CN112111563A - Premixing kit for refrigeration preservation and use method - Google Patents

Abstract

The invention relates to a pre-mixed kit for refrigeration storage and a use method thereof, wherein related reagents are pre-mixed according to an experimental process to form a pre-mixed reagent, the pre-mixed reagent is loaded into the kit, the experimental operation steps can be effectively simplified, meanwhile, the long-term effective storage of the reagent under the refrigeration condition is realized by performing targeted adjustment on the components of the pre-mixed reagent, the complex operation of repeated freeze thawing when the kit is used in the experiment is avoided, and the experimental process is obviously simplified.

Description

Premixing kit for refrigeration preservation and use method

Technical Field

The invention relates to the technical field of gene detection library preparation, in particular to a refrigerated storage premixing kit and a using method thereof.

Background

High-throughput Sequencing, also known as Next-Generation Sequencing, is a parallel Sequencing technique for Sequencing hundreds of thousands to millions of DNA molecules at a time, and it allows for Deep, detailed, and complete analysis of genomes and transcriptomes of a species, and is also known as Deep Sequencing.

The existing kit for high-throughput sequencing focuses on the basic principle of experiments, the kit except magnetic beads is placed at-20 ℃ for storage, components of the kit need to be thawed at normal temperature in advance and then are prepared for subsequent operation in use, particularly repeated freezing and thawing and proportioning are needed under some conditions, the types of reagents stored in the kit independently are various, the use process relates to melting, mixing and centrifugation of different reagents, the operation is complex, and the requirement on the operation environment is high.

Disclosure of Invention

In order to solve the defects of the prior art, the invention provides a pre-mixed reagent kit for refrigeration storage and a using method thereof.

In order to achieve the above purpose, the technical scheme adopted by the invention comprises the following steps:

the premixed kit for refrigeration preservation is characterized in that premixed reagent components contained in the kit comprise a terminal filling and connecting component, a linker component, a ligase component and a PCR component;

the terminal filling and connecting component comprises a terminal filling and buffer solution A, a terminal filling and enzyme A and a premixed reagent of glycerol accounting for 10-30% of the whole volume of the terminal filling and connecting component;

the linker component comprises a ligation buffer, a linker and a pre-mix of glycerol that comprises 10% to 30% of the total volume of the linker component;

the ligase component comprises a ligase, a ligation buffer and a premixed reagent of glycerol which accounts for 10-30% of the whole volume of the ligase component;

the PCR component comprises a joint primer, a PH8Tris buffer solution and a premixed reagent of an amplification reaction solution.

Further, the air conditioner is provided with a fan,

the terminal filling and connecting component comprises 3.5uL of terminal filling and A adding buffer solution, 1.5uL of terminal filling and A adding enzyme and glycerol accounting for 10-30% of the whole volume of the terminal filling and connecting component;

the linker component comprises 10uL of ligation buffer, 2uL of linker at a concentration of 15umol/L, and glycerol in an amount of 10% to 30% of the total volume of the linker component;

the ligase component comprises 10uL of ligase, 10uL of ligation buffer and glycerol accounting for 10-30% of the whole volume of the ligase component;

the PCR component comprises 5uL of adaptor primers (P5 index Primer and P7 index Primer) with the final concentration of 400-1000 nmol/L, 20uL of PH8Tris Buffer solution and 25uL of amplification reaction solution, wherein the amplification reaction solution comprises DNA Polymerase, PCR Buffer solution and dNTP, for example, 2X PCR Master Mix amplification reaction solution comprising 2X Taq DNA Polymerase, 2X PCR Buffer and 2X dNTP can be adopted. Preferably, 5uL of the adaptor primer and 20uL of a PH8Tris buffer solution are mixed, and then the mixture is mixed with 25uL of the amplification reaction solution; the PCR buffer in the amplification reaction solution is a buffer conventionally used for PCR amplification, and may include, for example, Tris and magnesium ions.

Further, the air conditioner is provided with a fan,

the terminal filling and connecting component comprises glycerol accounting for 30% of the whole volume of the terminal filling and connecting component;

the linker component comprises 30% glycerol by volume of the entire linker component;

the ligase component includes glycerol at 30% of the total volume of the ligase component.

Further, the ligase is T4 ligase of 10 to 30 units/uL.

Further, the glycerol is replaced with DMSO in all or part of an equal volume.

The invention also relates to a using method of the premixed kit for refrigeration preservation, which is characterized by comprising the following steps:

storing the kit under a refrigeration condition of 4 ℃;

the kit is used for library construction, the reagent melting process is not needed, and each premixed reagent component in the kit can be directly used in library construction experiment operation after 5-10 seconds of centrifugal operation of a desktop centrifuge.

Further, the library construction experimental procedures include:

s1, performing end repair and A addition on a pre-prepared fragmented DNA sample by using an end filling and connecting component;

s2, connecting the DNA fragment added with the A by using a joint component and a ligase component;

s3, purifying the DNA fragment connected with the joint to obtain a purified DNA fragment;

s4, amplifying and enriching the purified DNA fragments by using the PCR components;

s5, purifying the amplified and enriched DNA library to obtain a purified DNA library.

Further, the purification operation comprises:

purifying by using Agencour AMPure XP magnetic beads;

rinsing with 80% ethanol;

elution is performed using elution buffer or deionized water.

The invention has the beneficial effects that:

when the premixed kit for refrigerated storage and the using method are adopted to carry out DNA library preparation experiments, the effectiveness of the reagent can be ensured for a long time only under the conventional refrigerated condition, the freezing storage is not needed, the storage and transportation conditions of the kit are simplified, the reagent in the kit is not needed to be melted during use, and the influence on the preparation experiment efficiency of the DNA library due to repeated freezing and thawing of the reagent is avoided; meanwhile, the premixed reagent components loaded into the kit after the premixing operation not only better support the effectiveness of the reagent for cold storage preservation, but also simplify the operation steps of DNA library preparation experiment, and particularly, the process of uniformly mixing different reagents is completed in advance, so that the experiment efficiency can be greatly improved.

Drawings

FIG. 1 is a schematic flow chart of the method for using the pre-mixed kit for refrigerated preservation according to the present invention.

Detailed Description

For a clearer understanding of the contents of the present invention, reference will be made to the accompanying drawings and examples.

The existing kit, which requires cryopreservation to maintain the effectiveness of the reagents (e.g., enzyme activity), cannot be used directly during the experiment, and must be subjected to a thawing process.

According to the premixed kit for refrigeration preservation, provided by the invention, the reagents can keep effectiveness for a long time under refrigeration conditions by premixing different reagents and adding glycerol, for example, the reagents are stored in an environment at 4 ℃, additional preparation steps are not needed during use, the reagents can be directly used for experiments after short centrifugation, and the premixed reagent components are combined, so that the experimental process for preparing a DNA library is greatly simplified.

Preferably, the premixed kit for refrigerated storage comprises four premixed reagent components, particularly terminal filling and A reagent adding premixing, linker connecting reagent premixing and primer premixing are carried out, a certain amount of glycerol (or DMSO) is added in a targeted manner to improve the refrigerated storage property of the reagents, and the kit capable of effectively improving the preparation experiment efficiency of the DNA library is provided integrally. Wherein the glycerol (or DMSO) is added to remarkably improve the capability of the reagent to keep effectiveness under refrigeration conditions, and particularly helps to keep the activity of enzyme in the reagent, and the glycerol (or DMSO) is added in an amount of 10-30%, preferably 30%, of the total volume of the reagent, so that better refrigeration preservation effect can be realized.

FIG. 1 is a schematic flow chart of a preferred embodiment of a method for constructing a DNA library by using the pre-mix kit for cryopreservation, which mainly comprises the following steps:

s1, performing end repair and A addition on a pre-prepared fragmented DNA sample by using an end filling and connecting component;

s2, connecting the DNA fragment added with the A by using a joint component and a ligase component;

s3, purifying the DNA fragment connected with the joint to obtain a purified DNA fragment;

s4, amplifying and enriching the purified DNA fragments by using the PCR components;

s5, purifying the amplified and enriched DNA library to obtain a purified DNA library.

Compared with the experimental operation using the kit in the prior art, the cold storage preservation premixing kit can at least save the operation steps of reagent melting and thawing, mixing of different reagents and the like, and has higher experimental efficiency.

The technical effects which can be achieved by the invention are further illustrated by taking the specific application of the refrigerated preservation premix kit in library construction based on an Illumina sequencing platform as an example.

Library construction based on an Illumina sequencing platform by adopting a refrigerated preservation premix kit comprises the following steps:

1. sample preparation: extracting cell culture DNA, and physically breaking by Covaris, wherein the broken DNA sequence is small fragment DNA about 200 bp. The cleaved DNA fragment was purified by Ampure XP magnetic beads, diluted to a concentration of 10ng/uL in TE buffer, and OD260/OD280 was 2.0.

2. Fragmented dna (dna fragment) end repair and addition of a: the fragmented DNA interrupted in step 1 is diluted to the appropriate concentration, end-repaired with end-repair and A-reagent addition and an adenosine (A base) is added 3' to the fragmented DNA insert. The reaction system is shown in Table 1.

TABLE 1 fragmented DNA end repair and A addition reaction System

Reaction components	Volume (ul)
		End filling and adding A component	10
Fragmented DNA sample + H2O	20
		Total of	30

3. After the system is prepared, placing the reaction tube in a PCR instrument or other thermal incubation reaction instruments, and incubating for 30 minutes at 20 ℃; incubate at 65 ℃ for 30 minutes. Taking out the reaction tube for the next reaction.

Ligation of DNA fragments to linkers: adding a connecting reagent into the DNA fragments treated in the step (2) and the reaction solution to connect the joint and the DNA fragments. The reagents used in this step include Ligase (Ligase) and Ligation buffer (Ligation buffer). The reaction system is shown in Table 2.

TABLE 2 linker ligation reaction System

Reaction components	Volume (ul)
		The product of the last step	30
Joint component	15
		Ligase component	10
Total of	55

5. After the system is prepared, the reaction tube is placed in a PCR instrument or other thermal incubation reaction instruments and set at 20 ℃ for 15 min. And after the reaction is finished, taking out the reaction tube to carry out the next purification process.

6. The linker sequence used in this step is a Y-linker with complementary partial regions, the linker sequence being referenced to the linker sequences of different sequencers of the Illumina platform:

the joint 1: 5' -ACTCTTTCCCTACACGAC GCTCTTCCGATC T

And (3) joint 2: 5' -pGATCGGAAGGC ACACACGTCTGAACTCCAGTC

Wherein, represents a thio modification, and p represents 5-terminal phosphorylation

DNA fragment purification: after the completion of the ligation, the reaction system was purified using 1.8 × Agencour AMPure XP magnetic beads (Beckman Coulter), and a DNA library was isolated. Then, the purified DNA library is obtained by rinsing with 80% ethanol and eluting with EB (elution buffer) or deionized water.

PCR amplification enrichment of DNA library: the purified DNA library was eluted using a PCR amplification system, and the reaction system used was as shown in Table 3.

TABLE 3DNA library PCR amplification enrichment reaction System

Reaction components	Volume (ul)
		Magnetic bead
PCR Components	50
		Total of	50

The sequence of the adapter primer used was:

Primer1:

5’-AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGT

Primer2：

5’-CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCG

wherein [ i5] and [ i7] represent index sequences in the adapter primer sequence, and the length is 8 bases. The partial index sequences of the primer sequences are shown in Table 4.

Table 4 index sequences in primer sequences

Joint name	i5 index	i7 index
			IDT_Dual_Index_Adapter 81	ATCCAGAG	CGACGTTA
IDT_Dual_Index_Adapter 82	AGAGTAGC	TACGCCTT
			IDT_Dual_Index_Adapter 83	TGGACTCT	CCGTAAGA
IDT_Dual_Index_Adapter 84	TACGCTAC	ATCACACG

9. After the system is prepared, the reaction tube is placed in a PCR instrument or other thermal incubation reaction instrument, and the program setting is shown in Table 5.

Table 5 reaction sequence settings

Purification of DNA library amplification products: the amplified library was purified using 1 × Agencour AMPure XP magnetic beads (Beckman Coulter) and a DNA library was isolated. Then respectively rinsing by 80% ethanol and eluting by EB or deionized water to obtain a purified DNA library.

In order to verify that the premixed kit for refrigerated storage can support the preservation of the effectiveness of the reagents in a longer period of refrigeration (for example, at 4 ℃), the DNA library amplification method is adopted to perform library amplification experiments on samples of the same type from the same source by using the kits with different storage lives, and the obtained results are shown in table 6. For comparison, the library construction was performed after the prior art library construction kit (e.g., commercial library construction kit) which had not been premixed was left for a long time under a refrigeration condition (e.g., 4 ℃), and the results are shown in Table 7.

TABLE 6 premix kit library construction test results

TABLE 7 results of library construction experiments using the prior art library construction kit

The results in table 6 show that the concentration differences of the prepared library are within the acceptable error range when the premixed kit for refrigerated storage is stored for 1 month to 12 months, and the kit for refrigerated storage for 12 months still maintains the effectiveness of the available reagents, so that the premixed kit can be normally applied to library preparation experiments. Compared with the results obtained in the table 7, the kit in the prior art without the premixed reagent has obviously reduced library construction efficiency after being stored in a cold storage for 1 month, has greatly reduced library construction efficiency after 3 months, and basically does not have the library construction capability after being stored in the cold storage for 6 months, so that the premixed kit for cold storage provided by the invention has very good cold storage characteristics compared with the prior art.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are included in the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.

Claims (8)

1. The premixed kit for refrigeration preservation is characterized in that premixed reagent components contained in the kit comprise a terminal filling and connecting component, a linker component, a ligase component and a PCR component;

the terminal filling and connecting component comprises a terminal filling and buffer solution A, a terminal filling and enzyme A and a premixed reagent of glycerol accounting for 10-30% of the whole volume of the terminal filling and connecting component;

the linker component comprises a ligation buffer, a linker and a pre-mix of glycerol that comprises 10% to 30% of the total volume of the linker component;

the ligase component comprises a ligase, a ligation buffer and a premixed reagent of glycerol which accounts for 10-30% of the whole volume of the ligase component;

the PCR component comprises a joint primer, a PH8Tris buffer solution and a premixed reagent of an amplification reaction solution.

2. The kit of claim 1,

the terminal filling and connecting component comprises 3.5uL of terminal filling and A adding buffer solution, 1.5uL of terminal filling and A adding enzyme and glycerol accounting for 10-30% of the whole volume of the terminal filling and connecting component;

the linker component comprises 10uL of ligation buffer, 2uL of linker at a concentration of 15umol/L, and glycerol in an amount of 10% to 30% of the total volume of the linker component;

the ligase component comprises 10uL of ligase, 10uL of ligation buffer and glycerol accounting for 10-30% of the whole volume of the ligase component;

the PCR component comprises 5uL of adaptor primer, 20uL of PH8Tris buffer solution and 25uL of amplification reaction solution, wherein the amplification reaction solution comprises DNA polymerase, PCR buffer solution and dNTP.

3. The kit of claim 2,

the terminal filling and connecting component comprises glycerol accounting for 30% of the whole volume of the terminal filling and connecting component;

the linker component comprises 30% glycerol by volume of the entire linker component;

the ligase component includes glycerol at 30% of the total volume of the ligase component.

4. The kit of claim 2, wherein the ligase is a T4 ligase at 10 to 30 units/uL.

5. The kit of any one of claims 1 to 4, wherein all or a portion of the volume of glycerol is replaced with DMSO.

6. A method of using a pre-mix kit for refrigerated storage, the method comprising:

storing the kit of any one of claims 1 to 5 under refrigeration at 4 ℃;

the kit of any one of claims 1 to 5 is used for library construction, and the premixed reagent components in the kit can be directly used in library construction experiment operation through centrifugation operation without a reagent melting process.

7. The use of claim 6, wherein said library construction protocol comprises:

s1, performing end repair and A addition on a pre-prepared fragmented DNA sample by using an end filling and connecting component;

s2, connecting the DNA fragment added with the A by using a joint component and a ligase component;

s3, purifying the DNA fragment connected with the joint to obtain a purified DNA fragment;

s4, amplifying and enriching the purified DNA fragments by using the PCR components;

s5, purifying the amplified and enriched DNA library to obtain a purified DNA library.

8. The use according to claim 7, wherein said purification operation comprises:

purifying by using Agencour AMPure XP magnetic beads;

rinsing with 80% ethanol;

elution is performed using elution buffer or deionized water.

Images