CN112094862A - Creation method of marked cotton male sterile line - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a method for creating a cotton male sterile line with a marker. The invention provides a method for creating a cotton male sterile line with a novel marker by using a CRISPR-Cas9 system. The invention is characterized in that a cotton male sterile line with a novel marker is obtained by selecting a target site sgRNA1 and sgRNA2 specific to a GhEMS1 gene and stably expressing the target site sgRNA1 and the sgRNA2 and Cas9 protein in cotton. The anther surface of the transgenic regeneration plant has a black spot phenotype, can be stably inherited to the next generation, and has stable sterility. The invention has the advantages that the defect that the traditional manual castration method wastes time and labor for hybridization is overcome, and the sterile plants are provided with black spot marks, so that the sterile plants can be determined at an early stage conveniently.

Description

Creation method of marked cotton male sterile line

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a creation method and application of a cotton male sterile line with a marker. The invention provides a method for creating a cotton male sterile line with a novel marker by using a CRISPR-Cas9 system. Selecting target sites sgRNA1 and sgRNA2 specific to GhEMS1 gene, and stably expressing the target sites sgRNA1 and sgRNA2 and Cas9 protein in cotton to obtain a cotton male sterile line with a novel marker. The anther surface of the transgenic regeneration plant has a black spot phenotype, can be stably inherited to the next generation, and the male sterility of cotton is stable. The invention has the advantages that the defect that the traditional manual castration method wastes time and labor for hybridization is overcome, and the sterile plants are provided with black spot marks, so that the sterile plants can be determined at an early stage conveniently.

Background

The heterosis can greatly improve the crop yield, cotton is used as an important economic crop and also has obvious heterosis, and the strong heterosis combination of the upland cotton varieties can increase the yield by 20-30%. The 20 th century 90s make a breakthrough, a large amount of insect-resistant high-quality hybrid cotton varieties are cultivated, and the method is popularized and applied in large scale in production. For example, the "Zhongmian" series cultivated at the cotton institute of the Chinese academy of agricultural sciences, the "Huaza cotton" series cultivated at the university of Huazhong agriculture, the "Lu Cotton research" series cultivated at the cotton research center of Shandong province, the "Xiangza cotton" series cultivated at the cotton research institute of Hunan province, and so on. In the aspect of cotton male sterility utilization, after a hole A type cell nucleus male sterile line is discovered by the agricultural academy of sciences of Sichuan province in 1972, the cotton cell nucleus male sterile line and hybrid seed breeding are carried out, and Sichuan hybrid series nuclear sterile hybrid seeds are cultured. A plurality of units in China also breed a series of hybrid by introducing a hole A type genic male sterile dual-purpose line or transferring a new genic male sterile line. The cotton research institute of Chinese agricultural academy of sciences introduces double recessive genic male sterile line of ms5ms5ms6ms6, and breeds multiple hybrid cotton varieties such as ' Zhongmiao ' 38 ' through hybridization and backcross improvement. The Handan city agriculture academy of agriculture in Hebei province screens 104-7A cytoplasmic sterile line from the hybrid progeny of land and sea to obtain three-line hybrid cotton variety approved by multiple countries or provinces such as 'Handan hybrid 98-1'. The existing artificial emasculation pollination seed production method is labor-consuming and time-consuming, the cost of hybrid cotton seeds is increased year by year along with the shortage of rural labor in recent years, and the application area of hybrid cotton is greatly reduced, so that the creation of a male sterile line with stable and reliable fertility is a technical problem which needs to be solved in the production of hybrid cotton in China.

The CRISPR/Cas9 system directly acts on DNA, can edit almost any genome region, influences the functions of corresponding genes, is simple, accurate and efficient, and becomes a hotspot of the genomics research of plants in recent years. On cotton, Wang et al (Wang et al 2018) designed two sgrnas for the A, D subgenome of 1-deoxyxylulose-5-phosphate synthase (CLA) to direct Cas 9-mediated heterotetraploid cotton genome editing. Sequencing results show that more than 80% of mutation frequency occurs at each target site, and no off-target condition is detected in all samples, so that the CRISPR/Cas9 system can generate DNA level mutation on the genome of the alloploid cotton with high efficiency and high specificity.

Gene editing is effectively applied to creation of a plant sterile line, rice TMS5 is a main effective gene of a temperature-sensitive nuclear male sterile line widely applied in China, 10 target sites are designed in a coding region of TMS5 by Zhou and the like, and a CRISPR/Cas9 system is used for directional mutagenesis to create a new temperature-sensitive sterile line without a transgenic element. The established TMS5ab binary construct can be used for the rapid cultivation of temperature-sensitive sterile lines of indica and japonica subspecies (Zhou et al.2016). Ms45 is a male sterility gene found in maize that encodes a carotenoid synthase essential for pollen development. Singh et al (Singh et al.2018) in order to study the effect of the Ms45 gene in wheat, 3 homogemc stains A, B of wheat and the Ms45 homogemc gene of D were edited using CRISPR/Cas9 technology to obtain mutants. The simultaneous mutation of the three homologous sites results in male sterility of wheat, and the sterile line can be restored to fertility by non-simultaneously mutated material. Chen et al edited fertility-related gene MS8 of maize by gene editing technology to obtain a new maize male sterile line (Chen et al.2018). The creation of cotton male sterile line by gene editing technology is a convenient and effective means.

Disclosure of Invention

The invention aims to overcome the defects of incomplete abortion and no obvious mark of a male sterile line in the existing cotton crossbreeding, and provides a method for quickly creating a cotton male sterile line with a mark and application thereof. The invention comprises pRGEB32-GhU6.7-NPT II vector construction (Wang et al 2018), and constructs a gene editing vector aiming at GhEMS1 gene to transform cotton, thereby creating a cotton male sterile line with a specific marker.

The technical scheme of the invention is as follows:

a method for creating a cotton male sterile line with three genes simultaneously knocked out and black spot marks on the surface of anther comprises the following steps:

(1) three DNA fragments of GhEMS1 gene which can be used as a marker are obtained by screening in upland cotton, and the DNA fragments are respectively shown as SEQ ID NO: 1 (named Ghir _ a08G010860), SEQ ID NO: 2 (named Ghir _ D08G010810) and SEQ ID NO: 3 (named as Ghir _ A09G018830), and designing shared target sites sgRNA1 and sgRNA2 by using conserved regions of the three DNA fragments;

wherein the nucleotide sequence of sgRNA1 is as follows:

sgRNA1：AACCTGACCGCTCTTTACAT；

the nucleotide sequences of sgrnas 2 are respectively as follows:

sgRNA2：CAGTGAAATTGTTGGAGTCA；

(2) the sgRNA1-guid RNA and the sgRNA2-guid RNA are connected in series by a PCR method of overlapping extension, and then the high-efficiency transformation vector GhU6.7:: sgRNA1-sgRNA2 is obtained by constructing a CRISPR/Cas9 vector pRGEB32-GhU6.7-NPT II (Wang et al 2018) by a one-step cloning method.

(3) Cotton (cotton species such as upland cotton species Yu 668, although practice of the invention is not limited to this cotton species and variety) is transformed using Agrobacterium-mediated methods to obtain a cotton male-sterile line with a marker.

(4) The editing of the GhEMS1 gene was verified to have no off-target by T0 generation single strain sequencing, PAGE (polyacrylamide gel electrophoresis) and high throughput sequencing.

(5) The heritability of the gene editing method of the present invention was identified by sequencing through observation of individual strains of the T1 generation.

(6) Through semi-thin sections and TUNEL staining protocol (Min et al.2013), a mutant Ghems1 was obtained which failed to form intermediate and tapetum layers, and therefore microsporocytes were degraded by the lack of nutrition.

(7) The T1 generation complete sterile material is crossed with wild (non-transgenic) upland cotton variety to obtain F1 generation cross, and the filial generation shows that the female development of said sterile line is normal.

The cloned sgRNA1 and sgRNA2 can be applied to breeding cotton male sterile lines.

The invention has the following beneficial effects:

(1) the invention discovers that a cotton male sterile plant can be created by simultaneously mutating three gene fragments, namely a Ghir _ A08G010860 gene fragment, a Ghir _ D08G010810 gene fragment and a Ghir _ A09G018830 in cotton by utilizing the constructed GhU6.7 vector sgRNA1-sgRNA 2.

(2) The sequences of sgRNA1 and sgRNA2 identified by the invention have higher specific nuclear editing efficiency.

(3) The male sterile line of the invention is provided with black spot marks, is easy to identify and is convenient for determining the sterile plants in early stage. And the black spot phenotype of the male sterile line can be stably inherited to the next generation, and the sterility is stable.

(4) The abortion rate of the male sterile line of the invention is 100%.

Drawings

FIG. 1: is a phenotype map of the T0 representative plant of the present invention. Description of reference numerals: wt (wild type) wild type individual anther, panel B in fig. 1, panel C in fig. 1, and panel D in fig. 1 are H3, E67, and E27 mutant individual anthers, respectively; e in figure 1, F in figure 1, G in figure 1, H in figure 1 are WT, H3, E67, E27 pollen viability TTC staining, respectively.

FIG. 2: is an edited sequence of the H3 individual strain of the present invention. Description of reference numerals: sgRNA target sites and PAM regions are highlighted with green and red backgrounds, respectively. The length is shown on the right. Omitted nucleotides are indicated by dashed lines and their length is marked above.

FIG. 3: the detection is performed by the edited PAGE (polyacrylamide gel electrophoresis) of T0 and F1 generation plants. Description of reference numerals: panel A in FIG. 3: ghir _ a08G010860, sgRNA1 of Ghir _ D08G010810 gene and sgRNA2 flanking fragments, panel B in fig. 3: sgRNA1 and sgRNA2 flanking fragments of Ghir _ a09G018830 gene.

FIG. 4: the GhEMS1 of the present invention edited F1 generation for different time periods of phenotypic change. In comparison with the wild type, the anthers of the F1 generation plants appeared yellow spots at stage 7, gradually deepened at stages 10 and 13, and finally formed necrotic-like black spots. Description of reference numerals: panel A in FIG. 4, Panel B in FIG. 4, Panel C in FIG. 4 are anthers of wild type at the 7 th, 10 th, 13 th stages, respectively, and Panel D in FIG. 4, Panel E in FIG. 4, Panel F in FIG. 4 are individual anthers of wild type at the 7 th, 10 th, 13 th stages, respectively; panel G in FIG. 4, Panel H in FIG. 4, Panel I in FIG. 4 are anthers of mutant H3-3 at stages 7, 10, 13, respectively, and Panel J in FIG. 4, Panel K in FIG. 4, and Panel L in FIG. 4 are individual anthers of mutant H3-3 at stages 7, 10, 13, respectively. Scale bar: 200 μm.

FIG. 5: is the tissue section of the H3-3F1 generation and wild anther. Description of reference numerals: the upper half of fig. 5 is WT and the lower half of fig. 5 is H3-3. Wherein: panel A in FIG. 5, panel B in FIG. 5, panel C in FIG. 5, panel D in FIG. 5, panel E in FIG. 5, panel F in FIG. 5 are anther sections of wild type at times 2 to 3mm, 5 to 6mm, 6 to 7mm, 7 to 8mm, 9 to 10mm, >24mm, respectively, and panel G in FIG. 5, panel H in FIG. 5, panel I in FIG. 5, panel J in FIG. 5, panel K in FIG. 5, panel L in FIG. 5 are anther sections of mutant H3-3 at times 2 to 3mm, 5 to 6mm, 6 to 7mm, 7 to 8mm, 9 to 10mm, >24mm, respectively. Scale bar: 100 μm

FIG. 6: is the H3-3F1 generation apoptosis TUNEL staining of the present invention. Description of reference numerals: panel A in FIG. 6 and panel B in FIG. 6 show anther TUNEL staining of wild type at 7-8 mm and 9-10 mm respectively, and C, D show anther TUNEL staining of mutant H3-3 at 7-8 mm and 9-10 mm respectively. Scale bar: 100 μm.

DMs: degenerated microspores; e, epidermis; en, endothelium; msc, microsporocytes; mp, mature pollen; ML, intermediate layer; msp, microspore; t, a tapetum layer; tds, tetrad; WT, wild type.

Detailed Description

Description of sequence listing:

sequence listing SEQ ID NO: 1 is the nucleotide sequence of the gene fragment of the present invention (Ghir _ A08G010860 gene fragment). The length is 3828 bp.

Sequence listing SEQ ID NO: 2 is the nucleotide sequence of the gene fragment of the present invention (Ghir _ D08G010810 gene fragment). The length is 3828 bp.

Sequence listing SEQ ID NO: 3 is the nucleotide sequence of the gene fragment (Ghir _ A09G018830 gene fragment) of the invention. The length is 3753 bp.

Sequence listing SEQ ID NO: 4 is the nucleotide sequence of sgRNA1 of three conserved regions of the GhEMS1 gene.

Sequence listing SEQ ID NO: 5 is the nucleotide sequence of sgRNA2 of three conserved regions of the GhEMS1 gene.

Example 1: design of sgrnas

sgRNA design of GhEMS1 Gene

A conserved region of Gossypium hirsutum GhEMS1(Ghir _ A08G010860, Ghir _ D08G010810 and Ghir _ A09G018830) is used for designing a common target site sgRNA1 (the sequence of which is shown in a sequence table SEQ ID NO: 4) and sgRNA2 (the sequence of which is shown in a sequence table SEQ ID NO: 5).

TABLE 1 sgRNA sequence of GhEMS1 gene

Table 1 illustrates: the bases in bold are PAM (protospacer adjacencies motif).

Example 2: CRISPR/Cas9 vector construction

Two sgRNAs are connected with tRNA and gRNA in series by using an overlapping extension PCR method, and then the two sgRNAs are constructed on a CRISPR/Cas9 vector by using a one-step cloning method.

Primer sequences were designed as follows:

a forward primer P1: AAGCATCAGATGGGCAAACAAAGCACCAGTGGTCTAG,

reverse primer P2: ATGTAAAGAGCGGTCAGGTTTGCACCAGCCGGGAAT;

a forward primer P3: AACCTGACCGCTCTTTACATGTTTTAGAGCTAGAAATA,

reverse primer P4: TGACTCCAACAATTTCACTGTGCACCAGCCGGGAAT;

a forward primer P5: AAGCATCAGATGGGCAAACAAA,

reverse primer P6: TTCTAGCTCTAAAACTGACTCCAACAATTTCACTG;

the method comprises the following specific operation steps:

(1) two small fragments are amplified by the first PCR, wherein the first fragment is connected with primers P1 and P2 to form tRNA and sgRNA1, and the second fragment is connected with primers P3 and P4 to form sgRNA1, gRNA, tRNA and sgRNA 2. The PCR reaction system is shown in Table 2.

TABLE 2 PCR reaction System

PCR conditions were as follows: 5min at 95 ℃, 30sec at 55 ℃ and 20sec at 72 ℃ for 3 cycles; then, the mixture was stored at 95 ℃ for 30sec, 60 ℃ for 30sec, and 72 ℃ for 20sec for 27 cycles, at 72 ℃ for 5min and 15 ℃.

(2) The reaction system for splicing fragments 1 and 2 using overlap extension PCR to generate fragment 3PCR is shown in Table 3.

TABLE 3PCR reaction System

PCR conditions were as follows: at 95 deg.C for 5min, at 95 deg.C for 30sec, at 59 deg.C for 30sec, at 72 deg.C for 20sec for 28 cycles, at 72 deg.C for 5min, and at 15 deg.C.

(3) The vector was digested (BsaI, available from NEB of Beijing, cat # R3733L) in the manner shown in Table 4.

TABLE 4 enzyme digestion System

Incubate at 37 ℃ for 5 h.

(4) Connection (Clonexpress Entry Step Cloning Kit from Nanjing Novezam Biotech Co., Ltd.)

Incubate at 37 ℃ for 30min, and keep it on ice for 5 min.

(5) Transformation to GV3101 Agrobacterium competence, kanamycin screening, PCR positive identification (routine methods in the art), U6-7F for forward primer sequencing (GC rich).

U6-7 F:TGTGCCACTCCAAAGACATCAG

Example 3: transformation of cotton using CRISPR-Cas9 system

The constructed vector is introduced into a cotton host cell by an agrobacterium-mediated transformation method. The specific transformation steps are as follows:

(1) selecting plump and healthy upland cotton Yu 668 (selected and bred by agricultural academy of sciences in Henan, good for gifts, but the invention is not limited to the variety), peeling off seed coat, and adding 0.1% HgCl₂Soaking for 10min, washing with sterile water for 3 times, inoculating sterilized cotton seed to sterile seedling germination culture medium, and culturing in 28 deg.C incubator for 4-6d in dark condition;

(2) taking the hypocotyl of the aseptic seedling, cutting into 0.5-0.8cm sections, inoculating the sections into 0.5OD agrobacterium liquid suspended by an agrobacterium activation culture medium, infecting the sections for 10mm, and then sucking the liquid on the surface of the hypocotyl by aseptic filter paper;

(3) inoculating hypocotyls into a co-culture medium, and co-culturing at 21 ℃ for 48 h; transferring to a selective culture medium, and subculturing for 1 time every 1 month until embryogenic callus is obtained; transferring the embryonic callus into a differentiation culture medium to obtain a large number of embryoids;

(4) transferring the obtained embryoid to an embryo germination and seedling culture medium until obtaining a transgenic plant seedling.

The components of the culture medium for transformation and the preparation method are as follows:

sterile seedling germination culture medium: 1/2MS macroelements, 15g/L glucose, 2.5g/L Phytagel; the pH value is 6.1-6.2.

Callus induction medium: MSB, 24-D0.1 mg/L, KT 0.1mg/L, 3% Glucose, 0.3% Phytagel; the pH value is 5.85-5.95.

Agrobacterium activating culture medium: tryptone 5g/L, NaCl 5g/L, MgSO4.7H2O 0.1g/L, KH2PO4, 0.25g/L, mannitol 5g/L and glycine 1.0 g/L; the pH value is 5.85-5.95.

Co-culture medium: MSB +2, 4-D0.1 mg/l, KT 0.1mg/l, 50mg/l AS, 3% Glucose, 0.25% Phytagel, pH 5.8.

Selecting a culture medium: MSB, 2, 4-D0.1 mg/L, KT 0.1mg/L, 3% Glucose, 0.3% Phytagel, kanamycin 50mg/L, and cefuroxime 400 mg/L; the pH value is 5.85-5.95.

Differentiation medium: NH4NO3 was removed from MSB medium, and the amount of KNO3 was doubled, with Gln 1.0g/L, Asn 0.5g/L, IBA 0.5mg/L, KT 0.15mg/L, 3% Glucose, 0.25% Phytagel; the pH value is 6.1-6.2.

Rooting culture medium: 1/2MS inorganic salt + B5 organic matter, 15g/L glucose, 2.5g/L Phytagel; pH is 5.90-5.95;

MSB: MS medium + B5 vitamins.

Example 4: detection of editing effect of CRISPR-Cas9 on GhEMS1 gene

Primers are designed to amplify flanking sequences of the two sgrnas simultaneously, and products are sequenced by sanger. The sequences of the relevant primers for amplification are shown below: a forward primer A08D08-F: CCTGGCTAACAATTTCCTTT, a reverse primer A08D08-R: ATATCAACTGGCAGAGTCCC; a forward primer A09-F: CTTCAGTCTTTAACCTCCCT and a reverse primer A09-R: AACTGGCAACGTACCTTCTA. The statistical results are shown in table 6. Three genes in three individuals have high editing efficiency. FIG. 2 shows the editing of three genes in the H3 individual strain, with the base deletion in the range of 3-27 bases. Fig. 3 shows sgRNA editing detected by PAGE for H3 (T0) and F1, and the sequences of primers for amplification are as follows: a forward primer A08D08-1-F: TATCCCGCCTGAAATTGGTGAG and a reverse primer A08D08-1-R: AATTTCAGGTGGTATTTTCCCTGTA; a forward primer A08D08-2-F: AGAGTATCTTTCAGAGCTTCCA and a reverse primer A08D08-2-R CATCAAACTATTTGAACTCCAT; forward primer A09-1-F: CATCCCGCCAGATGTTGGTGAA, reverse primer A09-1-R: GAGGTGGCAACTGCCCACTG, respectively; forward primer A09-2-F: CGAGTATCTTGCTGAGCTTCCG, reverse primer A09-2-R: TCCATCAAAGTTTCTGAACTCCAC are provided. The results show that the F1 generation had the same fragments as the T0 generation, but some new edit types were generated due to WT pollination, e.g., in H3-3, four sgrnas all generated new edit types.

TABLE 6 statistics of editing efficiency of different strains

Example 5: phenotypic and mutational genetic validation

FIG. 1 is a phenotype of sterility of regenerated plants, as can be seen in FIG. 1: h3 and E67 have no pollen completely, E27 has malformed pollen and is sterile, and the activity is better after wild type TTC is stained. FIG. 4 shows the F1 generation time-dependent phenotypic changes of GhEMS1 edited H3 XWT of the present invention. In comparison with wild type, the anthers of F1 generation plants appeared yellow spots at stage 7, and gradually deepened their color at stages 10 and 13, eventually forming necrotic black spots. Consistent with the H3 phenotype at T0. As shown in FIG. 5, anther section observation was performed at 6 stages for wild type and H3-3 individuals, and H3-3 was found to fail to form the intermediate layer and tapetum, and at >24mm stage, microsporocytes were degraded, eventually leading to H3-3 pollenless formation leading to abortion. The TUNEL staining results in FIG. 6 show that wild type has apoptotic signals at tapetum and pollen of 7-8 mm, 9-10 mm, whereas mutant has microsporocyte degradation signals at 9-10 mm.

TTC pollen viability staining observation specific steps:

8g of TTC (2, 3, 5-triphenyltetrazolium chloride, molecular weight 334.8) is dissolved in 1L of phosphate buffer (26.6 g of dipotassium hydrogen phosphate trihydrate, 10.2g of dipotassium hydrogen phosphate) to prepare 2% working solution, and the working solution is stored at 4 ℃ in a dark place. The obtained mixture is packed in a 1.5ml centrifuge tube, the anther is stuffed in the centrifuge tube, and the anther reacts in an incubator at 37 ℃ for 30min and then is taken out to be observed under a microscope.

The semi-thin slicing method comprises the following specific steps:

(1) placing fresh sample in 2ml centrifuge tube, adding 2ml FAA fixative, soaking the obtained material in fixative, placing in 4 deg.C refrigerator for 2-4 hr, and vacuumizing the centrifuge tube with the material for 1 hr for 15min each time for 4 times.

(2) And (3) dehydrating the sample, respectively immersing the sample into ethanol washing liquor with gradient concentration (50%, 70%, 80% and 90%), and standing for 15min at room temperature.

(3) Staining the sample, immersing the sample in 95% ethanol solution containing eosin, and standing at 4 deg.C overnight.

(4) And (3) washing the sample, namely soaking the sample into absolute ethyl alcohol, and washing for three or four times, wherein a new pipe is required to be replaced for each washing.

(5) The sample was dehydrated and placed in 100% ethanol (containing anhydrous CuSO4) for 15min, and this procedure was repeated 3 times.

(6) Washing the sample, immersing the sample in absolute ethyl alcohol, and washing for three or four times

(7) The dehydrated tissue blocks are put into a 200uL centrifuge tube, 100uL of pre-permeation liquid is added to prepare the pre-permeation liquid (V absolute ethyl alcohol: V penetrant (conventional reagent) ═ 1:1), and the pre-permeation is carried out for 12 hours.

(8) After completion of the pre-permeation, 100uL of the permeation solution was added and the permeation was carried out for 24 hours.

(9) 1.2mL of the permeate was added to a 2mL centrifuge tube, followed by addition of harder II and mixing the two well on a shaker. And (3) subpackaging the uniformly mixed embedding agent into ten 200uL centrifuge tubes, wherein each tube has 120uL, and after the embedding agent is added, the bottom of each tube is looked at to remove generated bubbles. Thereafter, one tissue mass is placed in each tube. And the dissecting needle is used for dipping the embedding medium from time to time, when the embedding medium can be viscous to be withdrawn to be filiform, the dissecting needle is used for adjusting the position of the tissue block so as to lead the tissue block to stand in the embedding block vertically, and after multiple adjustments, the position of the tissue block is ensured not to be changed any more, and the tube cover is closed. The samples were treated in a 37 ℃ incubator for 24h and blown in a fume hood for 12h.

(10) And (3) scribing a plurality of scratches on the tube wall of the centrifuge tube provided with the embedding block along the long axis direction by using a single-sided blade, wherein the scratches are deep enough to touch the embedding block. The tube bottom was cut away again, taking care not to cut the embedded block. The embedded block was then poked out of the centrifuge tube from the bottom with a toothpick and trimmed.

(11) Repairing the block, slicing by using a slicing instrument, placing the sliced slices on a glass slide with polylysine, spreading the slices on a dryer, and drying.

(12) And (3) placing the dried slices into toluidine blue for dyeing for 90s, and then placing the slices in a fume hood for drying.

(13) After the slices are dried, taking neutral gum by a pipette, dripping the neutral gum on the dried slices, covering coverslip, placing at 37 ℃ for more than 12h, and observing after the gum is solidified.

TUNEL staining was performed as follows:

(1) tissue sections (attached to microscope slides) were immersed in a staining jar containing fresh xylene and allowed to stand at room temperature for 5 minutes. This was repeated once, and washed twice with xylene in total.

(2) The specimens were washed and the slides were immersed in a staining jar containing 100% ethanol and left at room temperature for 5 minutes.

(3) The samples were sequentially rehydrated by immersing the samples in graded concentrations of ethanol wash (100%, 95%, 85%, 70%, 50%) and left for 3 minutes each step at room temperature.

(4) The specimen was washed, and the slide was immersed in 0.85% NaCl and left at room temperature for 5 minutes.

(5) The specimens were washed, and the slides were immersed in PBS and left at room temperature for 5 minutes.

(6) The tissue sections were fixed and the slides were immersed in 4% paraformaldehyde solution in PBS without methanol and left at room temperature for 15 minutes.

(7) The specimens were washed, and the slides were immersed in PBS and left at room temperature for 5 minutes. This was repeated once, and washed twice with PBS in total.

(8) The fluid on the tissue was removed and the slide was placed on a flat surface. The stock proteinase K solution (10mg/ml) was diluted 1:500 with PBS to make 20. mu.g/ml proteinase K solution. 100 μ l of 20 μ g/ml proteinase K was added to each slide to cover the tissue sections. The slides were incubated at room temperature for 8-10 minutes.

(9) The specimens were washed and the slides were immersed in a staining jar containing PBS and allowed to stand at room temperature for 5 minutes.

(10) Tissue sections were washed and fixed, and slides were immersed in 4% methanol-free formaldehyde solution in PBS and allowed to stand at room temperature for 5 minutes.

(11) The specimens were washed, and the slides were immersed in PBS and left at room temperature for 5 minutes.

(12) The slide was tapped to remove excess fluid. Cells were covered with 100. mu.l of equilibration buffer. The mixture is allowed to stand for 5 to 10 minutes at room temperature for equilibration.

(13) While equilibrating the cells, the nucleoside mixture was thawed on ice and a sufficient amount of rTdT incubation buffer was prepared for all experiments and optional positive control reactions according to table 1. For a standard reaction with an area less than 5cm, the volume is 50. mu.l, and the total volume of rTdT incubation buffer required is determined by multiplying 50. mu.l by the number of experimental and positive control reactions. For samples with larger surface areas, the reagent volume can be increased proportionally. Most of 100. mu.l of equilibration buffer was blotted with absorbent paper around the post-equilibration area, and 50. mu.l of rTdT incubation buffer was then added to a 5cm area of cells.

(14) Plastic cover slips were applied to the cells to ensure even distribution of the reagents. A paper towel soaked with water is placed on the bottom of the wet box. The slides were placed in a wet box and incubated at 37 ℃ for 60 minutes for tailing reactions. The wet box was wrapped with aluminum foil to avoid light.

(15) 20 XSSC was diluted 1:10 with deionized water and a standard staining jar (40ml) was filled with sufficient 2 XSSC to make up. The plastic coverslip was removed and the slide was immersed in 2X SSC in a staining jar and left at room temperature for 15min to stop the reaction. Ensure that all salts of 20 XSSC are dissolved prior to dilution (step 9).

(16) The samples were washed and the slides were immersed in fresh PBS and left at room temperature for 5 min. This was repeated twice, for a total of three washes to remove unincorporated fluorescein-12-deoxyuridine triphosphate.

(17) The specimen was stained in a staining jar and the slide was immersed in a staining jar containing 40ml of propidium iodide solution freshly diluted to 1. mu.g/ml with PBS in the dark and left at room temperature for 15 minutes.

(18) The samples were washed and the slides were immersed in deionized water and left at room temperature for 5 min. This was repeated twice, for a total of three washes.

(19) Excess water on the slide was drained and the area around the cells was wiped with absorbent paper.

(20) The sample is analyzed immediately as described in step 19. (21) Sealing with rubber glue or transparent nail polish, and air drying for 5-10 min.

(22) The samples were analyzed under a fluorescence microscope and the green fluorescence was observed under fluorescence of 520 ± 20nm using a standard fluorescence filter; the red fluorescence of propidium iodide was observed at >620nm, and the blue DAPI was observed at 460 nm. If necessary, the slides can be stored overnight at 4 ℃ in the dark.

The main references:

1.Chen,R.,Q.Xu,Y.Liu,J.Zhang,D.Ren,G.Wang&Y.Liu(2018)Generation of Transgene-Free Maize Male Sterile Lines Using the CRISPR/Cas9System.Front Plant Sci,9,1180.

2.Min,L.,L.Zhu,L.Tu,F.Deng,D.Yuan&X.Zhang(2013)Cotton GhCKI disrupts normal male reproduction by delaying tapetum programmed cell death via inactivating starch synthase.Plant J,75,823-35.

3.Singh,M.,M.Kumar,M.C.Albertsen,J.K.Young&A.M.Cigan(2018)Concurrent modifications in the three homeologs of Ms45 gene with CRISPR-Cas9 lead to rapid generation of male sterile bread wheat(Triticum aestivum L.).Plant Molecular Biology,97,371-383.

4.Wang,P.,J.Zhang,L.Sun,Y.Ma,J.Xu,S.Liang,J.Deng,J.Tan,Q.Zhang,L.Tu,H.Daniell,S.Jin&X.Zhang(2018)High efficient multisites genome editing in allotetraploid cotton(Gossypium hirsutum)using CRISPR/Cas9 system.Plant Biotechnology Journal,16,137-150.

5.Zhou,H.,M.He,J.Li,L.Chen,Z.Huang,S.Zheng,L.Zhu,E.Ni,D.Jiang,B.Zhao&C.Zhuang(2016)Development of Commercial Thermo-sensitive Genic Male Sterile Rice Accelerates Hybrid Rice Breeding Using the CRISPR/Cas9-mediated TMS5 Editing System.Sci Rep,6,37395。

sequence listing

<110> university of agriculture in Huazhong

<120> creation method of male sterile line of cotton with mark

<141> 2019-12-13

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3828

<212> DNA

<213> Cotton (Gossypium hirsutum)

<220>

<221> gene

<222> (1)..(3828)

<400> 1

atggagttta agcttttgtt tcacttcctc tgtttccttc atttgttgtt atcgatatca 60

ggggcaacga tagagcaagc ggacggaaac ccagacaggg aagctctggt ttccttcaaa 120

agagggcttc aaaaccctca ttttctatca tcatggaacc aaagaattca tttctgcaag 180

tgggatggtg tcacttgtcg gctcggccga gtcacctcgc tttctcttcc atctcggtcc 240

ttgacaggtt ctctctctcc gtccctttcg tccctctcaa acctcaccct cctagacctg 300

tcctctaact ccttctttgg ccaaattccg actgagttgg ccgagttgac tctcctcaag 360

accctcaaac tcgggtctaa ctctttcacc ggaaacatcc cttccgagct gggcagcctg 420

aatgcacttc ggacgctaga actttccacc aatgcactca ctggcacagt gccggctaag 480

cttggacagt taactcagct acagttcttg gacctggcta acaatttcct ttcaggttct 540

ttcccttcaa cactctttga aaaccttcag tctttaacct ctctggatat ttccaacaat 600

tctttctctg gtaatatccc gcctgaaatt ggtgagctaa aaaacctgac cgctctttac 660

attggaatca accaatttac agggaaaata ccacctgaaa ttggtaaact ttcactcctt 720

gagaactttt tttcaccctc ttgttccata acaggacctt tgcctaaaca actatccaat 780

ctaaaatcac tcaccaagct cgacctttct tataacccat tgaaatgttc cattccaaag 840

tctataggaa agttacagaa tttgactata ttgaacctcg tctacaccga gctcaatggt 900

tcaataccag cggagcttgg gaactgccgg aatttgatga tgttgatgct gtctttcaat 960

tcgctgtccg ggtccttgcc tgaggagctt tcaagtttgc ctatgctgac gttttctgct 1020

gaaacgaacc agctttctgg gccactgcca ccttggcttg ggaaatggac ccaggtggag 1080

tctttgctac tttcaaacaa ccacttttca ggtaacatcc ctcctgaaat tgagaattgc 1140

tcaaggctta agcaccttag tttgagcaat aacaagttgt cgggttcgat accaagagag 1200

ttatgcaatg caaaatcact ctttgaggtt gatctcgatg gtaataacct ttcggttacc 1260

attgaggatg tgtttgtgaa ctgtagaaat cttgctcagt tggttttgct caataatcac 1320

attaatggtt caatcccaga gtatctttca gaacttccat tgatggttat tgaccttgac 1380

tccaacaatt tcactggtac cattcctgtg agtttatgga gttcaaatag tttgatggag 1440

ttttctgctg gaaataatat gctagagggg actctgccag ttgatattgg aaatgcggtt 1500

acattggaaa cgcttgttct tagcggtaat cgtttgaagg gaaatatacc aaaggagatc 1560

ggcaatctca cagctctttc tgtgctaaac ttgaactcga atttcttgga aggaaatata 1620

cctgttgaaa ttggatactg caaagcattg acaacgctgg atcttggaaa caacaatttc 1680

agtggatcaa ttcccatgga acttgcagac cttgatcagc tgcagtgcct ggttctttct 1740

cacaataatc tatccggttc catcccttgg aaaccatctt catatttcca tcaggctaat 1800

ctgcccgact tgagctttgt gcagcatcat ggagtattcg atctgtcaca caataggttg 1860

actggtccca tacctgaaga attgggaaac tgtgcagtgg tggtggatct tcttctcaac 1920

aacaacatgc ttactggctg gattccagga tcactttctc gtttgacaaa tcttacaact 1980

ttggatttgt ctggaaattt gctgacgggt cctattcctg ttgaattcgg tgactctctc 2040

aagcttcagg gcttgtattt ggggaataac cagcttacag gaaccatctc tgaaagctta 2100

ggccgtgtgg gtagtttggt aaagttaaat ttgactggca ataggttatc tggtgtagtt 2160

cctgcaagtt ttgggaactt gaaagaactt actcacttgg atttaagcaa taataagctt 2220

gccggtgagc taccttcgtc attgtcccag atgcttaacc tggtggggct ctatgttcag 2280

aagaataggc ttgctggtga gatacataac ctgttctcaa attccgtgtc ttggaagatt 2340

gaagacttga atttgagtaa taacattttc tatggaagct tgccccaatc tttgggcaat 2400

ttgtcttatt tgatgtactt ggatcttcat ggaaataaat ttagtggtgc cattccttca 2460

gaaattggta acttgatgca actagagtat tttgatttat ccagaaacag attttccgga 2520

cagattccag cggaagtgtg tggtttgttc agtctgttct acttgaatct agcagaaaac 2580

cggttgggag gacctgtgcc cagaaatggt atttgtcaaa acctgtcaaa aatctttcta 2640

gctgggaaca atgatctgtg tggaagaatt acaggtttgg agtgccagat cagatgttct 2700

gaaagatctt ctttgttaaa tgcctggggc cttgcaggga ttgtggctgc aagtgtcttt 2760

atcatttttg cttcagcctt tgctgtacgc agatggattt tgcggagtgg ccagctgagt 2820

gatccagaag aaattgagga aagcaaatta aacaacttcc tggatcaaaa tctctgcttc 2880

ttgagcagca gcagcaggtc aaaggagccg ctgagcatca atatagcgac atttgagcag 2940

ccactcctga aactcacact cggtgacatc cttgagggaa cccatcattt ttgcaagacc 3000

aacataatcg gagatggagg ctttggaact gtttacaaag ctaagttgcc tagtgggaag 3060

actgttgcag ttaagaagct aagccaggcc aaaacacaag gcaatcgaga attcatagct 3120

gaaatggaaa ccttgggaaa ggtgaagcac caaaatcttg ttccattgct tggatactgt 3180

tctttgggtg aggagaagct ccttgtttac gaatacatga tcaatggaag tttggatctt 3240

tggttgagaa atcgcagtgg agctcttgat gtccttgatt ggtccaaacg cttcaaaatc 3300

gctgttggtg ctgctcgggg actagcattt cttcaccatg gtttcattcc ccacatcatc 3360

catagagata tcaaagccag caacatctta ctcagtgaag actttgaagc aaaagttgcg 3420

gacttcgggc tggcaagact gattagtgct tgtgaaactc atgttagtac tgatatagca 3480

gggacttttg gttacattcc accagaatat ggacagagcg gtaggtccac tacaaaggga 3540

gatgttttca gttttggtgt gatactgctg gaattggtga ctgggaaaga gccaacaggc 3600

cctgaattta aagagattga aggagggaat ttagttggat gggtgactaa gaagataaaa 3660

aagggtcagg ctgcagatgt tttagatcct gtggttatgg gtgtggattc aaagcagatg 3720

atgcttcagg tgctcagtat tgctgcagtt tgcctggccg agaatcctgc taacagacct 3780

accatgcttc aagtgttgaa gctcctcaaa gggatccaca aggagtaa 3828

<210> 2

<211> 3828

<212> DNA

<213> Cotton (Gossypium hirsutum)

<220>

<221> gene

<222> (1)..(3828)

<400> 2

atggagttta agcttttgtt tcacttcctc tgtttcctct atttgttgtt accgatatca 60

ggggcaacga gagagcaagc agacggaaac ccagataggg gagctctggt ttccttcaaa 120

agagggcttc aaaaccctca ttttctatca tcatggaacc aaaaaatcca tttctgcaag 180

tgggatggtg tcacatgtcg gctcggccga gtcacctcgc tttctcttcc atctcggtcc 240

ttgacaggtt ctctctctcc gtccctttcg tccctcttaa acctcaccct cctagatctg 300

tcctctaact ccttctttgg ccaaattccg actgagttgg ccgagttgac tctcctcgag 360

accctcaaac tcgggtctaa ctctttcacc ggaaatatcc ctcccgagct gggcagcctg 420

aatacacttc gtacgctaga actttccacc aatgcactca ctggcacagt gccgactaag 480

cttggacagt taactcagct acagttcttg gacctggcta acaatttcct ttcaggttct 540

ctcccttcaa cactctttga aaaccttcag tctttaacct ctctggatat ttccaacaat 600

tctttctctg gtaatatccc gcctgaaatt ggtgagctaa aaaacctgac cgctctttac 660

attggaatca accaatttac agggaaaata ccacctgaaa ttggtaaact ttcactcctt 720

gagaactttt tttcaccctc ttgttccata acaggacctt tgcctgaaca actatccaat 780

ctaaaatcac tcaccaagct cgacctttct tataacccat tgaaatgttc cattccaaag 840

tctataggaa agttacagaa tttgactata ttgaacctcg tctacaccga gctcaatggt 900

tcaataccag cggagcttgg gaactgccgg aatttgatga tgttgatgct gtctttcaat 960

tcgctgtccg ggtccttgcc tgaggagctt tcaagtttgc ctatgctgac tttttctgct 1020

gaaacgaacc agctttctgg gccactgccc ccttggcttg ggaaatggaa ccaggtggag 1080

tctttgctac tttcaaacaa ccacttttca ggtaacatcc ctcctgaaat tgagaattgc 1140

tcaaggctta agcaccttag tttgagcaat aacaagttgt cgggttcgat accaagagag 1200

ttatgcaatg cagaatcact ctttgaggtt gatctcgatg gtaataacct ttcgggtacc 1260

attgagaatg tgtttgtgaa ctgtagaaat cttgctcagt tggttttgct taataatcac 1320

attaatggtt caatcccaga gtatctttca gagcttccat tgatggttat tgaccttgac 1380

tccaacaatt tcactggtac cattcctgtg agtttatgga gttcaaatag tttgatggag 1440

ttttctgctg gaaataatat gctagagggg actctgccag ttgatattgg aaatgcggtt 1500

acattggaaa ctcttgttct tagcggtaat cgtttgaagg gaagtatacc aaaggagatc 1560

ggcaatctca cagctctttc tgtgctaaac ttgaattcga atttcttgga aggaaatata 1620

cctgttgaaa ttggagactg caaagcattg acaacggtgg atcttggaaa caacaatttc 1680

agtggatcaa ttcccatgga acttgcggac cttgatcagc tgcagtgcct ggttctttct 1740

cacaataatc tatccggttc catcccttgg aaaccatctt catatttcca tcaggctaat 1800

ctgcccgact tgagctttgt gcagcatcat ggagtattcg atctgtcaca caataggttg 1860

actggtccca tacctgaaga attgggaaac tgtgctgtag tggtggatct tcttctcaac 1920

aacaacatgc ttactggcag gattccagga tcactttctc gtttgacaaa tcttacaact 1980

ttggatttgt ctggaaattt gctgagaggt cctattcctg ttgaattcgg tgactctctc 2040

aagcttcagg gcttgtattt ggggaataac cagcttacag gaaccatctc tgaaagctta 2100

ggtcgtgtgg gtagtttggt aaagttaaat ttgactggca ataggttatc tggtgtagtt 2160

cctgcgagtt ttgggaactt gaaagagctt actcacttgg atttaagcaa taataagctt 2220

gccggtgagc taccttcgtc attgtcccag atgcttaacc tggtggggct ctatgttcag 2280

aagaataggc tttctggtga gatacataac ctgttctcaa attccgtgtc ttggaagatt 2340

gaagacttga atttgagtaa taacattttc tttggaagct tgcctcaatc tttgggcaat 2400

ttgtcttatt tgatgtactt ggatcttcat ggaaataaat ttactggtgc cattccttca 2460

gaaattggta acttgatgca actagagtat tttgatgtat ctggaaacag attatccgga 2520

cagattccag aggaagtgtg cagtttgttc agtctgttct acttgaatct agcagaaaac 2580

cggttgggag gacctgtgcc cagaaatggt atttgtcaaa acctgtcaaa aatctttcta 2640

gctgggaaca atgatttgtg tggaagaatt acaggtttgg agtgccagat cagaagttct 2700

gaaagatctt ctttgttaaa tgcctggggc cttgcaggga ttgtggctgc aagtgtcttt 2760

atcatttttg cttcagcctt tgttgtacgc agatggatta tgcggagtgg ccagctgagt 2820

gatccagaag aaattgagga aagcaaatta aacaacttcc tggatcaaaa tctctgcttc 2880

ttgagcagca gcagcaggtc aaaggagccg ctgagcatca atatagcgac atttgagcag 2940

ccactcctga aactcacact cggtgacatc cttgagggaa cccatcactt ttgcaagacc 3000

aacataatcg gagatggagg ctttggaact gtttacaaag ctaagttgcc tagtgggaag 3060

actgttgcag ttaagaagct aagccaggcc aaaacacaag gcaatcgaga attcatagct 3120

gaaatggaaa ccttgggaaa ggtgaagcac caaaatcttg ttccattgct tggatactgt 3180

tctttgggtg aggagaagct ccttgtttac gaatacatga tcaatggaag tttggatctt 3240

tggttgagaa atcgcagtgg agctcttgat gtccttgatt ggtccaaacg cttcaaaatc 3300

gctgttggtg ctgctcgggg actagcattt cttcaccatg gcttcattcc ccacatcatc 3360

catagagata tcaaagccag caacatctta ctcagtgaag actttgaagc aaaagttgcg 3420

gacttcgggc tggcaagact gattagtgct tgtgaaactc atgttagtac tgatatagca 3480

gggacttttg gttacattcc accagaatat ggacagagcg gtaggtccac tacaaaggga 3540

gatgttttca gttttggtgt gatactgctg gaattggtga ctgggaaaga gccaacaggc 3600

cctgaattta aagagattga aggagggaat ttagttggat gggtgactaa gaagataaaa 3660

aagggtcaag ctgcagatgt tttagatcct gtggttatga gtgtggattc aaagcagatg 3720

atgcttcagg tgctcagtat tgctgcagtt tgcctggccg agaaccctgc taacagacct 3780

accatgcttc aagtgttgaa gctcctcaaa gggatccaca aggagtaa 3828

<210> 3

<211> 3753

<212> DNA

<213> Cotton (Gossypium hirsutum)

<220>

<221> gene

<222> (1)..(3753)

<400> 3

atggagtcta agctttcgtt tcagttcctc tgttttctac atctgttgtt ggtatttata 60

tgggggggca ttagagcgca agaagagcca aacccagaaa gggaagccct catttccttc 120

agaacaagac ttcaaaatcc tcatctcctt tcttcatgga accaacaact ccatcactgc 180

caatgggatg gtgtgatgtg ccaactcggt cgagtcaccg ttcttgctct tacatctcgc 240

tccttgaaag gtcctctctc ttcctctctt tcctcactct ccagcctcac ccttctggac 300

ttgtcctcca actttttgtt tggccaaata ccggttgagt tggctgagtt gactatgctc 360

cgcatcctca aactcgggtc caactttttc acgggaaaaa tccctccgga actgggcagc 420

ctgaaagccc ttcgtacgct agaactttcc tccaatggac tcagtggcac agtgccggct 480

cagctggggc agttgactca cttagagttc ttggacctgg caaacaattt cctttcagat 540

gttggtgaac ttaaaaacct gaccgctctt tacattggca ttaatcaatt cagtgggcag 600

ttgccacctc aaattggtaa cctttcactg ctcgagaact tcttttcacc ctcttgttcg 660

ataactgggc ccttacctga agaactattc agtctacagc tgcttaccaa gcttgacctt 720

tcatataacc cattgaaatg ttccattcca aagtctacag gaaagttaaa gaatttgagt 780

atattgaacc ttgtttacac tgagctcaat ggttcaatac cagcagagct tgggaactgc 840

cagaacttga tgatgttgat gctgtctttc aattccttat ccggctcttt gcctgaggag 900

ctttccaact tgcctatgtt gactttttcc gctgaaaaga atcagctctc tgggccattg 960

ccgccttggc ttgggaaatg gatcaaaatg gagtccttgc tgctttcaag caaccgcttt 1020

tcaggtaaca tcccacctga gttagggggt tgttccatgc tgaagcacct tagtttgagc 1080

aataacatct tgtcgggtca gataccaaga gagctatgta atgcggaatc acttttggag 1140

attgatcttg acggtaataa cctttcgggg accattgaaa atgtttttgt caagtgtaga 1200

aatctcaacc agttggtttt ggttaacaat cacatcaatg gttcagtgcc cgagtatctt 1260

gctgagcttc cgttgatggt tattgacctt gactccaaca atttcactgg caggatacct 1320

gtgagtttgt ggagttcaga aactttgatg gagttttctg ctggaaataa tatgctagaa 1380

ggtacgttgc cagttgaaat tggtaatgct gttacattgc agacccttgt tcttaatcgt 1440

aatcttttga ggggcagaat accgaaggag attggcaatc tcacagctct ctctgtgctt 1500

aacttgaact cgaatttcct agaaggatat ataccagttg aaattggaga ctgcaaagga 1560

cttacaacgt tggatcttgg aaacaacaat ttgagtggac caatcccggt ggaacttgct 1620

gatctgggac tgctgcagtg cctggttctc tcgcacaata atctatcagg ttcaatccct 1680

cggaagccat cattgtattt ccatcaggct aatatgcccg atttaagctt tgttcagcat 1740

catggagtat tcgatttgtc caacaataga ctgactggtc caatacctga agaattgggg 1800

aactgtgttg tggtggtgga tcttctgctt agcaaaaaca tgcttaccgg caacattcca 1860

ggatcacttt ctcgattgac aaatcttaca actttggatt tgtctgggaa tgtgctaaca 1920

ggttcaattc ctgtagaatt tggtgactct ctcaaccttc agggcttgta tttggggaat 1980

aaccggctta ctggaaccat ccctggaagc ttaggccgtg ttggtagttt ggtaaagtta 2040

aacttgactg gcaataagtt atctggtgtt attcctgcaa gttttgggaa cttgaaagag 2100

cttactcact tggatttaag ccgtaatgat cttactggtg agctaccttc ttcactgtcc 2160

cagatgctta acctggtggg gctttatgtt cagcagaata ggctttctgg tggggtaggt 2220

aatctcttct ccaatgccct ctcttggaag attgaagaca tgaatttgag taataacatt 2280

ttcaatggaa acttgccaca atctttgggc aatttgtctt atgcgactta cctggatctt 2340

catgggaata agtttactgg tgagatccct tcagaagttg gtaacttgat gcaacttgaa 2400

tattttgatg tatctggaaa cagattatct ggacagattc cagagagagt atgcgggatg 2460

ttcaatctat tctacttgaa tctggcagaa aaccggttgg aaggtcctgt accccgaact 2520

ggtatttgcc aaaacctgtc caggacattt ctctctggga acagtgatct ctgtggcaga 2580

attatgggtt tagaatgcca gatcagaagt tttgacagat cttctttgtt aagtgcttgg 2640

ggccttgctg cggtcacagc tgcaagtgtc tttatcattt ttacttcggc ctttgctcta 2700

cggagatgga ttatgagtag tagtcagcaa tgtgatccag aagaaattga ggaaagtaaa 2760

ctaaaatcct ttatagatca agagctctat ttcttgagta gcagcaggtc gaaggagccg 2820

ctgagcatca atatagcgat attcgagcag ccactcctga aactgacact aggcgacatc 2880

cttgagggca ctagtcattt ttgtaagacg aatgtgatag gagatggagg ctttggaacg 2940

gtttacaaag ctaagttgcc tagtgggaag acagttgcgg ttaagaagct aagccaggca 3000

aaaacgcagg gccatcgaga attcatagct gaaatggaaa ccttgggtaa ggtgaaacac 3060

caaaatcttg tcccattgct tggatactgt tctttggccg aggagaaact ccttgtttat 3120

gaatacatga ttaatggaag tttggatctg tggttgagaa accgcaccgg agcccttgat 3180

gtccttgact ggtccaaacg cttcaaaatc gcaataggtg ctgcgcgggg actggctttc 3240

cttcaccatg gtttcattcc tcatattatc catagagata tcaaagccag caacatctta 3300

ctcagtgaag actttgaacc aaaagttgcg gacttcgggc tggcaagact tataagtgct 3360

tgcgaaactc atgttagtac tgacatagca gggacattgg gttacatccc accagaatat 3420

ggacagagtg gtagatgcac tacgaaggga gatgtttaca gttttggtgt aattctactg 3480

gaattggtga ctggaaaaga gccaacaggc cctgatttta aagagattga aggaggcaat 3540

ttggttggtt gggtttctaa gaagatgaga atgggtgaag ctgctgacgt tttagatgca 3600

atggttttga atgtggactc aaagcagatg atgctcaagg tgctgagtat tgctgaagtt 3660

tgcttgtctg aaaatcctgc taatagacca actatgcttc atgtgctgaa gctccttaaa 3720

gggatcaagg aggattacct gtctttctac tag 3753

<210> 4

<211> 20

<212> DNA

<213> Cotton (Gossypium hirsutum)

<220>

<221> gene

<222> (1)..(20)

<400> 4

aacctgaccg ctctttacat 20

<210> 5

<211> 20

<212> DNA

<213> Cotton (Gossypium hirsutum)

<220>

<221> gene

<222> (1)..(20)

<400> 5

cagtgaaatt gttggagtca 20

Claims (3)

1. A method for creating a cotton male sterile line with three genes simultaneously knocked out and black spot marks on the surface of anther is characterized by comprising the following steps:

(1) three DNA fragments of GhEMS1 gene which can be used as a marker are obtained by screening in upland cotton, and the DNA fragments are respectively shown as SEQ ID NO: 1 (fragment nomenclature: Ghir _ A08G010860), SEQ ID NO: 2 (fragment nomenclature: Ghir _ D08G010810) and SEQ ID NO: 3 (fragment nomenclature: Ghir _ A09G018830), designing common target sites sgRNA1 and sgRNA2 by using conserved regions of the three DNA fragments;

wherein the nucleotide sequence of sgRNA1 is as follows:

sgRNA1：AACCTGACCGCTCTTTACAT；

the nucleotide sequences of sgrnas 2 are respectively as follows:

sgRNA2：CAGTGAAATTGTTGGAGTCA；

(2) the method comprises the steps of serially connecting sgRNA1-guid RNA and sgRNA2-guid RNA by a PCR method, and constructing the sgRNA1-guid RNA and the sgRNA2-guid RNA on a CRISPR/Cas9 vector by a one-step cloning method to finally obtain a high-efficiency transformation vector GhU6.7, namely sgRNA1-sgRNA 2;

(3) transforming host cotton by using an agrobacterium-mediated method to obtain a cotton male sterile line with anther surface carrying black spot marks.

2. A plant expression vector, wherein said expression vector comprises SEQ ID NO: 1. SEQ ID NO: 2 and SEQ ID NO: 3, or a fragment of the DNA shown in the figure.

3. The use of the sgRNA1, sgRNA2 sequences of claim 1 in breeding cotton male sterile lines.

Images