CN112048564A - Fluorescent quantitative PCR primer group and kit for rapidly detecting ruminococcus and application thereof - Google Patents
Fluorescent quantitative PCR primer group and kit for rapidly detecting ruminococcus and application thereof Download PDFInfo
- Publication number
- CN112048564A CN112048564A CN202010801702.5A CN202010801702A CN112048564A CN 112048564 A CN112048564 A CN 112048564A CN 202010801702 A CN202010801702 A CN 202010801702A CN 112048564 A CN112048564 A CN 112048564A
- Authority
- CN
- China
- Prior art keywords
- ruminococcus
- primer
- kit
- quantitative pcr
- fluorescence quantitative
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a fluorescence quantitative PCR primer group for rapidly detecting rumen coccus and application thereof in preparing a fluorescence quantitative PCR reagent or a kit for detecting rumen coccus, wherein the primer group comprises a forward primer and a reverse primer, and the sequences of the forward primer and the reverse primer are shown as SEQ ID NO: 1-2; the primer group has strong specificity, high accuracy and good stability. The invention also discloses a fluorescence quantitative PCR kit for rapidly detecting the ruminococcus and application thereof in clinical or scientific research detection of the ruminococcus, wherein the fluorescence quantitative PCR kit comprises the specific primer group, optimizes a reaction system and reaction conditions, can specifically and quantitatively detect the ruminococcus from a complex sample, and has no cross reaction with other bacteria; the method has the advantages of high accuracy, good repeatability and strong sensitivity, and can be used for quickly, sensitively and accurately quantitatively detecting the ruminococcus in the intestinal flora.
Description
Technical Field
The invention relates to the technical field of molecular biological detection, in particular to a fluorescence quantitative PCR primer group for rapidly detecting rumen coccus, a kit and application thereof.
Background
The intestinal flora is a huge number of microbial communities in human intestinal tracts, the composition and change of the intestinal flora are closely related to the health condition of a host, the flora plays a vital role in aspects of human metabolism, immunity and the like, and the flora imbalance can cause a series of diseases.
Ruminococcus is a native bacterium in the human intestinal tract, belongs to gram-positive anaerobic bacteria, exists in the rumen and the like of cattle and sheep, and grows under strict anaerobic conditions at 37 ℃. The ruminococcus is spherical or spheroidic, 1 micron or less in diameter, occurring singly, in pairs or in strands; the metabolism is typical mixed fermentation, the metabolites are complex and various, and the influence on the health condition of a human body is large. Researchers at the general hospital for massages in america (MGH) brodifard institute and harvard medical school found that active ruminococcus (ruminococcus gnavus) releases certain polysaccharides (or sugar molecule chains) to trigger immune response, which is directly related to Crohn's Disease (CD) and other forms of Inflammatory Bowel Disease (IBD), etc. The laboratory of the broudder core institute member, infectious disease and microbiome projects, jointly master Ramnik Xavier, also demonstrated earlier that the abundance of r.gnavus in the gut flora could be increased from less than 1% to over 50% during certain outbreaks of crohn's disease.
The existence and the metabolic condition of the ruminococcus in human intestinal tracts are greatly related to various diseases such as Crohn's Disease (CD) and other forms of Inflammatory Bowel Diseases (IBD), so that a rapid, specific and accurately quantifiable ruminococcus detection means is required to be developed to provide technical support for inflammatory bowel disease screening and ruminococcus related disease research.
Disclosure of Invention
In order to overcome the defects of the prior art, one of the purposes of the invention is to provide a fluorescence quantitative PCR primer group for rapidly detecting the ruminococcus, which is designed according to a 16SrRNA genome sequence of the ruminococcus, has strong specificity, high accuracy of amplification of the ruminococcus and good stability;
the invention also aims to provide application of the primer group in preparation of a fluorescence quantitative PCR reagent or a kit for detecting the ruminococcus.
The invention also aims to provide a fluorescent quantitative PCR kit for rapidly detecting the ruminococcus, which comprises the specific primer group, optimizes a reaction system, can specifically detect the ruminococcus from a complex sample, and has no cross reaction with other bacteria except the ruminococcus; the method has the advantages of high accuracy, good repeatability and strong sensitivity, and can be used for quickly, sensitively and accurately quantitatively detecting the ruminococcus in the intestinal flora.
The fourth purpose of the invention is to provide the application of the kit in clinical or scientific research detection of the ruminococcus, further optimize the PCR amplification condition, have good log-linear relationship between the strength of a fluorescence signal and a template amplification product, and have high quantitative detection accuracy; and the method is simple to operate, high in automation degree, less in cross contamination, and clear and visual in result interpretation.
One of the purposes of the invention is realized by adopting the following technical scheme:
a fluorescence quantitative PCR primer group for rapidly detecting rumen coccus comprises a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown as SEQ ID NO: 1, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO: 2, respectively.
The second purpose of the invention is realized by adopting the following technical scheme:
the application of the fluorescence quantitative PCR primer group for rapidly detecting the ruminococcus in the preparation of the fluorescence quantitative PCR reagent or the kit for detecting the ruminococcus.
The third purpose of the invention is realized by adopting the following technical scheme:
a fluorescence quantitative PCR kit for rapidly detecting rumen coccus comprises the primer group; wherein the volume ratio of the forward primer to the reverse primer is 1: 1.
Further, the kit also comprises SYBR Green Reaction Mix, ROX and sterile water.
The fourth purpose of the invention is realized by adopting the following technical scheme:
the application of the fluorescence quantitative PCR kit for rapidly detecting the ruminococcus in clinical or scientific research detection of the ruminococcus comprises the following steps:
s1: extracting the genome DNA of the sample;
s2: putting the genome DNA into a PCR reaction tube, adding a primer group, SYBR Premix Ex Taq, ROX and sterile water into the tube, and carrying out PCR amplification and melting curve determination.
Further, the reaction conditions of the PCR amplification are as follows: 5min at 95 ℃; 95 ℃ for 15s, 58 ℃ for 30s, 40 cycles.
The conditions for measuring the melting curve are as follows: cooling to 55 deg.C for 1min at 95 deg.C, and heating to 95 deg.C; the fluorescence signal was collected throughout the procedure.
And (4) interpretation of results: the sample with the amplification curve above the threshold value is a positive sample, the abundance of the ruminococcus in the sample can be calculated according to the Ct value of the amplification curve and the standard curve, and the result is easy and visual to interpret.
Compared with the prior art, the invention has the beneficial effects that:
1. according to the invention, a specific primer is designed according to the 16SrRNA gene sequence of the ruminococcus, so that the ruminococcus can be specifically and quantitatively detected from a complex sample; the reaction system and the amplification condition are optimized, the repeatability for detecting the ruminococcus is good, and the method is a favorable means for quickly, sensitively and accurately detecting the ruminococcus abundance value in the intestinal flora.
2. The reaction system and the amplification condition of the invention are reasonably designed, the strength of the PCR fluorescent signal and the logarithm linear relation of the template amplification product are good, the initial template concentration of the sample can be quantified by detecting the PCR fluorescent signal, the error is small, and the quantitative sensitivity is high.
3. The kit disclosed by the invention is simple to operate and high in automation degree when being applied, amplification and detection of a PCR product are completed in one step under the condition of closed tube, a cover does not need to be opened, the chances of cross contamination and environmental pollution are less, and the probability of result deviation is reduced; the detection result is also clear and intuitive to interpret. Meanwhile, the whole system does not contain toxic and harmful substances, and is harmless to operators and the environment.
Drawings
FIG. 1 is a photograph of agarose gel electrophoresis of the PCR amplification product of example 1;
FIG. 2 is a graph showing analysis of the delta Ct value of ruminococcus in human feces in example 2;
FIG. 3 is a melting curve diagram of the fluorescent quantitative PCR of example 2;
FIG. 4 is a fluorescent quantitative PCR amplification standard curve of Ruminococcus in example 3.
Detailed Description
The present invention will be further described with reference to the accompanying drawings and the detailed description, and it should be noted that any combination of the embodiments or technical features described below can be used to form a new embodiment without conflict.
A fluorescence quantitative PCR primer group for rapidly detecting rumen coccus comprises a forward primer and a reverse primer; wherein, the nucleotide sequence (shown as SEQ ID NO: 1) of the forward primer Rt-F is as follows:
5’-GACGGTAATGCGTCCTTCC-3’；
the nucleotide sequence of the reverse primer Rt-R (shown as SEQ ID NO: 2) is as follows:
5’-TGGCCGCTGGCTACTAAAG-3’。
the Primer is designed according to a 16SrRNA gene sequence of the ruminococcus, and the Primer can only be combined with the ruminococcus and has strong specificity as shown by an NCBI Primer-Blast comparison result.
The fluorescence quantitative PCR primer group for rapidly detecting the ruminococcus can be applied to preparation of a fluorescence quantitative PCR reagent or a kit for detecting the ruminococcus.
A fluorescence quantitative PCR kit for rapidly detecting rumen coccus comprises the primer group; wherein the volume ratio of the forward primer to the reverse primer is 1: 1.
The kit also comprises SYBR Premix Ex Taq, ROX and sterile water.
The application of the fluorescence quantitative PCR kit for rapidly detecting the ruminococcus in clinical or scientific research detection of the ruminococcus comprises the following steps:
s1: extracting the genome DNA of the sample;
s2: putting the genome DNA into a PCR reaction tube, adding a primer group, SYBR Premix Ex Taq, ROX and sterile water into the tube, and carrying out PCR amplification and melting curve determination.
Wherein, the reaction conditions of the PCR amplification are as follows: 5min at 95 ℃; 95 ℃ for 15s, 58 ℃ for 30s, 40 cycles. The conditions for melting curve measurement were: cooling to 55 deg.C for 1min at 95 deg.C, and heating to 95 deg.C; the fluorescence signal was collected throughout the procedure.
And (4) interpretation of results: after the fluorescent quantitative PCR amplification, the samples with the amplification curves above the threshold are all positive samples, and the abundance of the enterococcus faecium in the samples can be calculated according to the Ct value of the amplification curves and the standard curve, so that the result is simple and intuitive to interpret.
The invention utilizes the designed primer group to carry out common PCR amplification on the genome DNA of the standard strain of the bacteria to be detected, optimizes reaction parameters and leads the amplification product to be a single and clear strip; meanwhile, the minimum Ct is obtained under the condition that the melting curve of the sample is ensured to be a standard single peak.
Example 1
Primer specificity analysis
1) Sample processing
Human feces were used as a sample, and a Bacterial genome extraction kit (QIAgene Bacterial genome extraction kit) was used to extract human feces genomic DNA as a template to be amplified.
2) PCR amplification
The reaction system of this example comprises: 2 XPCR Master Mix10.0 μ L, Rt-F0.8 μ L, Rt-R0.8 μ L, template to be amplified 2.0 μ L, sterile water to make up to 20 μ L.
Rt-F：5’-GACGGTAATGCGTCCTTCC-3’；
Rt-R：5’-TGGCCGCTGGCTACTAAAG-3’。
Carrying out PCR amplification according to the reaction system under the following reaction conditions: 5min at 95 ℃; 95 ℃ for 15s, 58 ℃ for 30s, 40 cycles.
3) Product validation
Performing agarose gel electrophoresis on the product obtained by amplification in the step 2), wherein the result is shown in figure 1;
and (3) performing gel recovery and sequencing on the PCR product, wherein the sequence obtained by sequencing is as follows:
TTAACCCAACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCTCCGCTGCCCCGAAGGGAAGGACGCATTACCGTC
as can be seen from FIG. 1, the gel electrophoresis shows that the PCR product is a single band, which is clear, and no other bands are present. The sequencing result of the amplified product is a single peak and has no impurity peak, and the PCR product sequence is the rumen coccus through NCBI blast comparison. The primer of the invention has specificity, and the reaction system has no cross reaction with other bacteria except the bacteria to be detected.
Example 2
Detection of ruminococcus in human fecal samples
1) Sample processing
4 volunteers were randomly selected, and feces thereof were collected as samples for 3 consecutive weeks, and total genomic DNA of each sample was extracted with a Bacterial genome extraction kit (QIAgene Bacterial genome extraction kit).
2) Fluorescent quantitative PCR amplification
This example 20. mu.L of the reaction system included: SYBR Green Reaction Mix10. mu.L, Rox 0.4. mu.L, Rt-F0.8. mu. L, Rt-R0.8. mu.L, genomic DNA template 1. mu.L, sterile water 7.0. mu.L;
taking a universal primer of a bacterial 16SrRNA gene V3-V4 region as an internal reference;
Rt-F：5’-GACGGTAATGCGTCCTTCC-3’；
Rt-R：5’-TGGCCGCTGGCTACTAAAG-3’。
the PCR conditions in this example were: pre-denaturation at 95 ℃ for 5 min; at 95 ℃ for 15s and at 60 ℃ for 30s for 40 cycles;
the melting curve analysis conditions in this example were: cooling to 55 ℃ at 95 ℃ for 1min, then heating to 95 ℃, and collecting fluorescence signals in the whole process.
Performing fluorescent quantitative PCR amplification on a qPCR instrument of Thermofish QuantStudio by using the total genomic DNA of the volunteer stool sample obtained in the step 1) as a template by adopting the reaction system and the PCR reaction condition.
And detecting that all the rumen cocci in all the excrement samples are positive, reading the amplified delta Ct value of each sample, and analyzing the conditions of the rumen cocci in the excrement of the volunteers at different times, wherein the conditions are shown in figure 2. The abundance of the ruminococcus in the volunteers does not change remarkably within 3 weeks, and the primer group and the kit provided by the invention are also proved to have good repeatability when the ruminococcus in clinical samples is detected.
The melting curve of the embodiment is shown in fig. 3, and as can be seen from fig. 3, the melting curves are all single peaks, have no miscellaneous peaks, and have no non-specific amplification, and the primer set of the present invention has good specificity for amplifying ruminococcus, can be applied to detection of practical samples, and has no cross reaction with other bacteria except for bacteria to be detected.
Example 3
Establishment of a Standard Curve
1) Preparation of rumen coccus liquid and gDNA extraction
The method is operated in an anaerobic workstation, a BHI culture medium is used for recovering the rumen coccus standard strain, the inoculation amount is 5 percent, and the rumen coccus standard strain is placed in an anaerobic incubator for culturing for 48 hours. The genomic DNA of the ruminococcus was extracted using a Bacterial genome extraction kit (QIAgene Bacterial genome extraction kit).
2) Drawing of standard curve
Performing 10-fold gradient dilution on the rumen coccus genomic DNA obtained in the step 1), and performing fluorescent quantitative PCR amplification on a qPCR instrument of Thermofish QuantStudio by taking the rumen coccus genomic DNA with different gradient concentrations as a template to be amplified.
The fluorescent quantitative PCR reaction system and reaction conditions in this example are the same as those in example 2, and are not described herein again.
And establishing a standard curve according to the Ct values of the obtained genomic DNA of the ruminococcus with different concentrations and obtaining a regression equation in a corresponding linear range. As can be seen from the PCR detection results, the amount of the DNA initial template of the Ruminococcus standard strain is 102～106When the molecular weight is within the range of copies/mu L, a good linear relation exists between the template amount and the Ct value, the correlation coefficient is more than 0.99, and as shown in figure 4, the quantitative detection result is accurate.
The above embodiments are only preferred embodiments of the present invention, and the scope of the present invention is not limited thereto, and any insubstantial changes and substitutions made by those skilled in the art based on the present invention are within the scope of the present invention claimed in the present invention.
SEQUENCE LISTING
<110> Kangmeihua Dagenetechnology Co., Ltd
<120> fluorescent quantitative PCR primer group and kit for rapidly detecting ruminococcus and application thereof
<130> 20200715
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213> Artificial Synthesis
<400> 1
gacggtaatg cgtccttcc 19
<210> 2
<211> 19
<212> DNA
<213> Artificial Synthesis
<400> 2
tggccgctgg ctactaaag 19
Claims (7)
1. A fluorescence quantitative PCR primer group for rapidly detecting rumen coccus is characterized by comprising a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown as SEQ ID NO: 1, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO: 2, respectively.
2. Use of the primer set according to claim 1 for preparing a fluorescence quantitative PCR reagent or a kit for detecting ruminococcus.
3. A fluorescence quantitative PCR kit for rapid detection of ruminococcus comprising the primer set of claim 1; wherein the volume ratio of the forward primer to the reverse primer is 1: 1.
4. The kit of claim 3, further comprising a SYBR Green Reaction Mix, ROX and sterile water.
5. The use of the kit of claim 4 for clinical or scientific detection of ruminococcus comprising the steps of:
s1: extracting the genome DNA of the sample;
s2: putting the genome DNA into a PCR reaction tube, adding a primer group, SYBR Premix Ex Taq, ROX and sterile water into the tube, and carrying out PCR amplification and melting curve determination.
6. The use according to claim 5, wherein the PCR amplification is performed under the following conditions: 5min at 95 ℃; 95 ℃ for 15s, 58 ℃ for 30s, 40 cycles.
7. Use according to claim 5, wherein the conditions for melting curve determination are: cooling to 55 deg.C for 1min at 95 deg.C, and heating to 95 deg.C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010801702.5A CN112048564A (en) | 2020-08-11 | 2020-08-11 | Fluorescent quantitative PCR primer group and kit for rapidly detecting ruminococcus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010801702.5A CN112048564A (en) | 2020-08-11 | 2020-08-11 | Fluorescent quantitative PCR primer group and kit for rapidly detecting ruminococcus and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112048564A true CN112048564A (en) | 2020-12-08 |
Family
ID=73601733
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010801702.5A Pending CN112048564A (en) | 2020-08-11 | 2020-08-11 | Fluorescent quantitative PCR primer group and kit for rapidly detecting ruminococcus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112048564A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950780A (en) * | 2016-07-22 | 2016-09-21 | 昆明医科大学第附属医院 | Specificity detection primers of Aids related intestinal tract Megamonas funiformis translocation and application |
| CN106574294A (en) * | 2014-03-03 | 2017-04-19 | 何塞普特鲁塔博士赫罗纳生物医学研究所 | Method for diagnosing colorectal cancer from human feces sample by quantitive pcr, primers and kit |
| CN108060245A (en) * | 2018-02-24 | 2018-05-22 | 韩林志 | Primer sets, kit and the method for enteric microorganism genetic test based on high-flux sequence |
| CN111415705A (en) * | 2020-02-26 | 2020-07-14 | 康美华大基因技术有限公司 | Method and medium for making related intestinal flora detection report |
-
2020
- 2020-08-11 CN CN202010801702.5A patent/CN112048564A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106574294A (en) * | 2014-03-03 | 2017-04-19 | 何塞普特鲁塔博士赫罗纳生物医学研究所 | Method for diagnosing colorectal cancer from human feces sample by quantitive pcr, primers and kit |
| CN105950780A (en) * | 2016-07-22 | 2016-09-21 | 昆明医科大学第附属医院 | Specificity detection primers of Aids related intestinal tract Megamonas funiformis translocation and application |
| CN108060245A (en) * | 2018-02-24 | 2018-05-22 | 韩林志 | Primer sets, kit and the method for enteric microorganism genetic test based on high-flux sequence |
| CN111415705A (en) * | 2020-02-26 | 2020-07-14 | 康美华大基因技术有限公司 | Method and medium for making related intestinal flora detection report |
Non-Patent Citations (3)
| Title |
|---|
| KENICHIRO TAKAHASHI ET AL.: "Reduced Abundance of Butyrate-Producing Bacteria Species in the Fecal Microbial Community in Crohn’s Disease", 《DIGESTION》 * |
| 曾燕 等: "采用实时荧光定量PCR 法分析小熊猫胃肠道菌群", 《湖南农业大学学报》 * |
| 胡静平: "《生物医学常用实验方法》", 31 December 2019, 苏州大学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110904250B (en) | Multiplex fluorescent quantitative PCR primer, kit and detection method for detecting multiple bacteria | |
| CN110452974B (en) | Library construction sequencing method for detecting full length of 16S rDNA of bacteria | |
| CN109337995B (en) | PCR detection method and kit for eubacterium terrae and subspecies thereof | |
| CN107236793B (en) | Multiple fluorescent quantitative PCR (polymerase chain reaction) primer, probe, kit and detection method for corynebacterium and corynebacterium klebsiella | |
| CN115747361A (en) | Real-time fluorescent MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method | |
| CN106916903A (en) | The real-time fluorescence RT PCR detection methods and kit of mycobacterium tuberculosis 85B mRNA | |
| Johnson et al. | Characterization of Brachyspira communities from clinical cases of swine mucohaemorrhagic diarrhea through deep sequencing of the NADH oxidase (nox) gene | |
| CN111996267A (en) | Fluorescent quantitative PCR (polymerase chain reaction) primer group and kit for rapidly detecting AKK (alkyl ketene dimer) bacteria and application of fluorescent quantitative PCR primer group and kit | |
| CN112048564A (en) | Fluorescent quantitative PCR primer group and kit for rapidly detecting ruminococcus and application thereof | |
| CN112195258B (en) | Multiplex PCR detection kit for multiple pathogenic bacteria of waterfowl and application thereof | |
| CN105256041B (en) | The nucleotide special to aeromonas hydrophila O44, O24, O25 and O28 and application | |
| CN108950027A (en) | It is a kind of for detecting the kit and method of klebsiella pneumoniae | |
| CN114606328B (en) | Primer group, probe and kit for detecting campylobacter, application and detection method | |
| CN110184370B (en) | Specific primer for detecting Acinetobacter johnsonii, method and application | |
| CN114836581B (en) | Primer combination for detecting pathogens of digestive tract infectious diseases | |
| RU2814556C1 (en) | Test system for detecting dna of causative agent of moraxellosis kpc (moraxella bovis) in biological material of animals and feed using polymerase chain reaction in real time | |
| CN116411095A (en) | Primer probe combination for detecting clostridium gastrum based on fluorescent quantitative PCR, kit and application thereof | |
| CN110501414B (en) | Identification model, construction method and application of VIM type and SPM type metalloenzyme pseudomonas aeruginosa | |
| CN109609668B (en) | Detection primer group and kit for MLVA typing of salmonella typhimurium and application of detection primer group and kit | |
| CN110373486B (en) | PCR primer, PCR method and kit for detecting staphylococcus cohnii | |
| CN105648095A (en) | Detection kit for carrying out quick joint inspection on anthropogenic-gene bacillus anthraci, and preparation and application of detection kit | |
| JP2001169778A (en) | Method and kit for rapidly testing bacterial gene | |
| CN105256028A (en) | Specific nucleotides for citrobacter 017 and 039 and application of special nucleotides | |
| CN105256043B (en) | The nucleotide special to aeromonas hydrophila O29, O30, O33 and O35 and application | |
| CN115852004A (en) | Pathogen specific nucleic acid gene of staphylococcus epidermidis and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20201208 |