the polyclonal cells was maintained in a medium containing 500. mu.g/mL of G418, and two weeks later, stably transfected polyclonal CHO cell lines were obtained. When the cell density reaches 1X 10⁶At each cell/mL, the cells were collected for flow cytometry, and the effect of the promoter sequence on the stable expression of the recombinant gene was analyzed, with the results shown in FIG. 3.

As shown in the attached figure 3, compared with a pRC/CMV control vector, the expression vectors of the promoter-1 sequence and the promoter-2 synthesized by the embodiment of the invention can obviously improve the stable expression level of the EGFP gene. The promoter-2 has more obvious influence on improving the transgenic expression, the increase multiple reaches 3.21 times, and the promoter-1 can improve the transgenic expression by 1.68 times. All data are statistical data of triplicate experiments.

Thirdly, the influence of the promoter sequence on the transient expression of human EPO gene:

transient expression experiments of pRC/CMV-EPO (control), pRC/SCMV-1-EPO (promoter-1) and pRC/SCMV-2-EPO (promoter-2) plasmids were performed according to the first test example, and the cells were counted every day, and cell supernatants were collected to measure the expression amounts of EPO, a target protein, of each group, using an ELISA assay kit, and the results of the experiments are shown in FIG. 4.

As can be seen from FIG. 4, the CHO cells transfected with pRC/CMV-EPO produced on average 12.32 pg of EPO per cell per day, the CHO cells transfected with pRC/SCMV-1-EPO produced on average 17.21pg of EPO per cell per day, and the CHO cells transfected with the control expression vector pRC/SCMV-2-EPO produced on average 38.12pg of EPO per cell per day. The promoter-2 synthesized by the embodiment of the invention can obviously improve the expression of EPO gene.

Fourthly, the influence of the promoter sequence on the stable expression of human EPO gene:

the cells obtained in the third experiment were cultured in a medium containing G418 at a concentration of 800. mu.g/mL, and the concentration of G418 was reduced when all normal CHO cells (untransfected cells) died, and the growth of the polyclonal cells was maintained in a medium containing 500. mu.g/mL of G418, and two weeks later, stably transfected polyclonal CHO cell lines were obtained. Transferring the polyclonal cell strain stably transfected with EPO into a 125mL suspension culture flask, wherein the initial cell amount is 5-6 multiplied by 10⁶Add 30mL serum-free medium per mL and culture in suspension at 120 rpm. The cells were counted every day, and cell supernatants were collected and the expression amounts of EPO, a protein of interest, of each group were measured using ELISA assay kits, and the results of the assay are shown in FIG. 5.

As can be seen from FIG. 5, the CHO cells transfected with pRC/CMV-EPO produced on average 26.46 pg per cell per day, the CHO cells transfected with pRC/SCMV-1-EPO produced on average 43.65pg per cell per day, and the CHO cells transfected with the control expression vector pRC/SCMV-2-EPO produced on average 88.26pg per cell per day. The promoter-2 synthesized by the embodiment of the invention can obviously improve the expression of EPO gene.

It should be noted that, although not specifically mentioned, the relevant operations in the above examples and test examples are conventional in the art, for example, refer to Molecular cloning handbook (Sambrook J & Russell DW. Molecular cloning: a laboratory Manual. 2001) edited by Sambrook et al, or the instruction provided by the manufacturer of the product.

The various culture media, cell lines, plasmid vectors, reagents, tool enzymes, and the like used in the examples and test examples are commercially available. Among them, pRC/CMV, pIRES-Neo, pEGFP-C1 plasmids were purchased from Clontech Bio Inc., and Chinese Hamster Ovary (CHO) cells were purchased from Shanghai cell Bank, Chinese academy of sciences.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Yunshangfeng (Shandong) Biotechnology Co., Ltd

HENAN PUNUOYI BIOLOGICAL PRODUCT RESEARCH INSTITUTE Co.,Ltd.

<120> a promoter, expression vector of mammalian cell, expression system and application

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 65

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aggtctatat aagcagagct ctctggctaa ctagagaacc cactgcttaa ctggcttatc 60

gaaat 65

<210> 2

<211> 81

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aggtctatat aagcagagct cgtttagtga accgtcagat cgcctggaga cgccatccac 60

gctgttttga cctccataga a 81

<210> 3

<211> 81

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aggtctatat aagcagagct cgtttagtga accgtcagat cgcctggaga cgtcgagccg 60

agtggttgtg cctccataga a 81

<210> 4

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccgaagctta tggtgagcaa gggcgaggag 30

<210> 5

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctagcggccg cggacttgta cagctcgtcc atgc 34

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccgaagctta tgggggtgca cgaa 24

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctagcggccg caactctgtc ccctgtcctg 30

Claims

1. The promoter is characterized in that the nucleotide sequence of the promoter is shown as SEQ ID NO 2 or SEQ ID NO 3 of a sequence table.

2. The promoter according to claim 1, wherein the nucleotide sequence of the promoter is shown as SEQ ID NO. 3 of the sequence Listing.

3. An expression vector for mammalian cells, comprising the promoter of claim 1 or 2.

4. The expression vector of claim 3, wherein the expression vector is constructed by the following steps:

taking a starting carrier;

5. The expression vector of claim 4, wherein the starting vector is one of pRC/CMV, pIRES-neo2, pIRES-neo3, pEGFP-C1, pcDNA1.1 and pCHO1.0.

6. An expression system, characterized in that the construction method of the expression system comprises the following steps:

inserting an exogenous target gene into the downstream of a promoter of the expression vector according to any one of claims 3-5 to construct a recombinant expression vector;

7. An expression system according to claim 6, wherein the host cell is one of CHO, HEK293, BHK and C127.

8. A mammalian cell expression vector according to claim 7, wherein the host cell is CHO.

9. Use of an expression vector according to any one of claims 3 to 5 for the preparation of a protein of interest in a mammalian cell.

10. Use of an expression system according to any one of claims 6 to 8 for the production of a protein of interest in a mammalian cell.