CN112111497B - AACT gene overexpression reagent and preparation method and application thereof - Google Patents

Abstract

The invention provides an AACT gene overexpression reagent andthe preparation method comprises the following steps: the method comprises the following steps: 1) designing a band using a human cDNA library as a templateEcoR I and Xba IAdding an enhancer sequence GCCACC in front of a promoter ATG by using a primer of a restriction enzyme site, and carrying out PCR amplification to obtain an AACT of a product coding region sequence; 2) the pCS2-HA was used for the empty vectorEcoRI andXbacarrying out double enzyme digestion to obtain a linearized pCS2-HA vector; 3) connecting the target gene AACT obtained in the step 1) with the linearized pCS2-HA vector obtained in the step 2) to form an overexpression vector pCS 2-HA-AACT. The invention also provides application of the AACT gene overexpression reagent in inhibiting lung cancer cell proliferation. The whole process for constructing the over-expression vector is low in cost, environment-friendly, simple and convenient to operate and high in efficiency, the provided AACT gene over-expression reagent can help to diagnose the lung cancer earlier, and the reagent is high in sensitivity and reliability.

Description

AACT gene overexpression reagent and preparation method and application thereof

Technical Field

The invention relates to the field of tumor molecular biology, in particular to an AACT gene overexpression reagent and a preparation method and application thereof.

Background

Lung cancer is a primary malignant tumor, has increasing morbidity and mortality, is the first place, and becomes a large malignant tumor threatening human health. Lung cancer can be divided into Small Cell Lung Cancer (SCLC) and Non-Small cell lung cancer (NSCLC), with SCLC being more malignant, easily metastasizing, and having a short survival time, with a five-year survival rate of approximately 10-15% in advanced patients. NSCLC develops slowly and metastasizes later, 80% -85% of patients in clinical pathology are NSCLC, which mainly includes three histological subtypes of Adenocarcinoma (AD), Squamous Cell Carcinoma (SCC) and Large Cell Carcinoma (LCC). In recent years, many new breakthroughs are made in the diagnosis and treatment of lung cancer, and particularly, a plurality of proposals are made for treating patients with advanced NSCLC. However, patients with early lung cancer often have no obvious clinical symptoms, the technical level of clinical early diagnosis is low, specific diagnosis markers are lacked, misdiagnosis and missed diagnosis are easily caused, and the early diagnosis rate is only 10% -20%; 70% of NSCLC patients are diagnosed in a local late stage or a metastatic stage, the best treatment opportunity is lost, the long-term curative effect is still relatively poor, and the 5-year survival rate is only 19.7%. Failure to discover lung cancer early makes effective treatment difficult, a major cause of high mortality in current NSCLC patients. If the non-small cell lung cancer can be found early, the 5-year survival rate can reach more than 85 percent especially in the immunodeficiency period.

The clinically common lung cancer screening approaches are Low-dose helical CT (LDCT) and serum tumor marker examination. The LDCT radiation is small, is 22 percent of the standard CT radiation dose, is relatively safe, reduces the death rate of lung cancer patients by 20 percent, but has low LDCT specificity, high false positive rate up to 96 percent, is easy to misdiagnose and can not be found in a very small focus. Common lung cancer serum markers include Carcinoembryonic antigen (CEA), Cytokeratin 19 fragment (CYFRA 21-1), Squamous Cell Carcinoma Antigen (SCCA), and the like. CEA is a broad-spectrum tumor marker, and the CEA level in serum of 30-70% of tumor patients is increased. The higher the stage of lung cancer, the higher the CEA concentration, but the more obvious the CEA diagnosis to the patients of late stage, the worse early diagnosis effect. ② CYFRA21-1 is a relatively good marker for diagnosing squamous cell lung carcinoma, and the sensitivity is 40-60%. And the sensitivity of SCCA in detecting squamous cell lung carcinoma is 15-55%. Although the existing combined diagnosis effect of the indexes is superior to that of a single index, the existing early diagnosis technology of the lung cancer is low in level, the early diagnosis is late in discovery, a high-sensitivity and high-specificity early diagnosis marker is lacked, the requirements of early discovery and early diagnosis cannot be met, and the early diagnosis method has certain limitation in early screening application. In addition, the bottleneck of early diagnosis of lung cancer is that benign and malignant tumors are difficult to distinguish, and about 30% of patients with uncertain lung diseases are benign due to biopsy after surgical resection, and the risk of infection and the like is increased due to surgery. Therefore, the method has great significance in urgently searching for a high-efficiency and sensitive serum tumor biomarker to improve the survival rate of patients with early non-small cell lung cancer.

In summary, as described above, the existing early diagnosis technology for lung cancer is low in level, late in discovery, lack of high-sensitivity and high-specificity early diagnosis markers, and not capable of meeting the requirements of early discovery and early diagnosis, and has a certain limitation in early screening application.

The existing lung cancer treatment methods mainly comprise operations, radiotherapy, chemotherapy, targeted therapy, immunotherapy and the like, and the radiotherapy is one of the main treatment means of the advanced lung cancer; standard chemotherapy regimens are primarily platinum-based combination therapies such as paclitaxel, gemcitabine, etc.; targeted therapies have K-Ras-targeted epidermal growth factor-tyrosine kinase inhibitors (EFGR-TKIs), such as gefitinib, etc.; the immunotherapy mainly comprises PD-1 and PD-L1 inhibitors. Although the treatment methods have been greatly improved on the treatment of lung cancer, the treatment methods still have great side effects, and because the existing medicaments have certain limitations in use, such as multiple types of lung cancer, complex etiology and the like, a new feasible approach for treating lung cancer still needs to be developed.

The inventor finds that the expression of alpha-1-antichymotrypsin (AACT) is reduced in NSCLC tissues and serum, and can be used as a marker for early diagnosis of NSCLC. AACT is one member of the serine protease inhibitor superfamily, is the most abundant protease inhibitor in human plasma, and can inhibit a plurality of proteases. AACT is encoded by the serpin A3 gene, has 423 amino acids, and has a molecular weight of about 48 kDa. AACT is synthesized primarily in the liver, secreted into the blood, and is a glycoprotein in serum, and also synthesized in other organs, including the lung and brain, primarily alveolar epithelial cells and brain astrocytes. AACT primarily inhibits cathepsin and mast cell chymase, affecting tissue remodeling. AACT also belongs to acute phase protein, participates in inflammatory response, changes in AACT concentration in inflammatory response are important indexes for monitoring inflammatory diseases, and AACT high glycosylation, SLe in acute inflammatory environment^xFucosylation modification of glycoforms is significantly increased. AACT is also involved in the development of neurological diseases, plays an important role in the development of Alzheimer's disease, is elevated in the cerebrospinal fluid and serum expression levels in patients with Alzheimer's disease, deposits of amyloid plaques of A beta with increasing concentration of AACT, and mediates tau protein by activating c-Jun N-terminal kinaseWhite hyperphosphorylation leads to neurofibrillary tangles, causing disease to occur.

Studies report that expression of AACT in lung cancer cells is closely associated with tumor growth. However, the biological function of AACT in lung cancer is still unknown, and therefore, further research is needed. The invention uses molecular biology technology to construct AACT gene overexpression vector, and detects overexpression at cell levelAACTThe influence of the gene on the proliferation of the NSCLC cells provides a new tool for treating the lung cancer. Compared with the existing overexpression method, the invention adopts the recombinant cloning method to construct the AACT gene overexpression vector, the operation process is simpler, and the time is saved.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a preparation method of an AACT gene overexpression reagent, which has the advantages of low cost, high efficiency and environmental protection and can be used for preparing a reagent for inhibiting lung cancer cell proliferation.

In order to achieve the above object, the present invention provides a method for preparing an AACT gene overexpression reagent, which is characterized by comprising the steps of:

1) designing a vector using human cDNA library as templateEcoR I and Xba IPrimer of enzyme cutting site, enhancer sequence GCCACC is added in front of promoter ATG, AACT of product coding region sequence is obtained by PCR amplification, namely AACT with product coding region sequenceEcoRI andXbai, a target gene AACT with double enzyme cutting sites.

2) pCS2-HA was used for empty carriersEcoRI andXbacarrying out double enzyme digestion, and recovering an enzyme digestion product by using a gel recovery kit to obtain a linearized pCS2-HA vector;

3) connecting the target gene AACT obtained in the step 1) with the linearized pCS2-HA vector obtained in the step 2) to form an overexpression vector pCS2-HA-AACT, namely the AACT gene overexpression reagent.

Preferably, in the step 1), a human cDNA library is used as a template, a primer is designed, the full length of the coding sequence of the AACT gene is amplified by PCR using a recombinant cloning method, and the primer sequence for amplifying the target gene by PCR is as follows:

the upstream primer is (Sequence 1):

5′>CAGACTACGCTGGCCGGCCAGAATTCGCCACCATGGAGAGAATGTTACCTCTCC>3', underlined part isEcoR I, enzyme digestion site;

the downstream primer is (Sequence 2):

5′>GTAATACGACTCACTATAGTTCTACACTAGGCTTGCTTGGGATTGGTG>3', underlined part isXbaI, enzyme digestion site;

the reaction system for PCR amplification of the target gene is as follows:

the PCR amplification conditions were as follows:

amplifying for 30 cycles, extending for 5 min at 72 ℃, performing electrophoresis on the PCR amplification product, recovering the product by using a glue recovery kit to obtain a PCR product, namely the beltEcoRI andXbai, target gene AACT of double enzyme cutting sites;

the enzyme digestion system in the step 2) is as follows:

the ligation in step 3) was performed using 2 XMultiF Seamless Assembly Mix recombinant ligase, the ligation system was as follows:

another object of the present invention is to provide an AACT gene overexpression reagent prepared according to the above method.

It is still another object of the present invention to provide the use of the above AACT gene overexpression reagent.

The invention has the beneficial effects that: the whole process for constructing the over-expression vector has low cost and environmental protection, and the method has simple and convenient operation, high efficiency, simple production method and simple required equipment by utilizing a recombinant cloning method; the AACT gene overexpression reagent provided by the invention can help to diagnose lung cancer earlier, and has high sensitivity and strong reliability.

Drawings

FIG. 1 is a diagram showing the results of PCR amplification product identification using AACT cDNA plasmid as a template;

FIG. 2 is a flow chart of the construction of the over-expression vector pCS 2-HA-AACT;

FIG. 3 is a diagram showing the results of sequencing by selecting positive single colonies;

FIG. 4 is a graph of Western blot detection of AACT expression in lung cancer;

FIG. 5 is a graph showing the results of Western blot analysis of transfected A549 cells and H157 cells;

FIG. 6 is a graph showing the proliferation changes of A549 cells and H157 cells after the CCK8 is detected to over-express AACT.

Detailed Description

The technical solution of the present invention will now be described in detail with reference to the accompanying drawings and examples. It should be understood that the following examples are only illustrative of the present invention and are not intended to limit the scope of the present invention. It is intended that all modifications or alterations to the steps or conditions of the present invention be made without departing from the spirit or essential characteristics thereof.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

EXAMPLE preparation of AACT Gene overexpression reagent

1. The material and the method are as follows:

1) experimental Material

The empty vector pCS2-HA plasmid (Beijing holotype gold Biotech); AACT plasmid (GeneCopoeia)^TM) (ii) a (ii) a DH 5. alpha. competent cells (Kyoto Kogyo Co., Ltd.); axygen endotoxin-free plasmid miniprep kit (Wuhan Dafeng technologies, Inc.); OMEGA gel recovery kit (Beijing Solaibao Tech Co., Ltd.); recombinant clonase 2 XMultiF Seamless Assembly Mix (ABClonal); enzymeEcoR I andXbai (TAKARA); taq 2 XPCR Master Mix with Dye (Tiangen Biochemical technology Co., Ltd.).

LB culture medium: is prepared from tryptone (OXOID), NaCl and yeast extract (OXOID), and sterilized at 121 deg.C under high pressure for 20 min.

2) Experimental method

Firstly, extracting plasmid

The pCS2-HA empty vector bacterial liquid and the bacterial liquid containing AACT plasmid from the human cDNA library are activated and cultured. Extracting plasmids from 4 ml of LB culture medium by using an endotoxin-free plasmid small-amount kit (Axygen, No. AP-MN-FEP-150G), specifically operating according to the instruction of the kit, and finally extracting to obtain AACT cDNA plasmids with the concentration of 39.6 ng/mul; pCS 2-HA-unloaded plasmid at a concentration of 229.7 ng/. mu.l.

(ii) AACT Gene amplification and PCR product recovery

The amplification template is the AACT cDNA plasmid extracted above and adds a section of enhancer sequence (GCCACC) in front of the promoter, and the primer sequence of PCR amplification target gene is as follows:

upstream primer (Sequence 1): 5'>CAGACTACGCTGGCCGGCCAGAATTCGCCACCATGGAGAGAATGTTACCTCT

CC>3', underlined part isEcoRI, restriction enzyme site;

downstream primer (Sequence 2): 5'>GTAATACGACTCACTATAGTTCTACACTAGGCTTGCTTGGGATTGGTG>3′，

Underlined part isXbaI, enzyme digestion site;

the reaction system for PCR amplification of target gene by using the recombinant cloning enzyme method for cloning is as follows:

reagent	Volume of
		cDNA template	12 µl
10 μ M upstream primer	2.5 µl
		10 μ M downstream primer	2.5 µl
Taq 2×PCR Master Mix with Dye	25 µl
		Water (W)	8 µl
Total volume	50 µl

PCR amplification conditions:

pre-denaturation at 98 ℃	5 min
		Denaturation at 98 deg.C	15 sec
Renaturation at 62 ℃	15 sec
		Extension at 72 deg.C	30 sec

Amplifying for 30 cycles, extending for 5 min at 72 deg.C, electrophoresing PCR amplification product, recovering product with gel recovery kit (OMEGA, number D2500-01-100T), and obtaining PCR product containingEcoRI andXbathe concentration of the target gene AACT of the double enzyme cutting sites is 81 ng/. mu.l.

Construction and sequence determination of over-expression vector pCS2-HA-AACT plasmid

pCS2-HA was used for empty carriersEcoRI andXbai, double enzyme digestion is carried out at 37 ℃ overnight, and an enzyme digestion product is recovered by using an OMEGA gel recovery kit, wherein the concentration of the enzyme digestion product is 30.3 ng/mu l. The enzyme-cleaved product and the PCR product were ligated with recombinant ligase (2 XMultiF Seamless Assembly Mix) at 50 ℃ for 15 min, the ligation product was transformed into DH 5. alpha. competent cells, single clones were selected, positive clones were selected by bacterial liquid PCR identification, and the plasmid of the over-expression vector was sequenced (Prohibidae biosciences, Wuhan).

The enzyme digestion system is as follows:

reagent	Volume of
		Sterile water	32 µl
1×M	5 µl
		EcoR I	1.5 µl
Xba I	1.5 µl
		Vector pCS2-HA	10 µl
Total volume	50 µl

The digested product was recovered and ligated with PCR product using recombinant ligase 2 XMultiF Seamless Assembly Mix (conditions for ligation: 50 ℃ C., 15 min) in the following system:

reagent	Volume of
		Sterile water	1 µl
2×MultiF Seamless Assembly Mix	5 µl
		pCS2-HA double enzyme digestion product	2 µl
PCR product AACT	2 µl
		Total volume	10 µl

And transforming the ligation product into DH5 alpha competent cells, selecting monoclonal activated shake bacteria, and screening out positive clones by bacteria liquid PCR identification. The conversion steps are as follows:

A. thawing DH5 α competent cells directly on ice followed by heat shock transformation of the ligation product;

B. adding 5 ul of the ligation product to 50 ul of DH5 alpha competent cells, gently mixing, and standing on ice for 30 min;

C. placing into water bath preheated to 42 deg.C, thermally exciting for 45 s, immediately transferring to ice, standing for 2-3 min to cool down cells, and not shaking;

D. then, it was added to 950. mu.l of LB liquid medium, cultured with shaking at 37 ℃ for 1 hour, and shaken slowly (220 rpm);

E. centrifuging at 5000 rpm for 5 min. After centrifugation, 900 mul of supernatant is discarded, and the remaining 100 mul of bacterial liquid is resuspended;

F. pouring the resuspended bacterial liquid on an LB plate culture medium containing Amp + resistance, and uniformly coating the bacterial liquid by using a sterile coating rod;

after the liquid was absorbed, the plate was inverted, marked with a marker pen, placed in an incubator at 37 ℃ and incubated overnight for 12-16 h.

Carrying out PCR amplification by using AACT cDNA plasmid as a template, detecting the product by 1% agarose gel electrophoresis, wherein the target fragment is 1272 bp which is consistent with the length of the AACT gene (figure 1); carrying out double enzyme digestion on the pCS2-HA empty vector by using EcoR I and Xba I, recovering the enzyme digestion product, connecting the enzyme digestion product with the PCR product by using recombinant ligase, and constructing an over-expression vector pCS2-HA-AACT, wherein the construction schematic diagram is shown in figure 2; the overexpression vector is transformed into DH5 alpha competent cells, positive clones are screened, sequencing comparison is carried out, and the result shows that the positive clone sequence is consistent with the AACT sequence of the target gene (figure 3), which indicates that the overexpression vector pCS2-HA-AACT of the AACT gene is successfully constructed. And finally, expanding culture, and extracting the over-expression plasmid by using an endotoxin-free kit to obtain the plasmid with the concentration of 602.8 ng/mu l.

In fig. 1, M: marker, 1: PCR amplification products, the result is that the target fragment is 1272 bp which is consistent with the length of AACT gene; in FIG. 2 usingEcoRI andXbai double enzyme digestion pCS2-HA empty vector, recovering enzyme digestion product, connecting with PCR product by recombinant ligase, constructingThe targeting vector pCS 2-HA-AACT; in FIG. 3, sequencing analysis was performed by Shanghai Biotech, and the sequencing results showed that the sequence was aligned with the AACT sequence of the target gene, indicating that the construction of the over-expression vector of the AACT gene was successful.

Example application of AACT Gene overexpression reagent

1. The material and the method are as follows:

1) experimental Material

Reagent: EXAMPLE one resulting over-expression vector pCS2-HA-AACT plasmid (concentration 602.8 ng/. mu.l); LB culture medium; kang is a endotoxin-free middle-extracting kit (kang is century biotechnology limited); high Gene transfection reagent (ABClonal); 0.25% pancreatin (Gibco); 10% fetal bovine serum (FBS, Gibco); penicillin streptomycin antibiotic (Gibco); DMEM medium (Gibco); RIPA cell lysate (beijing solibao technologies ltd); AACT antibody (USCNK); HA antibody (Proteintech); GAPDH antibody (Proteintech).

Both a549 cells and H157 cells were purchased from the chinese academy of sciences stem cell bank.

TBST buffer: prepared from Tris-base and NaCl, the pH value is adjusted to 7.4, and then 0.1 percent of Tween 20 is added.

5% of skim milk: the cream is prepared by dissolving 1g of illite skim milk powder in 20 ml of TBST solution.

2) Experimental methods

Firstly, cell culture and plating

Recovering lung adenocarcinoma cells A549 and lung squamous carcinoma cells H157, and culturing. Cells in logarithmic growth phase were then plated, a549 cells: 6-well plate, cell concentration per well 3.0X 10⁵Per ml; 96-well plates with a cell concentration of 5.0X 10 per well³One per ml. H157 cells: 6-well plate with cell concentration of 2.45X 10 per well⁵Per ml; 96-well plates with a cell concentration of 4.08X 10 per well³One per ml.

② the over-expression vector pCS2-HA-AACT plasmid to transfect NSCLC cells

The positive single clone with correct sequencing is subjected to amplification culture, and an over-expression vector pCS2-HA-AACT plasmid is extracted by using a Kangshi endotoxin-free medium-extracting kit (CWBIO, No. CW 2105). Transfection of adherent cells was performed with the transfection reagent High Gene (ABClonal, number RM 09014). According to the instructions, the High Gene transfection reagent B solution is slowly dripped into the plasmid A-containing solution, namely the compound is kept still, and then added into a 6-well plate and a 96-well plate of the paved cells respectively.

Expression of over-expression vector pCS2-HA-AACT in lung cancer cell detected by western blot

Collecting lung cancer cells after 24h transfection of over-expression AACT gene, preparing a protein sample by cracking RIPA lysate containing 0.2 mM PMSF, carrying out 12% SDS-PAGE electrophoresis, transferring the strips in the gel onto 0.22 mu m PVDF membrane (Millipore), sealing with 5% skimmed milk at room temperature for 1 h, washing the membrane, and then applying primary antibody (anti-AACT, 1: 2000 dilution, USCNK; anti-HA, 1: 5000, Proteintech; anti-GAPDH, 1: 10000 dilution, Proteintech) at 4 ℃ overnight. The membrane was washed three times with 0.1% TBST at room temperature, and goat-anti-rabbit HRP-IgG secondary antibody (1: 10000 dilution, Proteintech) was incubated, and the membrane was washed three times with 0.1% TBST at room temperature, followed by detection with chemiluminescence kit (Bio-Rad), and developed.

Detecting the influence of AACT overexpression on lung cancer cell proliferation by CCK8

After 48 hours of transfection, 10. mu.l of CCK8 reagent (Japan Co., Ltd.) was added to the 96-well plate, mixed well, and measured for OD450 nm by a microplate reader (Spectra Max i3X, Shanghai Co., Ltd., Meigu molecular apparatus). The measured values were calculated using an Excel table and subjected to data analysis using Graphpad Prism software (version 6.0), with p < 0.05 considered statistically significant.

Collecting cultured lung cancer cells such as A549, H157, H1975 and SK-LU-1, and detecting by Western blotting that the expression level of AACT in A549, HI57 and H1975 cells is reduced, as shown in FIG. 4; lung cancer cells transfected with over-expressed AACT genes for 24 hours are collected, and as shown in figure 5, Western blotting detection finds that the over-expression of AACT in A549 cells and H157 cells is successfully realized; the plasmid for over-expressing AACT is detected by CCK8 experiment and transfected into A549 cells and HI57 cells for 48 hours, and the proliferation of the A549 cells and H157 cells is obviously inhibited (figure 6).

In FIG. 4, AACT is expressed in a decreased amount in A549, H157 and H1975 cells; in fig. 5, the detection with the AACT antibody and the HA-tagged antibody shows that the target gene AACT is successfully overexpressed in a549 cells and H157 cells;

in FIG. 6, after 24H or 48H of transfection, the proliferation of A549 cells and H157 cells showed obvious inhibition effect, and the inhibition effect was more obvious after 48H of transfection.

According to the AACT gene overexpression reagent, the preparation and the application of the AACT gene overexpression reagent, a pCS2 vector for overexpressing the AACT gene is successfully constructed by applying a molecular biology technology, the AACT gene is successfully overexpressed in A549 cells and HI57 cells through western blot detection, and a CCK8 experiment result shows that the proliferation of the A549 cells and H157 cells is obviously inhibited after the AACT is overexpressed. The invention provides a new feasible tool for treating the lung cancer.

Sequence listing

<110> university of northHubei province

<120> AACT gene overexpression reagent, preparation method and application thereof

<141> 2020-09-14

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 54

<212> DNA

<213> Homo sapiens

<400> 1

cagactacgc tggccggcca gaattcgcca ccatggagag aatgttacct ctcc 54

<210> 2

<211> 48

<212> DNA

<213> Homo sapiens

<400> 2

gtaatacgac tcactatagt tctacactag gcttgcttgg gattggtg 48

Claims (1)

1. The application of AACT gene overexpression reagent in preparing the medicine for inhibiting the lung cancer cell proliferation is characterized in that the preparation method of the AACT gene overexpression reagent comprises the following steps:

1) using human cDNALibrary as template, design withEcoR I and Xba IPrimer of enzyme cutting site, enhancer sequence GCCACC is added in front of promoter ATG, AACT of product coding region sequence is obtained by PCR amplification, namely AACT with product coding region sequenceEcoRI andXbai, target gene AACT of double enzyme cutting sites;

2) pCS2-HA was used for empty carriersEcoRI andXbai, carrying out double enzyme digestion, and recovering an enzyme digestion product by using a gel recovery kit to obtain a linearized pCS2-HA vector;

3) connecting the target gene AACT obtained in the step 1) with the linearized pCS2-HA vector obtained in the step 2) to form an overexpression vector pCS2-HA-AACT, namely the AACT gene overexpression reagent;

in the step 1), a human cDNA library is used as a template, a primer is designed, the full length of the AACT gene coding sequence is amplified by PCR by using a recombinant cloning method, and the primer sequence of the target gene amplified by PCR is as follows:

the upstream primer is as follows:

5′>CAGACTACGCTGGCCGGCCAGAATTCGCCACCATGGAGAGAATGTTACCTCTCC>3', underlined part isEcoR I, enzyme digestion site;

the downstream primer is:

5′>GTAATACGACTCACTATAGTTCTACACTAGGCTTGCTTGGGATTGGTG>3', underlined part isXbaI, enzyme digestion site;

the reaction system for PCR amplification of the target gene is as follows:

the PCR amplification conditions were as follows:

amplifying for 30 cycles, extending for 5 min at 72 ℃, performing electrophoresis on the PCR amplification product, and recovering the product by using a glue recovery kit to obtain a PCR product, namely the stripEcoRI andXbai, target gene AACT of double enzyme cutting sites;

the enzyme digestion system in the step 2) is as follows:

the ligation in step 3) is performed by using 2 XMultiF Seamless Assembly Mix recombinant ligase, and the ligation system is as follows:

Images