CN112107684A - Methods and compositions for treating ARID2 or HSPA1A mediated diseases - Google Patents

Abstract

The present invention relates to methods and compositions for treating ARID2 or HSPA1A mediated diseases. Specifically, the invention provides an application of an agent which takes HSPA1A as a target and inhibits the expression or activity of HSPA1A in preparing a medicament for treating or preventing an ARID 2-mediated disease, and an application of an agent which takes ARID2 as a target and improves the expression or activity of ARID2 in preparing a medicament for treating or preventing an HSPA 1A-mediated disease.

Description

Methods and compositions for treating ARID2 or HSPA1A mediated diseases

Technical Field

The present invention relates to methods and compositions for treating ARID2 or HSPA1A mediated diseases.

Background

Studies have shown that chromatin remodeling genes play an important role in a variety of physiological and pathological conditions (Tang L et al, 2010; Wu JI et al, 2009). As an important component of chromatin remodeling factors, the SWI/SNF complex remains conserved from yeast to humans and is involved in cell differentiation, proliferation and DNA repair processes (Masliah-Planchon J et al 2015; Narlikar GJ et al 2013; Romero OA and Sanchez-Ceseeds M2014). The SWI/SNF complex, consisting of about 15 subunits including lineage-specific factors, can slide on DNA in an ATP-dependent fashion along nucleosomes, and also regulate the expression of lineage-specific genes by way of combinatorial assembly (Wu JI et al, 2009). Loss of function of the SWI/SNF complex is likely to be associated with malignant progression of the disease (Tang L et al, 2010). Mutations of individual components of the SWI/SNF complex frequently occur in cancers, with overall mutation rates of the individual components of the complex varying in height among different epithelial tumors, such as a mutation rate of 75% in ovarian clear cell cancers (Yamamoto S et al, 2012), 57% in renal clear cell cancers (Varela I et al, 2011), 40% in hepatocellular carcinomas (Li M et al, 2011), 34% in melanomas (Hodis E et al, 2011), and 35.12% in lung cancers (Huang HT et al, 2015).

PBAF and BAF are two subunits of the SWI/SNF complex, but only PBAF with two distinct subunits, BAF200 and BAF180, can promote transcriptional activation in vitro through nuclear receptors (Lemon B et al, 2001). BAF200, encoded by the ARID2 gene, is essential in the function and selectivity of PBAF. Knock-down of ARID2 may affect protein levels of other PBAF subunits as well as PBAF function in development and differentiation (Xu F et al, 2012; Yan Z et al, 2005). Unintentional mutations of ARID2 found in about 10% of melanoma samples are predicted to be loss-of-function mutations and lack the ability to bind DNA, therefore, ARID2 is currently considered a tumor suppressor gene (Hodis E et al, 2012). The inactivating mutation rate of ARID2 was approximately 18.2% in both U.S. and European HCV-associated liver cancers (Li M et al, 2011; ZHao H et al, 2011). Importantly, in lung cancer, which is one of the leading causes of cancer death worldwide, ARID2 is also listed as one of the most frequently mutated genes following TP53, KRAS, EGFR, CDKN2A and STK11, with an inactivating mutation rate of about 5-7% in non-small cell cancers (Manceau G et al, 2013). However, the role of ARID2 in the malignant progression of lung cancer is still unclear.

Disclosure of Invention

The invention provides application of a reagent which takes HSPA1A as a target and inhibits the expression or activity of HSPA1A in preparing a medicament for treating or preventing ARID 2-mediated diseases.

In one or more embodiments, the ARID 2-mediated disease is a tumor or cancer, preferably selected from the group consisting of: lung cancer, ovarian clear cell cancer, renal carcinoma, liver cancer, gastric cancer, pancreatic cancer, melanoma, diffuse B large cell lymphoma, multiple myeloma, glioblastoma, head and neck cancer, medulloblastoma, breast cancer, and chronic lymphocytic leukemia.

In one or more embodiments, the ARID 2-mediated disease is a disease resulting from low expression or low activity of ARID2 or a deletion of ARID 2.

In one or more embodiments, the ARID 2-mediated disease is lung cancer resulting from low expression or activity of ARID2 or loss of ARID 2.

In one or more embodiments, the ARID 2-mediated disease is non-small cell lung cancer due to low expression or activity of ARID2 or a deletion of ARID 2.

In one or more embodiments, the agent that targets HSPA1A and inhibits expression or activity of HSPA1A is selected from the group consisting of:

(1) antibodies to HSPA 1A;

(2) a homologous recombination vector encoding a nucleic acid sequence of a HSPA1A mutant with down-regulated or lost activity compared to wild-type HSPA 1A;

(3) a nucleic acid molecule selected from the group consisting of siRNA, antisense RNA, ribozymes, and gene editing vectors; and

(4) a small molecule inhibitor.

In one or more embodiments, the siRNA or antisense RNA binds to the promoter region of HSPA1A, and the gene editing vector knocks out or introduces a mutation in the promoter region of HSPA1A that results in inactivation of the promoter, thereby inhibiting expression of HSPA 1A.

In one or more embodiments, the small molecule inhibitor is selected from the group consisting of: ATP mimetics, dihydroxypyrimidines, fatty acid sulfonyl galactosylceramides, (-) -catechins, myricins, MKT-077, gerilin analogs, thiophene-2-amides, phenylacetylene sulfonamides, polypeptides, acyl benzamides, J protein substrate analogs, and TPR domain inhibitors; more preferably, the small molecule inhibitor is KNK 437.

The invention also provides application of the reagent which takes the ARID2 as a target and improves the expression or activity of the ARID2 in preparing a medicament for treating or preventing HSPA1A mediated diseases.

In one or more embodiments, the HSPA1A mediated disease is a tumor or cancer, preferably selected from the group consisting of breast, colon, rectal, liver, prostate, esophageal, cervical, and lung cancer.

In one or more embodiments, the HSPA1A mediated disease is a tumor or cancer that is the result of low expression or activity of ARID2 or a deletion of ARID 2.

In one or more embodiments, the HSPA1A mediated disease is lung cancer with low expression or activity of ARID2 or a deletion of ARID 2.

In one or more embodiments, the HSPA1A mediated disease is non-small cell lung cancer with low expression or activity of ARID2 or a deletion of ARID 2.

In one or more embodiments, the agent that targets ARID2 that increases expression or activity of ARID2 is selected from the group consisting of:

(1) an expression vector for ARID 2;

(2) an expression vector comprising a nucleic acid molecule capable of promoting expression of the ARID2 gene carried by the host cell itself.

Drawings

FIG. 1: knocking down ARID2 promotes malignant progression of human lung cancer cells. A: survival curve analysis was performed on low expressing ARID2 and high expressing ARID2 lung adenocarcinoma samples in the GEO database (PubMed: Okayama et al, accession number GSE 31210); b: survival curve analysis was performed on patients with low-expression ARID2 and high-expression ARID2 lung squamous carcinoma in the TSGA database (PubMed: Hammermann et al, accession number TCGA _ LUSC); c: plotting survival curves for ARID2 expression levels in chinese non-small cell lung cancer patients; D-F: transfecting control group and ARID interfering group plasmids in human non-small cell lung cancer cell lines CRL-5907, A549 and CRL-5866, and paving a 96-well plate after transfecting for 48h to detect cell proliferation; G-H: the control group and the ARID2 interference plasmid were transfected in mouse cell lines Kras MEF and KL, after which cell growth was detected; i: tumor volume was measured in nude mice after in situ transplantation of control and ARID2 knockdown cells to form tumors, at 6, 8, 10, 12, 14, 15 days after tumor formation; j: photographing control group and orthotopic transplantation tumor formed by cells with knocked-down ARID2 and detecting the weight of the tumor; k: the control group and the ARID2 knocked-down orthotopic transplantation tumor are fixed by 4% formaldehyde, dehydrated, embedded, sliced, then subjected to ARID2 and Ki67 immune tissue slices, and photographed under a 40-fold optical microscope; l: control and ARID2 after Ki67 staining interfered with statistics of Ki67 positivity of transplanted tumor sections in groups.

FIG. 2: knocking-down ARID2 promotes malignant progression of a primary lung cancer model of a mouse. A: kras^G12D/+(K)，Kras^G12D/+Arid2^fl/fl(KA) and Kras^G12D/+Lkb1^fl/fl(KL) experimental design of mice injected with adenovirus to induce lung neoplasia for 6 or 8 weeks; b: K. survival curves of KA and KL mice after nasal drip treatment; c: taking the whole lung of a K, KA mouse after the virus is inhaled for 12 weeks, and carrying out dehydration embedding HE staining; d: K. after the KA mouse virus is inhaled for 12 weeks, taking the lung of the mouse and counting the number of tumors by HE staining; e: analyzing the negative tumor condition of the lung after 8 weeks and 12 weeks of the inhalation of the K and KA mouse viruses; f: kras^G12D/+Lkb1^fl/fl(KL) and Kras^G12D/+Lkb1^fl/flArid2^fl/fl(KLA) experimental design of mouse induced neoplasia; g: analyzing survival curves of KL and KLA mice after nasal drip; h: taking out the whole lung after the KL and KLA mouse viruses are inhaled for 6 weeks, and observing the tumor type by HE staining; i: killing KL and KLA mouse viruses after 6 weeks of inhalation, and counting tumor grading after HE staining; j: KL and KLA mouse tumor burden analysis 6 and 8 weeks after virus inhalation; k: KL and KLA mouse viruses were aspirated for 6 weeks before lymph nodes were removed and HE staining of liver and pleura was performed.

FIG. 3: the ARID2 transcript level down-regulates HSPA1A gene expression. A: the upper panel shows the design of the primers used in ChIP-QPCR, designed between 1900 and 1894 upstream of the transcription start site of the promoter region of HSPA1A gene. The lower panel shows the ChIP-QPCR results, and detection confirms that ARID2 binds to HSPA1A gene promoter region in KL and K mouse MEF. B-C: ARID2 overexpression and knockdown of plasmid and HThe reporter plasmid in the SPA1A promoter region was co-transfected into 293T cells and dual luciferase activity was detected. D: extracting wild mouse, Kras^G12D/+Mouse and Kras^G12D/+Arid2^fl/flMouse RNA was tested for expression of HSPA1A in 3 samples by QPCR. E: collecting wild type mouse, Kras^G12D/+Mouse and Kras^G12D/+Arid2^fl/flTotal mouse protein, Western Blot method for detecting the expression of HSPA1A protein in different tumor models. F: two human patients with non-small cell lung cancer were lung sampled for tissue embedding and sectioning, immunohistochemical staining for two antibodies, ARID2 and HSPA1A, and post-hematoxylin counterstaining for mounting. G: extracting total RNA of collected human non-small cell lung cancer samples, detecting the expression levels of ARID2 and HSPA1A by a QPCR method after reverse transcription, and mapping.

FIG. 4: knockdown of HSPA1A inhibits malignant progression of ARID2 deficient lung cancer. A-D: 3 transfection 3 of 3 control 3 group 3 and 3 HSPA 31 3 A 3 interfering 3 plasmids 3 into 3 Kras 3 MEF 3, 3 KL 3, 3 KLA 3- 3 A 3, 3 KLA 3- 3 2 3, 3 48 3 h 3 after 3 transfection 3, 3 96 3- 3 well 3 plates 3 were 3 plated 3 to 3 detect 3 cell 3 growth 3. 3 E: 3 Kras 3 MEF 3, 3 KL 3, 3 KLA 3- 3 A 3 and 3 KLA 3- 3 2 3 cells 3 with 3 HSPA 31 3 A 3 knocked 3 down 3 are 3 fixed 3 by 3 a 3 fixing 3 solution 3 at 3 room 3 temperature 3, 3 washed 33 3 times 3 by 3 PBS 3, 3 stained 3 by 3 PI 3 / 3 annexin 3 V 3, 3 photographed 3, 3 and 3 randomly 3 selected 3 10 3 fields 3 to 3 count 3 the 3 proportion 3 of 3 apoptotic 3 cells 3. 3 F: and (3) transplanting the KLA cells of the control group and the HSPA 1A-knocked-down KLA cells into the lung of a nude mouse to form tumor, and counting the number of the tumor under a light microscope after sampling embedded section HE staining. G: KLA transplanted tumors of control and knockdown HSPA1A were analyzed gravimetrically. H: control and Hspa1a interfering groups transplanted tumors were stained with Ki67 and cleaved caspase3 (i.e., CC-3), counterstained with hematoxylin, and the staining of Ki67 and CC-3 was observed under a 40-fold microscope. I-J: statistical plots of Ki67 and CC3 staining positive.

FIG. 5: knockdown of HSPA1A specifically inhibits the malignant progression of ARID2 deficient lung cancer. A: design of tumor induction by nasal knock-down of HSPA1A gene at 12 weeks in K and KA mice. B: tumors formed in K and KA mice after the control group and the knockdown HSPA1A were paraffin-embedded and HE-stained, and the tumors were observed under a light microscope. C-D: HE staining of tumors was performed after knocking down HSPA1A 12 for 12 weeks in K and KA mouse models, and tumor burden was counted. E-F: and counting the average tumor number of the I stage, the II stage and the III stage by HE staining of K and KA mouse tumors of a control group and a mouse with a knocked-down HSPA1A gene. G: k and KA miceAfter nasal drip, Ki67 staining was performed in the control group and HSPA1A interference group. H: statistics of K and KA mouse tumor Ki67 positive cell staining. I: kras^+/G12DArid^+/+And Kras^+/G12DArid^fl/flAfter the mice had developed tumors after 12 weeks of nasal drip induction of the control group and interference of HSPA1A, the tumors were stained with paraffin-embedded section CC-3 and the staining results were observed under a light microscope. J: k and KA mouse tumor CC-3 staining positive sections are randomly selected 10 visual fields under a light microscope to count the CC-3 positive rate.

FIG. 6: the medicine inhibits HSPA1A from inhibiting the growth of ARID 2-deficient lung cancer tumor. A: treating KL and KLA cells with a KNK437 inhibitor, and collecting total protein Western Blot to detect the expression of HSPA 1A. B: after KL and KLA cells are paved on a 96-well plate, the cells are treated for 48h by KNK437 with different concentration gradients, and then the cell growth is detected, and IC50 is counted. C: KL and KLA cells treated by KNK437 are fixed by a fixing solution at room temperature, PI/Annexin V is stained, and 10 fields of view are randomly selected under a light microscope to count the apoptosis staining positive rate. D-E: tumor volumes were counted daily after 5 days of KNK437 treatment of KL and KLA mice. F: KL mouse transplantable tumors of the KNK437 untreated group and the treated group were paraffin-embedded and sectioned, and after deparaffinization, staining was performed with Ki67 and CC-3, and the staining results were observed under a light magnification microscope. G-H: KL and KLA transplants from untreated and KNK 437-treated groups were counted for Ki67 and CC-3 positive staining by embedded sections. I: KLA transplants from both untreated and treated groups of KNK437 were stained with Ki67 and Caspase3 and recorded by light-powered microscopy. J-K: statistics of positive staining of KLA transplantable tumors Ki67 and Caspase3 in both the non-treated and treated groups of KNK 437.

In the figure: ctrl refers to control.

Detailed Description

It is to be understood that within the scope of the present invention, the above-described technical features of the present invention and the technical features described in detail below (e.g., the embodiments) may be combined with each other to constitute a preferred embodiment.

The comprehensive analysis of human clinical samples, cell lines and a gene engineering mouse model with KrasG12D as background proves that ARID2 plays a role in inhibiting cancer in the development process of lung cancer; in addition, the invention also identifies HSPA1A as a potential synthetic lethal target of ARID 2-deleted lung cancer.

Accordingly, the present invention relates to the treatment or prevention of ARID2 mediated diseases and the treatment or prevention of HSPA1A mediated diseases.

Herein, ARID2 refers to AT-rich interaction domain 2(AT-rich interaction domain2), which encodes BAF200 protein (also known as CSS6 or p 200). The ARID2 gene or BAF200 protein coded by the ARID2 gene comprises ARID2 gene and BAF200 protein from different species, in particular ARID2 gene and BAF200 protein of mammals (such as human, mice and the like), in particular ARID2 gene and BAF200 protein of human. The gene ID of human ARID2 in NCBI is 196528, and the human BAF200 protein has different subtypes, and its accession numbers in NCBI can be respectively seen in NP-689854.2 and NP-001334768.1. It is understood that the ARID2 gene and BAF200 protein described herein include mutants well known in the art. These mutants are usually naturally produced and carried by the animal itself. I.e., such genes or proteins that may be referred to in the art as "ARID 2" and "BAF 200" are included within the scope of the present invention. ARID2 is expressed in a variety of tissues including adrenal gland, cecum, bone marrow, brain, colon, duodenum, endometrium, esophagus, bladder, heart, kidney, liver, lung, lymph node, ovary, pancreas, prostate, skin, small intestine, spleen, stomach, testis, and thyroid.

Mutational studies have shown that ARID2 acts as a cancer inhibitor in a variety of cancers including, but not limited to, ovarian clear cell carcinoma, renal clear cell carcinoma, liver cancer, stomach cancer, pancreatic cancer, melanoma, diffuse B large cell lymphoma, multiple myeloma, glioblastoma, head and neck cancer, medulloblastoma, breast cancer, and chronic lymphocytic leukemia, among others. The present invention further demonstrates that ARID2 also plays an inhibitory role in lung cancer. Accordingly, the ARID2 mediated diseases described herein particularly refer to cancers, including solid tumors and hematological tumors, that result from low expression or low activity of ARID 2. More specifically, the ARID 2-mediated diseases described herein include, but are not limited to, lung cancer, ovarian clear cell cancer, renal clear cell cancer, liver cancer, stomach cancer, pancreatic cancer, melanoma, diffuse B large cell lymphoma, multiple myeloma, glioblastoma, head and neck cancer, medulloblastoma, breast cancer, and chronic lymphocytic leukemia. Further, the ARID2 mediated diseases described herein include lung cancer, including non-small cell lung cancer, due to low expression or low activity of ARID2 and even loss of ARID 2. It is to be understood that "low expression" and "low activity" as used herein refer to a decrease in the amount of expression or activity in a cancer tissue or cancer cell as compared to a normal tissue or cell.

Treatment or prevention of ARID2 mediated diseases may be achieved by targeting HSPA1A and inhibiting expression or activity of HSPA 1A. HSPA1A is member 1A (Heat shock protein family A (Hsp70) member 1A) of Hsp 70. Herein, HSPA1A genes and proteins include HSPA1A genes and proteins from different species. Even from the same species, there may be genes and proteins that differ somewhat in sequence, but all have the same biological function. Thus, the HSPA1A genes and proteins of the present invention include mutants known in the art. These mutants are usually naturally produced and carried by the animal itself. I.e., such genes or proteins that may be referred to in the art as the "HSPA 1A gene" and the "HSPA 1A protein" are included within the scope of the present invention. The amino acid sequence of the exemplary human HSPA1A has accession number AQY76873.1 in GenBank and its corresponding coding sequence has accession number KY500386.1 in GenBank. One or more of such gene sequences and protein sequences can be obtained from known databases.

In the present invention, inhibition of the activity of HSPA1A protein may be achieved using techniques well known in the art. For example, activity can be antagonized by administering an antibody to HSPA 1A. HSPA1A antibodies are well known in the art and commercially available antibodies can be used. The antibody is preferably a humanized antibody. In addition, the antibody is preferably a monoclonal antibody. Alternatively, inhibition of the activity of the HSPA1A protein may be achieved by expression of a mutant HSPA1A protein, typically with a down-regulation or loss of the biological activity of the mutant HSPA1A as a heat shock protein. For example, a homologous recombinant vector may be expressed in a subject cell, and the nucleic acid sequence encoding HSPA1A with its biological activity as a heat shock protein down-regulated or lost may be recombined into the genome of the cell, e.g., replacing the normal HSPA1A gene, such that the subject cell expresses the mutated HSPA 1A. Mutations typically occur within the functional domain of HSPA 1A. For example, Hsp70 protein is composed of two domains, one domain being the N-terminal Nucleotide Binding Domain (NBD) and the other domain being the C-terminal Substrate Binding Domain (SBD). Mutations may occur in either or both domains, resulting in a decrease or loss of activity of HSPA 1A. The mutation may be an unlimited number of insertion, deletion or substitution mutations, as long as the activity of mutated HSPA1A is down-regulated or lost. In some embodiments, small molecule compounds may also be used to antagonize the biological activity of HSPA 1A. Small molecule inhibitors of HSPA1A are known in the art and include, but are not limited to, ATP mimetics (e.g., 8-aminoadenosines), dihydroxypyrimidines, fatty acid sulfonyl galactosylceramide, (-) -catechin, myricetin, MKT-077, gelalin analogs, thiophene-2-amides, phenylacetylene sulfonamide, polypeptides (e.g., proline-rich antibacterial peptides such as drosocin, pyrrocoricin, and apidaecin), acyl benzamides, J protein substrate analogs, TPR domain inhibitors (e.g., pyrimido-oxazine diones), and the like. Further examples of small molecule inhibitors of HSPA1A can be found in zephyranthis, et al, "progress in the study of heat shock protein 70 and its inhibitors", journal of international pharmaceutical research, 2011, 8 months, volume 38, phase 4, pages 263-269, the disclosure of which (especially concerning Hsp70 inhibitors) is incorporated herein by reference in its entirety. In some embodiments of the invention, the inhibitor of HSPA1A is KNK437 having the following structural formula:

in the present invention, expression of the HSPA1A gene may be inhibited by expression of a suitable nucleic acid molecule. Such nucleic acid molecules include, but are not limited to, siRNA, antisense RNA, ribozymes, and gene editing vectors. siRNA is double-stranded RNA of 20 to 25 nucleotides in length, involved in RNA interference (RNAi), and inhibits expression of the HSPA1A gene in a specific manner. siRNA can also be introduced into a subject's cells via a variety of different transfection techniques and produce specific knockdown effects on HSPA 1A. siRNA can be designed using principles known in the art for siRNA design. For example, a 20-25nt, usually 21nt, sequence starting with an AA dinucleotide can be searched for in HSPA1A mRNA as a siRNA target site. The siRNA of interest can be prepared by methods such as chemical synthesis, in vitro transcription, siRNA expression vectors, PCR expression modules and the like. Antisense RNA refers to RNA that inhibits gene expression after being complementary to mRNA. Antisense RNA typically includes 3 classes: the type I antisense RNA directly acts on the SD sequence and/or partial coding region of target mRNA to directly inhibit translation or is combined with the target mRNA to form double-stranded RNA, so that the type I antisense RNA is easily degraded by RNase III; class II antisense RNAs bind to non-coding regions of mRNA, causing conformational changes in mRNA, inhibiting translation; class III antisense RNAs directly inhibit transcription of target mRNAs. Ribozymes are small RNA molecules with catalytic function that degrade specific mRNA sequences. Ribozymes can specifically cleave a substrate RNA molecule by catalyzing the cleavage of the phosphodiester bond in the RNA strand at the target site, thereby blocking the expression of the target gene. The gene editing vector may be a CRISPR-CAS9 gene editing vector or a TALEN gene editing vector known in the art. In some embodiments, the gene editing vector is constructed using an AAV viral vector as a backbone vector. In some embodiments, the siRNA or antisense RNA binds to the promoter region of HSPA1A, or the gene editing vector knocks out the promoter region of HSPA1A or introduces a mutation in the promoter region that results in inactivation of the promoter, thereby inhibiting expression of HSPA 1A.

siRNA, antisense RNA, ribozymes and gene editing vectors suitable for use in the present invention can be prepared using techniques well known in the art and administered to a subject in need thereof for inhibition of expression of HSPA 1A.

Treatment or prevention of ARID2 mediated diseases may also be achieved by administering an agonist of ARID 2. Agonists of ARID2 include, but are not limited to, expression vectors of ARID 2. Any plasmid or vector that is capable of replication and stability in a host may be used in the present invention, including bacterial plasmids, bacteriophages, yeast plasmids, and viruses (e.g., adenovirus, retrovirus, adeno-associated virus, herpes virus, and lentivirus), among others. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, and translation control elements. The coding sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters are: lac or trp promoter of E.coli; a lambda phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs from retrovirus, and other known promoters that control gene expression in eukaryotic cells. The translation control element includes a ribosome binding site for translation initiation, a transcription terminator, and the like. In higher eukaryotic cells ARID2 is expressed, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene. Examples include the SV40 enhancer at the late side of the replication origin at 100 to 270 bp, the polyoma enhancer at the late side of the replication origin, and adenovirus enhancers. Thus, in some embodiments, an enhancer is also included in the expression vectors of the invention. In addition, the expression vector may optionally comprise one or more selectable marker genes to provide a phenotypic trait, such as a fluorescent protein, for selection of transformed host cells.

Methods for constructing expression vectors containing the coding sequence of ARID2 are well known in the art. For example, the coding sequence for ARID2 can be obtained by chemical synthesis. Alternatively, the coding sequence of ARID2 can be obtained by PCR amplification of DNA/RNA. The coding sequence is then cloned into an appropriate expression vector. Methods well known in the art can be used to construct expression vectors containing the coding sequences described herein and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like.

In the present invention, the expression vector also includes an expression vector containing a nucleic acid molecule capable of promoting the expression of the ARID2 gene carried by the host cell itself.

The Hsp70 family is a class of ATP-dependent chaperones, which are not normally expressed or are poorly expressed in cells. Hsp70 has been found to be highly expressed in cancer tissues of cancers such as breast cancer, colon cancer, rectal cancer, liver cancer, prostate cancer, esophageal cancer, cervical cancer and lung cancer. The invention discovers that ARID2 acts on a promoter of HSPA1A, so that the ARID2 can be used as a target to treat or prevent HSPA1A mediated diseases by improving the expression or activity of ARID 2. Herein, HSPA1A mediated diseases refer to diseases associated with high expression of HSPA1A or due to high expression of HSPA1A, particularly tumors or cancers, including but not limited to breast, colon, rectal, liver, prostate, esophageal, cervical, and lung cancers, among others. In some embodiments, the HSPA1A mediated disease is the tumor or cancer, particularly lung cancer, including non-small cell lung cancer, resulting from low expression or low activity of ARID2 and even loss of ARID 2.

Methods for increasing the expression or activity of ARID2 include administering an agonist of ARID2 as described above, such as an expression vector, including an expression vector of ARID2, and an expression vector containing a nucleic acid molecule that promotes expression of the ARID2 gene carried by the host cell itself.

Therefore, the invention provides application of an agent which takes HSPA1A as a target and inhibits the expression or activity of HSPA1A in preparing a medicament for treating or preventing ARID 2-mediated diseases. The present invention also provides a method of treating or preventing an ARID 2-mediated disease, comprising administering to a subject in need thereof a therapeutically effective amount or a prophylactically effective amount of an agent that targets HSPA1A and inhibits the expression or activity of HSPA 1A. Preferably, the ARID 2-mediated disease is a tumor or cancer, including but not limited to lung cancer, ovarian clear cell cancer, renal clear cell cancer, liver cancer, stomach cancer, pancreatic cancer, melanoma, diffuse B large cell lymphoma, multiple myeloma, glioblastoma, head and neck cancer, medulloblastoma, breast cancer and chronic lymphocytic leukemia, especially tumors or cancers with low expression or low activity of ARID2 and even absence of ARID 2; more preferred are lung cancers, including non-small cell lung cancers, which are the result of low expression or low activity of ARID2 or even a loss of ARID 2. The agent targeting HSPA1A that inhibits expression or activity of HSPA1A is as described above.

The invention also provides the use of an agent that targets ARID2 and increases expression or activity of ARID2 in the manufacture of a medicament for treating or preventing HSPA1A mediated diseases, and a method of treating or preventing HSPA1A mediated diseases comprising administering to a subject in need thereof a therapeutically or prophylactically effective amount of an agent that targets ARID2 and increases expression or activity of ARID 2. HSPA1A mediated diseases include tumors or cancers, such as breast, colon, rectal, liver, prostate, esophageal, cervical and lung cancers, among others; preferably tumors or cancers caused by low expression or low activity of ARID2 or even deletion of ARID 2; more preferred are lung cancers, including non-small cell lung cancers, which are the result of low expression or low activity of ARID2 or even a loss of ARID 2. The reagent taking the ARID2 as a target and improving the expression or activity of the ARID2 comprises but is not limited to an expression vector of ARID2 or an expression vector containing a nucleic acid molecule capable of promoting the expression of the ARID2 gene carried by a host cell.

In the present invention, the mode of administration differs depending on the agent. For example, when an AAV viral vector is used as a backbone vector to construct a gene editing vector, the vector can be administered by intravenous injection. The dose to be administered may also be determined depending on the age, sex, kind and severity of the disease to be treated, etc. of the individual subjects.

The medicament or pharmaceutical composition of the invention may contain an agent that targets HSPA1A to inhibit expression or activity of HSPA1A, or an agent that targets ARID2 to increase expression or activity of ARID2, as described herein. The medicament or pharmaceutical composition may also contain a physiologically or pharmaceutically acceptable carrier or excipient. As used herein, "physiologically or pharmaceutically acceptable carriers" refer to those carriers and diluents which do not significantly irritate the organism and which do not otherwise impair the biological activity and performance of the agents in the pharmaceutical compositions being administered. "physiologically or pharmaceutically acceptable excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of the agent. Non-limiting examples of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.

The agent is present in the pharmaceutical composition in a therapeutically effective amount or a prophylactically effective amount. An effective amount is an amount administered sufficient to ameliorate or in some way reduce the symptoms associated with the disease. The amount administered is an amount effective to ameliorate or eliminate one or more symptoms and can be determined by one of ordinary skill in the art based on the age, sex, physical condition, etc. of the subject. The amount administered may be sufficient to cure the disease, but is generally administered to ameliorate the symptoms of the disease. Repeated administration is generally required to achieve the desired improvement in symptoms.

The pharmaceutical composition of the present invention may be formulated into any suitable dosage form for administration orally, intravenously, topically, or the like.

Herein, the subject is a mammal, especially a human.

The present invention will be illustrated below by way of specific examples. It should be understood that these examples are illustrative only and are not intended to limit the scope of the present invention. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

First, experimental materials and methods

1. Antibodies

HSPA1A (10995-1-AP, Proteintech), JNK (CST-9252, Cell Signaling Technologies), pJNK (CST-9251, Cell Signaling Technologies), human ARID2(GTX129444, GeneTex), mouse ARID2(SC 98299X, Santa Cruz), GAPDH (AC002, Abclonal), RNA Polymerase II (SC 900, Santa Cruz).

2. Cell culture

A549, CRL5866 and CRL5907 were purchased from ATCC, and the passaged cell strain was cultured in high-glucose DMEM medium (Hyclone) containing 8% FBS (Gibco). Both the Kras/Lkb1/ARID2(KLA) -1 and KLA-2 cell lines were derived from KLA mouse tumors and the KL cell line was established from KL mouse tumors. Kras mouse embryo fibroblast cell lines were constructed as before (Wang Z, et al, 2012). Primary cell lines were cultured in high glucose DMEM medium (Hyclone) containing 8% FBS (Gibco).

3. Cell growth assay

The cells are paved in a 96-well plate at the density of 2000 cells per well and are arranged for 6 times, after 24 hours, the cells are treated by adding drugs, after 3 days of culture at 37 ℃,20 uL of 3- (4, 5-dimethylthiazole-2) -2, 5-diphenyl tetrazole bromide is added per well, incubation is carried out for 30 minutes at 37 ℃, 100uL of DMSO is added per well after spin-drying, and the light absorption value at 570nm/630nm is detected.

4. Apoptosis detection

Cancer cells were stained with PI/Annexin V double staining kit (C1062, Beyotime), Flow FACS was detected with BD LSRII, and Flow data were analyzed by Flow Jo (Tree Star).

5. Real-time fluorescent quantitative PCR detection

After extraction of RNA, cDNA was synthesized using a reverse transcription kit (Invitrogen, Carlsbad, Calif.) and detected using ABI 7500(Perkin Elmer Life Science, Shelton, CT).

6.ChIP-PCR

Cells were incubated with 1% formaldehyde at room temperature for 10min, lysed with SDS lysate for 5min, and sonicated to generate fragments of approximately 500 bp. Protein G magnetic beads were pretreated, and incubated overnight at 4 ℃ with ARID2 antibody (SC98299X, Santa Cruz), RNA polymerase II (SC 900, Santa Cruz) and control IgG. The DNA sequence bound to ARID2 was then washed with Protein G magnetic beads, purified using a minElute PCR purification kit (No, 28004, QIANGEN), and the enriched DNA and whole cell DNA were analyzed by PCR detection.

7. Tissue section staining

Dewaxing and hydrating the tissue slices, treating the tissue slices with 3% hydrogen peroxide at room temperature for 15min, sequentially carrying out high fire treatment for 5min, unfreezing for 2min, carrying out microwave antigen retrieval at medium and low temperature for 20min, sealing with sealing liquid, standing overnight for the first time, incubating at 37 ℃ for 30min for the second time, carrying out DAB (digital audio broadcasting) color development for 5min, carrying out hematoxylin counterstaining, and dehydrating and drying. And sealing the neutral resin and observing.

Western Blot assay

Carrying out electrophoresis after cell or tissue lysis, sealing 5% milk of a PVDF membrane after electrotransfer, carrying out DAB color development when primary antibody is over night and secondary antibody is incubated for 1 hour at room temperature, carrying out X-ray film pressing, carrying out immersion in a developing solution for 5-10min, then washing with ionized water, and observing a strip.

9. In situ transplantation

Nude mice were injected subcutaneously with 5X 10⁵Cancer cells until significant tumor formation. Tumor detection volume per day, volume calculation formula is (mm)³) Long x wide ═²)/2。

10. Interference sequences

Human-shARID2-1-F：CCGGCCAGCGTGAAATGTATCCATTCTCGAGAATGGATACATTTCACGCTGGTTTTTG(SEQ ID NO:1)

Human-shARID2-1-R：

AATTCAAAAACCAGCGTGAAATGTATCCATTCTCGAGAATGGATACATTTCACGCTGG(SEQ ID NO:2)

Human-shARID2-2-F：

CCGGCGTACCTGTCTTCGTTTCCTACTCGAGTAGGAAACGAAGACAGGTACGTTTTTG(SEQ ID NO:3)

Human-shARID2-2-R：

AATTCAAAAACGTACCTGTCTTCGTTTCCTACTCGAGTAGGAAACGAAGACAGGTACG(SEQ ID NO:4)

Mice-shArid2-1-F：

CCGGACCTGTCCCGCCTACTAATAACTCGAGTTATTAGTAGGCGGGACAGGTTTTTTG(SEQ ID NO:5)

Mice-shArid2-1-R：

AATTCAAAAAACCTGTCCCGCCTACTAATAACTCGAGTTATTAGTAGGCGGGACAGGT(SEQ ID NO:6)

Mice-shArid2-2-F：

CCGGGACTAACAGCTGCCTTAATATCTCGAGATATTAAGGCAGCTGTTAGTCTTTTTG(SEQ ID NO:7)

Mice-shArid2-2-R：

AATTCAAAAAGACTAACAGCTGCCTTAATATCTCGAGATATTAAGGCAGCTGTTAGTC(SEQ ID NO:8)

Second, result in

1. Knocking-down ARID2 obviously promotes malignant progression of lung cancer

First, we analyzed the clinical relevance of ARID2 expression in human lung cancer using the TCGA database. We found that low expression of the ARID2 gene correlated with a short overall survival time of the patients (fig. 1, a and B). We confirmed this finding in the data of a chinese population cohort of non-small cell cancer patients (fig. 1, C). These results indicate that ARID2 may play a cancer suppressive role in the development of lung cancer.

To test this hypothesis, we knocked down the ARID2 gene in three human NSCLC cell lines CRL-5907, A549, and CRL-5866, and we found that knocking down the ARID2 gene promoted cell growth (FIG. 1, D-F). At the same time, we are in Kras^G12D/+Mouse Embryonic Fibroblasts (MEF) and Kras^G12DKnockdown in/Lkb 1(KL) mouse Lung cancer cell linesARID2, as well as ARID2 knockdown, promoted cell growth (fig. 1, G and H).

To verify the effect of knocking-down ARID2 in vivo, we transplanted ARID 2-knocked-down KL cells and control cells in situ into nude mice. The results indicate that ARID2 knockdown significantly promoted the growth of the transplanted tumors (fig. 1, I and J). Tissue section staining results showed enhanced Ki-67 staining of the ARID 2-deficient transplantant (fig. 1, K and L). These data indicate that ARID2 plays a cancer suppressing role in lung cancer.

Promotion of Kras by deletion of ARID2^G12D/+Malignant progression of lung cancer

We next examined the inhibitory function of ARID2 using genetically modified mice. We found Arid2^fl/flAfter the mice are treated by the nasal inhalation Ad-Cre adenovirus for 12 months, the lungs of the mice basically keep normal structures without obvious tumors, which indicates that the deletion of the ARID2 alone can not drive the lung cancer to generate.

We analyzed over 10000 tumor samples in the MSKCC database and found that ARID2 was co-mutated with KRAS and LKB1 (Ji H et al, 2007; Ding L et al, 2003). Because of the Lox-Stop-Lox Kras^G12D/+(Kras^G12D/+(ii) a K) Mice are the classical model for studying lung cancer development, and we combined K mice with Arid2^fl/flMouse hybridization to obtain progeny Kras^G12D/+Arid2^fl/fl(KA) mice (FIG. 2, A). Following the method described in the previous article (Li F et al, 2015), we used 2X 10⁶Treatment of K and KA mice with pfu Ad-Cre adenovirus with Kras capable of developing lung cancer^G12D/+Lkb1^fl/fl(KL) mice served as positive controls. We found that the survival of KA mice was significantly shorter than K mice (median survival of 15.1 and 30.4 weeks, respectively), approaching that of KL mice (median survival of 15.1 and 14.6 weeks, respectively) (fig. 2, B). The results of the histochemical analysis show that the knock-out of two ARID2 alleles significantly promotes Kras^G12D/+The malignant progression of lung cancer in mice (fig. 2, C), and the significant increase in tumor number and tumor burden in mice with both ARID2 alleles knocked out (fig. 2, D, E) clearly demonstrate that deletion of the ARID2 gene significantly promotes lung cancer development in mouse models.

We subsequently constructed Kras^G12D/+Lkb1^fl/fl Arid2^fl/fl(KLA) mouse model (FIG. 2, F). The survival of KLA mice was significantly lower than KL mice (median survival was 7.1 and 15.9 weeks, respectively) (fig. 2, G). After 6 weeks of nasal instillation of Ad-Cre adenovirus, we found increased lung tumors in KLA mice, with increased numbers of stage II and III tumors and decreased numbers of stage I tumors, compared to control KL mice (FIG. 2, I). In addition, we found that deletion of the ARID2 gene significantly promoted tumor burden (fig. 2, J). These data indicate that the deletion of the ARID2 gene significantly promoted malignant progression of lung cancer in KL mice. In terms of tumor metastasis, all (5/5) KLA mice developed tumor metastasis to lymph nodes, liver and pleura 7 weeks after Ad-Cre adenovirus inhalation (FIG. 2, K). In contrast, no tumor metastasis was found in KL mice (0/5). The data from these in vivo experiments indicate that the ARID2 gene plays an inhibitory role in the development of lung cancer.

ARID2 binding to HSPA1A promoter and downregulating its expression

Next, we investigated how ARID2 exerts its tumor-inhibiting effect. ARID2 is an important component of the chromatin remodeling complex SWI/SNF and can regulate transcription of downstream genes (Xu F and Flowers S, 2012; Duan Y et al, 2016). Therefore, we compared the transcriptome expression of KA and K mouse lung cancer models. Compared with K mice, the expression of 189 genes in KA mouse tumor is obviously up-regulated (p < 0.01). Previous studies found that ARID2 regulates gene expression by binding directly to the promoter region of the gene (Raab JR et al, 2015). Therefore, we performed ChIP-PCR experiments with ARID2 antibody in Kras MEFs and KL cells, and the results showed that ARID2 was aggregated in both cells. However, in KLA cells, the accumulation of ARID2 in the promoter region of HSPA1A was cleared, while RNA polymerase II, which indicates that the gene is in a transcription activated state, was still enriched in the HSPA1A promoter region (fig. 3, a), indicating that ARID2 might regulate the transcription of the latter gene by binding to the HSPA1A promoter region. We further validated the regulation of HSPA1A by the ARID2 gene using a dual luciferase reporter assay. The results show that the fluorescent intensity of the HSPA1A reporter gene decreased significantly after overexpression of the ARID2 gene (fig. 3, B). In contrast, the activity of the HSPA1A reporter gene was significantly enhanced when ARID2 was knocked down (fig. 3, C). We found that KA mouse tumors were expressed with the highest amount of HSPA1A in the mouse model (fig. 3, D, E). We further analyzed the expression of ARID2 and HSPA1A in human non-small cell carcinoma samples using immunohistochemistry (fig. 3, F). Interestingly, expression of ARID2 and HSPA1A appeared negatively correlated (fig. 3, G).

4. Knocking down HSPA1A obviously inhibits the malignant progression of the lung cancer with ARID2 deletion

Next we investigated the potential role of HSPA1A in the malignant progression of lung cancer with ARID2 deficiency. Knockdown of HSPA1A did not significantly affect the growth of Kras MEF or KL tumor cells (fig. 4, a, B), but significantly inhibited the growth of KLA tumor cells (fig. 4, C, D). Research reports that ARID2 is involved in apoptosis (Oba et al, 2017), and we find that the proportion of Annexin V positive staining in KLA cancer cells is obviously increased after knocking down HSPA1A compared with Kras MEF and KL tumor cells containing wild-type ARID2 through Annexin V/PI staining (FIG. 4, E). In addition, knockdown of HSPA1A significantly inhibited malignant progression of KLA cell transplantable tumors (fig. 4, F, G). In agreement, the proportion of Ki67 positive staining was reduced and cleaved caspase3 positive staining was observed in KLA cell transplants following HSPA1A knockdown (fig. 4, H, I, J). These results indicate that proliferation and survival of ARID 2-deficient cells are preferentially dependent on HSPA1A, a finding that provides a potential target for therapy.

5. Knocking down HSPA1A specifically inhibits malignant progression of ARID2 deletion type lung cancer mice

We further detected synthetic lethal effects caused by targeting HSPA1A in the ARID 2-deleted mouse model (fig. 5, a). We found that knocking down HSPA1A in KA mice significantly reduced the burden and malignant progression of primary lung tumors, while having no significant effect on K mice (fig. 5, B-F). We found that knockdown of HSPA1A significantly inhibited the proportion of Ki67 positive staining cells in KA tumors, while significantly increased the number of cleaved caspase3 positive staining cells (fig. 5, G-J), compared to the primary tumors of K mice, and these results demonstrate that HSPA1A knockdown plays a synthetic lethal role in ARID2 deficient lung cancers.

The HSPA1A small-molecule inhibitor can inhibit the growth of ARID 2-deficient lung cancer

KNK437 is a specific inhibitor of HSPA1A, which is well tolerated by immunodeficient mice (Koishi M et al, 2001; Kondrikov D et al, 2015). We found that KNK437 treatment reduced expression levels of HSPA1A, both in vitro and in vivo (fig. 6, a). We found that treatment with 0.1mM KNK437 significantly reduced the survival of ARID 2-deficient KLA cells, but had no significant effect on ARID2 wild-type KL cells (fig. 6, B). The IC50 value of KNK437 in ARID 2-deleted KLA cells was 0.05mM (fig. 6, B), significantly lower than the IC50 value of ARID2 wild-type KL cells at 1 mM. In addition, it was found that treatment with KNK437 induced significant apoptosis of KLA cells, consistent with the effect of knocking down HSPA1A (fig. 6, C). These data further support: targeting HSPA1A results in synthetic lethality in ARID2 deficient lung cancer.

More importantly, we found that KNK437 treatment significantly inhibited the growth of ARID 2-deficient tumors, while having no significant effect on ARID2 wild-type tumors (fig. 6, D, E), and that KNK437 treatment selectively inhibited the proliferation and induced apoptosis of tumor cells in ARID 2-deficient lung cancer (fig. 6, F, J, K). These results indicate that small molecule inhibitors of HSPA1A can selectively inhibit the growth of ARID2 deficient tumors.

Third, summarize and discuss

(1) We verify that ARID2 is an important cancer suppressor gene in lung cancer through an in vitro human non-small cell cancer cell strain and a primary lung cancer mouse model. We found that ARID2 can regulate expression of the HSPA1A gene promoter region by binding to the latter. Malignant progression of the ARID 2-deficient lung cancer can be inhibited by gene-knocking down HSPA1A or pharmacologically inhibiting HSPA 1A.

(2) We used STRING analysis to find that ARID2 correlates with expression of HSPA 1A. Experiments with ChIP-PCR and dual luciferase reporter genes confirmed that ARID2 can negatively regulate the expression of the promoter region of HSPA1A gene by binding to the latter. Analysis of human lung cancer samples further confirmed that ARID2 is negatively associated with expression of HSPA 1A. Functional experiments prove that whether the expression of HSPA1A is knocked down or HSPA1A is inhibited by using a small molecule inhibitor, the malignant progression of the ARID2 deletion type lung cancer can be effectively inhibited. Combining the results of these experiments, our study demonstrated that ARID2 is an important cancer suppressor gene in lung cancer and suggested that targeting HSPA1A could be a potential strategy for treating ARID 2-deficient non-small cell lung cancer.

Sequence listing

<110> Shanghai Life science research institute of Chinese academy of sciences

<120> methods and compositions for treating ARID2 or HSPA1A mediated diseases

<130> 193525

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccggccagcg tgaaatgtat ccattctcga gaatggatac atttcacgct ggtttttg 58

<210> 2

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aattcaaaaa ccagcgtgaa atgtatccat tctcgagaat ggatacattt cacgctgg 58

<210> 3

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccggcgtacc tgtcttcgtt tcctactcga gtaggaaacg aagacaggta cgtttttg 58

<210> 4

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aattcaaaaa cgtacctgtc ttcgtttcct actcgagtag gaaacgaaga caggtacg 58

<210> 5

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccggacctgt cccgcctact aataactcga gttattagta ggcgggacag gttttttg 58

<210> 6

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aattcaaaaa acctgtcccg cctactaata actcgagtta ttagtaggcg ggacaggt 58

<210> 7

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccgggactaa cagctgcctt aatatctcga gatattaagg cagctgttag tctttttg 58

<210> 8

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aattcaaaaa gactaacagc tgccttaata tctcgagata ttaaggcagc tgttagtc 58

Claims (10)

1. The application of a reagent which takes HSPA1A as a target and inhibits the expression or activity of HSPA1A in the preparation of a medicament for treating or preventing ARID2 mediated diseases.

2. The use according to claim 1, wherein the ARID 2-mediated disease is a tumor or cancer, preferably selected from the group consisting of: lung cancer, ovarian clear cell cancer, renal carcinoma, liver cancer, gastric cancer, pancreatic cancer, melanoma, diffuse B large cell lymphoma, multiple myeloma, glioblastoma, head and neck cancer, medulloblastoma, breast cancer, and chronic lymphocytic leukemia.

3. The use of claim 1 or 2, wherein the ARID 2-mediated disease is a disease resulting from low expression or low activity of ARID2 or a deletion of ARID 2; preferably lung cancer caused by low expression or low activity of ARID2 or deletion of ARID2, more preferably non-small cell lung cancer.

4. The use according to any one of claims 1 to 3, wherein the agent targeting HSPA1A which inhibits expression or activity of HSPA1A is selected from the group consisting of:

(1) antibodies to HSPA 1A;

(2) a homologous recombination vector encoding a nucleic acid sequence of a HSPA1A mutant with down-regulated or lost activity compared to wild-type HSPA 1A;

(3) a nucleic acid molecule selected from the group consisting of siRNA, antisense RNA, ribozymes, and gene editing vectors; and

(4) a small molecule inhibitor.

5. The use of claim 4, wherein the siRNA or antisense RNA binds to the promoter region of HSPA1A and the gene editing vector knocks out the promoter region of HSPA1A or introduces a mutation in the promoter region that inactivates the promoter, thereby inhibiting expression of HSPA 1A.

6. The use of claim 4, wherein the small molecule inhibitor is selected from the group consisting of: ATP mimetics, dihydroxypyrimidines, fatty acid sulfonyl galactosylceramides, (-) -catechins, myricins, MKT-077, gerilin analogs, thiophene-2-amides, phenylacetylene sulfonamides, polypeptides, acyl benzamides, J protein substrate analogs, and TPR domain inhibitors; more preferably, the small molecule inhibitor is KNK 437.

7. The application of the reagent which takes the ARID2 as a target and improves the expression or activity of the ARID2 in the preparation of the medicine for treating or preventing the HSPA1A mediated diseases.

8. The use according to claim 7, wherein the HSPA1A mediated disease is a tumor or cancer, preferably selected from the group consisting of breast, colon, rectal, liver, prostate, esophageal, cervical and lung cancer.

9. The use according to claim 7 or 8, wherein the HSPA1A mediated disease is a tumor or cancer with low expression or activity of ARID2 or a deletion of ARID 2; more preferably lung cancer caused by low expression or low activity of ARID2 or deletion of ARID2, preferably non-small cell lung cancer.

10. The use of any one of claims 7-9, wherein the agent that targets ARID2 and increases expression or activity of ARID2 is selected from the group consisting of:

(1) an expression vector for ARID 2;

(2) an expression vector comprising a nucleic acid molecule capable of promoting expression of the ARID2 gene carried by the host cell itself.

Images