CN112029769B

CN112029769B - Construction method of Cyp1a1 gene knockout mouse model and application of model in sepsis

Info

Publication number: CN112029769B
Application number: CN202010953304.5A
Authority: CN
Inventors: 马晓媛; 王芳杰; 唐婉琦; 李卫; 杨雪; 梁华平
Original assignee: Chinese Peoples Liberation Army Army Specialized Medical Center
Current assignee: Chinese Peoples Liberation Army Army Specialized Medical Center
Priority date: 2020-09-11
Filing date: 2020-09-11
Publication date: 2022-03-22
Anticipated expiration: 2040-09-11
Also published as: CN112029769A

Abstract

The invention discloses a construction method of a Cyp1a1 gene knockout mouse model and application thereof in sepsis, wherein the construction method comprises the following steps: determining a target site of a gene to be knocked out of a mouse, and designing sgRNA, wherein the sequence of the sgRNA is shown as SEQ ID No. 2-5; co-injecting or co-electrotransforming the active sgRNA and Cas9 mRNA or Cas9 Protein into mouse fertilized egg cells, transplanting the fertilized eggs into a receptor mother mouse for inoculation, and obtaining an F0 generation gene knockout mouse; f0 generation mice and wild mice are hybridized to obtain F1 generation Cyp1a1 gene knockout mice. The invention successfully prepares the Cyp1a1 gene knockout mouse model, applies the model to the research of sepsis pathological process for the first time, and unexpectedly finds that the bacterial removing capability of the Cyp1a1 gene knockout mouse is obviously enhanced, the survival capability is improved when the mouse deals with endotoxemia and gram-negative bacteria attack, and the anti-infection capability is enhanced. The invention also applies the Cyp1a1 gene knockout mouse to the metabolic regulation research of sepsis for the first time, and provides a reliable animal model for the research of the relevant metabolic mechanism in the critical illness field.

Description

Construction method of Cyp1a1 gene knockout mouse model and application of model in sepsis

Technical Field

The invention relates to the technical field of biological medicines, and particularly relates to a construction method of a Cyp1a1 gene knockout mouse model and application of the Cyp1a1 gene knockout mouse in sepsis.

Background

Sepsis 3.0 human sepsis is defined as life-threatening organ dysfunction due to the body's dysregulation of the response to infection. With the growing understanding of the nature of sepsis onset, it has been recognized that sepsis onset is closely associated with infection, inflammation, coagulation, neuro-endocrine-immune responses, etc., and involves abnormal changes in multiple organs, systems throughout the body.

Disorders of metabolic pathways, hypoxia response of the host and overdriving of the immune system are pathological hallmarks of sepsis at the molecular level. Although the mechanisms of inflammatory responses in the pathogenesis of sepsis are well understood, the mechanisms that lead to metabolic disorders and multiple organ dysfunction or failure are unclear. Changes in metabolic processes observed in trauma and sepsis are strongly correlated with immune disorders that severely affect patient prognosis. Particularly, the exact mechanism of the body metabolic dysfunction caused by severe wound/burn, shock and surgical striking and the status thereof in sepsis are not well known, and a feasible metabolic state evaluation method and a metabolic treatment means are lacking clinically.

Cytochrome P4501A1(CYP1A1) is a hydroxylase, and can catalyze Polycyclic Aromatic Hydrocarbons (PAHS), aromatic amines, benzenes and the like to form polar complexes. Under special circumstances, after the exogenous substance is used as a ligand to be combined with an in-vivo Aromatic Hydrocarbon Receptor (AHR), the CYP1A1 is highly expressed, and the highly active substance is covalently combined with DNA, so that mutation is induced, and the carcinogenic effect is achieved. As an important metabolic enzyme in vivo, CYP1a1 is also involved in various physiological processes of the body, such as immune response, oxidative stress, etc.; is related to various diseases, such as various tumors, acute and chronic inflammation, atherosclerosis and the like. However, what role CYP1A1 plays in sepsis metabolic disorders and what function is not clear, and at present, no research report that CYP1A1 participates in the regulation of the metabolic axis arginine-agmatine-polyamine/gamma aminobutyric acid in the sepsis pathological process is seen at home and abroad.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to solve or at least partially solve the existing technical problems, provides a method for constructing a Cyp1a1 gene knockout mouse model, and obtains unexpected technical effects by applying the successfully constructed Cyp1a1 gene knockout mouse to the research of sepsis metabolic regulation.

Specifically, the method for constructing the Cyp1a1 gene knockout mouse model provided by the invention comprises the following steps: (1) determining a target site of a gene to be knocked out of a mouse, and designing sgRNA aiming at a Cyp1a1 gene, wherein the sgRNA comprises Cyp1a1-Sg1, Cyp1a1-Sg2, Cyp1a1-Sg3 and Cyp1a1-Sg4, and the sequences of the sgRNA are respectively shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5; (2) co-injecting or co-electrotransfering the active sgRNA and Cas9 mRNA or Cas9 Protein into cytoplasm or nucleus of mouse zygote, transplanting the zygote into a receptor mother mouse for inoculation, and obtaining an F0 generation Cyp1a1 gene knockout mouse; (3) a F0 generation Cyp1a1 gene knockout mouse is hybridized with a normal wild type mouse to obtain a F1 generation Cyp1a1 gene knockout mouse model.

The invention successfully prepares a Cyp1a1 gene knockout mouse model, and the 4 sgRNAs designed by the invention have the advantages of high knockout efficiency and no exogenous gene interference, and can ensure that the Cyp1a1 whole knockout mouse model with stable expression genotype can be obtained.

Further, the step (1) further comprises: and carrying out in-vitro amplification on the designed sgRNA to construct a plasmid for expressing the sgRNA, and testing the in-vitro activity of the sgRNA.

Further, the step (2) further comprises: and extracting genome DNA of the F0 generation mouse for genotype identification to obtain a F0 generation mouse with successfully knocked-out Cyp1a1 gene.

Further, the strain of the mouse and the mother mouse in the step (2) is C57 BL/6J.

Further, the step (3) further comprises: and (3) carrying out genotype identification on the F1 generation mice to obtain a F1 generation mice model with successfully knocked-out Cyp1a1 gene.

The invention also provides application of the Cyp1a1 gene knockout mouse model in sepsis, which comprises the following steps: (1) constructing a Cyp1a1 knockout mouse by the method of any one of claims 1 to 5, (2) and then modeling sepsis in the Cyp1a1 knockout mouse.

Further, the sepsis modeling method comprises: when the survival condition of a Cyp1a1 gene knockout mouse for endotoxemia is researched, 15-20 mg/kg lipopolysaccharide is injected into the abdominal cavity of the Cyp1a1 gene knockout mouse; the inventor researches that the intraperitoneal injection concentration of lipopolysaccharide influences the stability of a finally constructed mouse model, and when the injection amount of lipopolysaccharide is too small, the pathological state of sepsis cannot be achieved; when the injection amount of lipopolysaccharide is too much, the death rate of the mouse is high, and the next research cannot be carried out; in the present invention, lipopolysaccharide is most preferable when studying the survival of Cyp1a1 knock-out mice in response to endotoxemiaThe selected injection dose is 20 mg/kg. When the survival condition of the Cyp1a1 gene knockout mouse to gram-negative bacteria is researched, the intraperitoneal injection of 5 multiplied by 10 is adopted for the Cyp1a1 gene knockout mouse⁷～1×10⁸The most preferred injection dose for CFU E.coli, as explored by the inventors, is 1X 10⁸CFU E.coli. When the change of macrophages and monocytes after the Cyp1a1 gene knockout mouse is infected is researched, 3-7 multiplied by 10 intraperitoneal injection is adopted for the Cyp1a1 gene knockout mouse⁷The most preferred injection dose for CFU E.coli, as explored by the inventors, is 5X 10⁷CFU E.coli.

Furthermore, the Cyp1a1 knockout mouse is also applied to the sepsis 'arginine-agmatine-polyamine/gamma aminobutyric acid' metabolic research, and comprises the following steps: a1, constructing Cyp1a1 gene knockout mice by the method of any one of claims 1 to 5; a2, injecting 5-10 mg/kg of lipopolysaccharide into the abdominal cavity of a Cyp1a1 gene knockout mouse, wherein the most preferable injection dosage is 5 mg/kg; a3, detecting the activity of arginase, agmatinase, diamine oxidase and arginine decarboxylase in mice.

Further, before the step (2), 5-15 mg/kg of diamine oxidase inhibitor was administered to Cyp1a1 knock-out mice 15 days in advance, and then the mice were subjected to cecal ligation perforation modeling.

In summary, due to the adoption of the technical scheme, the invention has the beneficial effects that:

the invention successfully prepares the Cyp1a1 gene knockout mouse model, applies the Cyp1a1 gene knockout mouse to the research of sepsis pathological process for the first time, and unexpectedly finds that the bacterial removing capability of the Cyp1a1 gene knockout mouse is obviously enhanced, the survival capability is improved when the endotoxemia and gram-negative bacteria attack are responded, and the anti-infection capability is enhanced. The invention also applies the Cyp1a1 gene knockout mouse to the metabolic regulation research of sepsis for the first time, provides a reliable animal model for the research of relevant metabolic mechanisms in the critical illness field, and initially explores the metabolic change of 'arginine-agmatine-polyamine/gamma aminobutyric acid' in sepsis of the Cyp1a1-KO mouse. Arginine is a non-essential amino acid in physiological states, but becomes essential under certain stress conditions (e.g., sepsis, trauma, and surgery), and is therefore a "conditionally essential" amino acid. Agmatine (AGM) is a bioactive amine, is one of the important metabolites of L-arginine, is produced by the action of Arginine Decarboxylase (ADC), and can be degraded into putrescine and the like by agmatinase; or carrying out catalytic oxidation by diamine oxidase (DAO) to generate guanidine butanal, and finally converting the guanidine butanal into guanidine butyric acid by acetaldehyde dehydrogenase. The invention unexpectedly discovers that the metabolic axis of arginine-agmatine-polyamine can be activated in the sepsis, and further discovers that Cyp1a1 can prevent the sepsis from happening and developing by inhibiting the metabolic axis of arginine-agmatine-polyamine/gamma aminobutyric acid. The invention provides a new idea and an intervention target point for treating sepsis, namely the disorder of the metabolic pathway can be corrected by regulating the expression/activity of Cyp1a1 at the initial stage of sepsis, thereby laying a foundation for establishing a novel intervention measure for sepsis and subsequent clinical application.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

FIG. 1 is the genotype identification result of mouse tail at F1 generation.

FIG. 2 is a graph showing the results of the ability of Cyp1a1-KO mice to eliminate bacteria in vivo.

FIGS. 3A and 3B are graphs showing the survival of Cyp1a1-KO mice in response to endotoxemia and gram-negative bacterial challenge, respectively.

FIG. 4 is a graph showing the results of macrophage and monocyte changes in vivo after Cyp1a1-KO mice were infected.

FIGS. 5A-5D are graphs showing the results of changes in the downstream metabolic pathway of intestinal arginine in Cyp1a1-KO mice.

FIG. 6 is a graph showing the survival results of Cyp1a1-KO mice after DAO inhibitor drying and LPS challenge.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to be limiting. The operations referred to in the following examples are conventional ones unless otherwise specified.

The invention relates to a method for constructing a Cyp1a1 gene knockout mouse by adopting a gene operation strategy, which completely knocks out the Exon2-7 and about 3648bp of a Cyp1a1 gene coding region.

Example 1 construction and characterization of Cyp1a1-KO mouse model

First, experimental animal

The mice used in this example were: c57BL/6J, and the surrogate mother mouse line is C57 BL/6J.

Second, Experimental methods

2.1 knockout mouse construction method

2.1.1 construction of sgRNA plasmid expressing exon2-7 against murine Cyp1a1 Gene

The gene sequence of the Cyp1a1 gene exon2-7 and the designed sgRNA information are as follows:

exon2-7 sequence:

the underlined part of the above gene sequence (SEQ ID No:1) represents an exon region, and the non-underlined part represents an intron region.

The sgRNA sequence is as follows:

Cyp1a1-Sg1：CACCTCTCTTAATTGTG(SEQ ID No:2)

Cyp1a1-Sg2：CTCTAGAAGTGGGCTACTT(SEQ ID No:3)

Cyp1a1-Sg3：TCATTCCTTTACTCTAGACC(SEQ ID No:4)

Cyp1a1-Sg4：GCTGTTTAGCCTCAGC(SEQ ID No:5)

2.1.2 microinjection of fertilized eggs

The active gRNA and Cas9 mRNA or Cas9 Protein are injected or transferred to cytoplasm or nucleus of mouse fertilized egg in a co-injection mode, and the fertilized egg is transplanted into a receptor mother mouse to produce a Cyp1a1 gene knockout mouse model, so that F0 generation mice are obtained.

2.1.3 mouse genotype identification and breeding

Extracting the genome DNA of the offspring (F0 generation) mice obtained in the above steps, carrying out genotype identification (the identification method is the same as that of F1 generation mice), and then hybridizing the mice with the target genes knocked out with Wild Type (WT) mice respectively to obtain F1 generation mice.

2.2 genotype identification of F1 mouse

2.2.1 tissue digestion

2.2.1.1 Rapid genotype identification is carried out by using Bimake rat tail direct PCR kit.

Preparing tissue digestive juice according to the number of mice, wherein the reagent ratio is as follows:

	single sample
		Protease Plus	2μL
Buffer L	100μL

The tissue digestive juice is prepared as it is and is used after being fully mixed.

2.2.1.2 to each EP tube containing a mouse tissue sample, 100. mu.L of fresh tissue digest was added and digested in a 55 ℃ water/metal bath for 15 min. When the tissue is digested, it is necessary to completely immerse the tissue in the digestive juice. After digestion is complete, the tissue remains intact in appearance, but sufficient genomic DNA has been released to not affect subsequent PCR experiments.

2.2.1.3 incubate the samples in a water/metal bath at 95 ℃ for 5min to inactivate proteases in the digest. Centrifuged at 12000rpm for 5 minutes, and the supernatant was used as a PCR template.

2.2.2PCR amplification

2.2.2.1PCR reaction System

The preparation of the reaction system is preferably carried out in a low-temperature environment (such as ice bath) to ensure the PCR amplification efficiency and the amplification specificity.

PCR reaction components	25 μ L reaction System (μ L)
		2×Taq Master Mix，Dye Plus，(Vazyme P112-03)	12.5
ddH₂O	9.5
		Forward primer (10 pmol/. mu.l)	1
Reverse primer (10 pmol/. mu.l)	1
		Template (≈ 100 ng/. mu.l)	1

2.2.2.2 Forward and reverse PCR primers are respectively designed aiming at the upstream and downstream regions of about 200-300 bp of the target.

The primer information is as follows:

2.2.2.3PCR program settings:

2.2.3 identification results

The genotype identification results of F1 mouse are shown in FIG. 1, the numbers are the numbers of mouse tails, WT is a C57BL/6J wild-type mouse, N is a negative blank control mouse, and M is a DNA Marker. As shown in fig. 1,

mice #

26, 28, 31, 32 were positive F1 mice, KO phenotype.

The identification method selected by the invention is specially developed for rapid genotype identification of mice, can quickly release enough genome DNA from tissues such as tail, ears or toes of the mice, has the digestion time of only 15 minutes, does not need extraction and purification, and can directly carry out PCR amplification by taking a digestion product as a template.

Example 2 application of Cyp1a1-KO mouse model

In order to better show the application of the Cyp1a1-KO mouse model of the invention, the experimental methods given below are all better or optimal embodiments for establishing the mouse model.

Analysis of bacterial scavenging ability of Cyp1a1 Gene knockout mice

1.1 Experimental methods

The clearance ability of the Cyp1a1 gene knockout mouse to escherichia coli was analyzed by a peripheral blood bacteria plating counting method.

1.1.1 overnight an adequate amount of E.coli was activated, washed twice with physiological saline and resuspended, and the E.coli concentration was then calculated colorimetrically.

1.1.2 random number table method for selecting 12 male Cyp1a1 with age of 6-8 weeks and approximate body weight^+/+And Cyp1a1^-/-Mice, each mouse injected 5x 10 via tail vein⁷CFU E.coli.

1.1.36 hours later, the mice were sacrificed, peripheral blood was taken, diluted 100 times and spread evenly on LB solid plates and cultured overnight at 37 ℃. Colonies were counted the next day.

1.2 analysis of results

The results of the bacterial clearance of the Cyp1a1 knock-out mice are shown in FIG. 2. As shown in FIG. 2, compare Cyp1a1^+/+(without knocking out the Cyp1a1 gene) mice, the remarkable enhancement of the capability of the Cyp1a1 knock-out mice to eliminate escherichia coli is unexpectedly found. The results show that mice lacking the Cyp1a1 gene rather have enhanced clearance ability against e.

Cyp1a1-KO mouse survival assay

2.1 Experimental methods

To further evaluate the status of Cyp1a1-KO mice in response to endotoxemia and gram-negative bacterial challenge, the response of Cyp1a1-KO mice to death was analyzed using a Kaplan-Meier survival curve. The endotoxemia model was modeled using 20mg/kg Lipopolysaccharide (LPS). Gram-negative bacteria attack model adopts intraperitoneal injection of escherichia coli (1 × 10)⁸CFU) modeling.

2.2 analysis of results

FIGS. 3A and 3B show the interaction of Cyp1a1-KO mice with LPS (20mg/kg) and E.coli (E.coli, 1X 10), respectively⁸CFU) survival outcome against endotoxemia and gram-negative bacterial challenge; the abscissa in FIGS. 3A and 3B represents LPS (20mg/kg) and E.coli (E.coli, 1X 10)⁸CFU) time after the attack, the ordinate represents the percent survival after the attack. As shown in FIG. 3A, compare Cyp1a1^+/+(Cyp1a1 Gene-undestroyed) mouse, Cyp1a1-KO (Cyp1a1)^-/-) The mice showed a clear survival protection effect after challenge with LPS (20 mg/kg). As shown in the figure3B, in comparison with Cyp1a1^+/+(Cyp1a1 Gene-undestroyed) mouse, Cyp1a1-KO (Cyp1a1)^-/-) Mice were treated with E.coli (E.coli, 1X 10)⁸CFU) attack, a significant survival protection effect also appears. The results show that the deletion of the Cyp1a1 gene surprisingly favors mice responding to endotoxemia and gram-negative bacterial challenge.

Macrophage and monocyte changes following Cyp1a1-KO mouse infection

3.1 Experimental methods

3.1.1 overnight an adequate amount of E.coli was activated, washed twice with physiological saline and resuspended, and then the E.coli concentration was calculated colorimetrically.

3.1.2 random number Table method for selecting 12 male Cyp1a1 with age of 6-8 weeks and approximate body weight^+/+And Cyp1a1^-/-(Cyp1a1-KO) mice, each mouse injected intraperitoneally at 5x 10⁷CFU E.coli.

3.1.36 hours later, the mice were sacrificed and spleen, peripheral blood and peritoneal lavage were removed.

3.1.4 spleen was ground with 70 μm cell sieve, lysed erythrocytes were washed and resuspended with PBS; directly carrying out secondary scarlet treatment on peripheral blood, washing by PBS and then resuspending; after direct centrifugation of the peritoneal lavage fluid to remove the supernatant, the cell pellet was resuspended in PBS.

3.1.5 taking a proper amount of single cell suspension, staining with the following antibodies of CD45-APC/CY7, CD11b-BV605, F4/80-PE, LY6C-APC, CD11C-BV650, incubating at room temperature in the dark for 15 minutes, washing twice with PBS, resuspending again, and detecting with Novocyte flow cytometer.

3.2 analysis of results

FIG. 4 shows a graph corresponding to Cyp1a1^+/+(without knockout of Cyp1a1 Gene) mice, Cyp1a1-KO (Cyp1a1)^-/-Knockout of Cyp1a1 gene) results of changes in macrophages and monocytes in vivo after infection of escherichia coli in mice. As shown in FIG. 4, the macrophage content in spleen was decreased and the macrophage content in peripheral blood and peritoneal lavage was increased in Cyp1a1 knockout mice infected with E.coli, probably because the anti-infective ability of Cyp1a1 knockout mice was significantly enhanced.

The proportion of the mononuclear cells has no obvious difference, and the content of the mononuclear cells of the Cyp1a1-KO mouse is reduced only in the peritoneal lavage fluid.

Analysis of Metabolic Change in sepsis in Cyp1a1-KO mice

4.1 Experimental methods

The invention unexpectedly discovers that the Cyp1a1-KO mouse has obvious change in the metabolic axis of sepsis 'arginine-agmatine-polyamine/gamma aminobutyric acid', so that the constructed Cyp1a1-KO mouse is applied to the research on the metabolic change of the sepsis 'arginine-agmatine-polyamine/gamma aminobutyric acid'. In order to evaluate the metabolic change of a Cyp1a1-KO mouse in sepsis, an arginine-agmatine-polyamine/gamma aminobutyric acid metabolic axis is used as a detection index, and the determination is carried out by adopting an activity detection kit of key enzyme of the metabolic axis.

The detection method of the enzyme activity kit comprises the following steps:

4.1.1 sample treatment:

selecting 20 male Cyp1a1 with age of 6-8 weeks and approximate body weight by using random number table method^+/+And Cyp1a1^-/-A mouse. An inflammation model was prepared by intraperitoneal injection of 5mg/kg LPS, mice were anesthetized 4 and 8 hours later, then sacrificed by cervical dislocation, and then soaked in 75% alcohol to sterilize the whole body.

The mouse intestinal tissue was rinsed with pre-cooled PBS, residual blood was removed (lysed erythrocytes in the homogenate affected the measurement), and the tissue was minced after weighing. The minced tissue is mixed with a corresponding volume of PBS (typically in a 1:9 weight to volume ratio, e.g., 1g of tissue sample corresponds to 9mL of PBS, the specific volume can be adjusted as appropriate for the experiment and recorded. preferably, a protease inhibitor is added to PBS, the mixture is added to a glass homogenizer and sufficiently ground on ice. for further lysis of tissue cells, the homogenate can be sonicated or repeatedly frozen and thawed. finally, the homogenate is centrifuged at 5000 Xg for 5-10 minutes, and the supernatant is removed for testing.4.1.2:

the required laths were taken out of the aluminum foil bag after equilibration for 60min at room temperature, and the remaining laths were sealed with a valve bag and placed back at 4 ℃. Setting standard substance holes and sample holes, wherein 50 mu L of standard substances with different concentrations are added into the standard substance holes respectively; adding 50 mu L of sample to be detected into the sample hole; blank wells were not added. In addition to blank wells, 100. mu.L of detection antibody labeled with horseradish peroxidase (HRP) was added to each of the standard wells and the sample wells, the reaction wells were sealed with a sealing plate film, and incubated in a 37 ℃ water bath or incubator for 60 min. Discarding the liquid, drying on absorbent paper, filling each well with washing solution (350 μ L), standing for 1min, removing the washing solution, drying on absorbent paper, and washing the plate for 5 times (or washing the plate with plate washing machine). 50. mu.L of substrate A, B was added to each well and incubated at 37 ℃ for 15min in the absence of light. Add stop solution 50. mu.L per well, measure OD value of each well at 450nm wavelength within 15 min.

4.1.3 results of the experiment calculation:

and (3) taking the OD value of the measured standard substance as an abscissa and the concentration value of the standard substance as an ordinate, drawing a standard curve on coordinate paper or by using related software, obtaining a linear regression equation, substituting the OD value of the sample into the equation, and calculating the concentration of the sample.

4.1.4 to further clarify the relationship of Cyp1a1 and the metabolic axis of "arginine-agmatine-polyamine/γ -aminobutyric acid" in sepsis, modeling of Cecal Ligation and Puncture (CLP) was performed after administering a Cyp1a1-KO mouse diamine oxidase (DAO) inhibitor (Pentamidine, 15mg/kg, qd.) for 15 days in advance, and a sepsis pathology model was replicated.

4.2 analysis of results

FIGS. 5A to 5D show the results of the change of the metabolic pathway downstream of small intestinal Arginine in Cyp1a1 knock-out mice, wherein FIG. 5A is the result of the activity of Arginase (Arginase), and FIG. 5B is the result of the activity of Arginine Decarboxylase (ADC); FIG. 5C shows the activity of Agmatinase (AGMAT); FIG. 5D shows the results of the activity of Diamine oxidase (DAO). As shown in FIGS. 5A-5D, Cyp1a1^+/+Agmatinase (AGMAT), Arginine Decarboxylase (ADC), and Diamine oxidase (DAO) in the small intestine of the mouse showed a tendency of activity decrease after LPS (5mg/kg) challenge; and Cyp1a1^-/-The mice showed a clear increase in activity. Arginase (Arginase) did not differ significantly between the two. The results indicate that Cyp1a1 may be involved in the metabolism of arginine-agmatine-polyamine/gamma-aminobutyric acidAnd (4) activating the shaft.

FIG. 6 shows the survival results of LPS challenge in mice with sepsis modeled by CLP after 15 days of prior intervention of Cyp1a1-KO mice with DAO inhibitor (Pentamidine, 15mg/kg) (FIG. 6 left curve). FIG. 6 also shows the survival results of LPS challenge in Cyp1a1-KO sepsis mice without intervention of DAO inhibitors (FIG. 6 right curve). In fig. 6, the abscissa represents the time after LPS challenge of the mice, and the ordinate represents the percent survival of the mice. As shown in FIG. 6, it was found that Cyp1a1^-/-The mortality rate of the mice given Pentamidine was lower than that of the placebo group (Cyp1a1 without Pentamidine)^-/-Mice) increased, indicating that Cyp1a1 may suppress the development of sepsis by inhibiting the "arginine-agmatine-polyamine/gamma aminobutyric acid" metabolic axis.

While embodiments of the invention have been shown and described, it will be understood by those of ordinary skill in the art that: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.

SEQUENCE LISTING

<110> China people liberation army special medical center

<120> construction method of Cyp1a1 gene knockout mouse model and application of model in sepsis

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 3745

<212> DNA

<213> Artificial Synthesis

<400> 1

cagccaccta gatcatgcct tccatgtatg gacttccagc cttcgtgtca gccacagagc 60

tgctcctggc tgtcaccgta ttctgccttg gattctgggt ggtcagagcc acaagaacct 120

gggttcccaa aggcctgaag actccaccag ggccctgggg cttgcccttc attggtcaca 180

tgctgactgt ggggaagaac ccacatctgt cactgacacg gctgagtcag cagtatgggg 240

acgtgctgca gatccgcatc ggctccactc ctgtggtggt gctgagcggc ctgaacacca 300

tcaagcaggc cctggtgagg cagggagatg acttcaaggg ccggccagac ctctacagct 360

tcacacttat cactaatggc aagagcatga cttttaaccc agactctgga cccgtgtggg 420

ctgcccgccg gcgcctggcc cagaatgccc tgaagagctt ctccatagcc tcggacccga 480

cgtcagcatc ctcttgctac ttggaggagc acgtgagcaa ggaggctaac tatctcgtca 540

gcaaacttca gaaggtgatg gcagaggttg gccactttga cccttacaag tatttggtcg 600

tgtcagtagc caatgtcatc tgtgccatat gctttggcca acgttatgac catgatgacc 660

aagagctgct cagcatagtc aatctgagca atgagtttgg ggaggttact ggctctggat 720

acccagctga cttcattcct gtcctccgtt acctgcctaa ctcttccctg gatgccttca 780

aggacttgaa tgataagttc tacagcttca tgaagaagtt aatcaaagag cactacagga 840

catttgagaa ggtaggggag aagcaggtgg tgatgggaag cagttaggat ccagggccag 900

aacatcacag gcaagcttaa aactggtagc agaatgtact ctatcctcag caggtcaacg 960

aaacttttct tggctggtcc ttctatgcat ccataagaca agagctactg aatggaggag 1020

ccctggacca gttctctctc tctctctctc tcccttcctt cctctctttt tttttctttc 1080

tttctttctt tctttctttc tttctttctt tctttctttc tttctttcct tccttccttc 1140

cttcctttct ttctttcttt ctttccttct ttcttaagct tcatttattt attgcatgta 1200

tgtgggtaca ctgttgctgt cttcagacac accagaagag ggcatcaaat gcctattaca 1260

gatggttgtg agccaccctg tggtggctgg gaattgaact cctttggaaa agcagtcagt 1320

gctcttaagc actgagccat atctgcagac ccctgggcca gttcttcatg gtagaaaaaa 1380

gttaaagaac tcatcaaata actaacagtg tcaggctctg tgcctccagg gtcacttgag 1440

ttgggttatc cattctttaa ggtagaaaga gacttggaga gacaagggga aaatgggaca 1500

gcagcctcac catgacatct ctttaacagt gaggggccag gcctagatgg atggttaggt 1560

ctgggatatt tctcaccttg gtctcctttg tctcccaggg ccacatccgg gacatcacag 1620

acagcctcat tgagcattgt caggacagga agctggacga gaatgccaat gtccagctgt 1680

cagatgataa ggtcatcacg attgttttgg acctctttgg agctggtacg tgtactttgg 1740

tgtatcattt ctgtgctcag gtgcccctag ttgccgcata cctaaccact gcctctgttc 1800

catcctgttc agggtttgac acagtcacaa ctgctatctc gtggagcctc atgtacctgg 1860

taaccaaccc tagggtacag agaaagatcc aggaggaact aggtaggtgg tgactccatt 1920

caaaagactc taagtggagg accctgataa agtcttggca accccttaat ccttctgaac 1980

ctctgaattc tgtagacaca gtgattggca gagatcggca gccccggctt tctgacagac 2040

ctcagctgcc ctatctggag gccttcattc tggagacctt ccggcattca tccttcgtcc 2100

ccttcaccat cccccacagg tcagaccata gatccgttga catttgatac cagatctcag 2160

tttagtgtac acagcccatt aggattcgtg ggaaggatat ggcatggggc ggggtgtgga 2220

tttcccctgt gtgtggtcct gatcctgact acgtgtcctc tttccccagc accacaagag 2280

atacaagtct gaatggcttc tatatcccca aggggtgctg tgtctttgtg aaccagtggc 2340

aggttaacca tgaccggtaa gttgacaggg gcagtgaaaa ctcctgggtg ggatggatgc 2400

atcctctcct gggcttcaga ttccttgggg attgacctgc ttgatgatta taatccctga 2460

actttgactt cagctgtctc cctctgcata tagggaactg tggggtgacc caaacgagtt 2520

ccggcctgaa aggtttctca cccccagcgg cactctggac aagcgcttga gtgagaaggt 2580

cactctcttt ggtttgggca agcgaaagtg catcggagag accattggcc gatcggaggt 2640

ctttctcttc ctggccatct tgctgcagca aatagaattt aaggtgtctc caggggagaa 2700

ggtggatatg actcctacct atgggctgac tttaaaacac gcccgctgtg aacacttcca 2760

agtgcagatg cggtcttctg gtcctcagca tcttcaggct tagactgtcc aggatgctca 2820

ccagaccagg tggctgttcc tgtgattcaa ctttagccag aaacacagat cctgggacat 2880

tgtgcctgcc tcctactttg gacttgtttc tctatatgct gaacacacac tgggcacagc 2940

agaggcccac aggaacctca gatccttctc aatttcagca tcaactagga gatctgaaag 3000

ggttaggaga tacctgggcc tcagagaact cctgaagagt gctctgggtg ctccagtggc 3060

taactggttt gaaaaatact gcaggttata gcaggatgtg tctggttact ttgacaagtg 3120

ggagctgccc agaatggagg gagaagacag cttaaaattc tggcacagag gtgctcttgc 3180

cacctgctga ggctaaacag ccttcccaaa tggtttatga cactgcatgt ggggggcacc 3240

tctgttcacc ctacatagaa acaaacaggg tgctcctgtc cttgcatgtc catgtttctc 3300

ttcaggaagg gttgagactt gtgtctagaa agacccaaga acagagggag agattctctg 3360

ggcagtaaaa ccaggtctag agtaaaggaa tgacttttga gacagagtct tgtgtagccc 3420

aggctgactc tgaacttgct accaaaggag gccttggact cctttttgtt gttgttgttc 3480

ttactacctt accaagtgct aggatacagt catagactac tgcatcagct cttggtctct 3540

cttctttact gtataaaatg tttttcttag aaaatgtttg tgcataagag ctttgtatta 3600

tggactgtat tttgcttatg catttgtatt agttatacct taagagattt agataatttg 3660

ctagtgtaac aaagaagatt ctaactcaag tattcagaaa tatatataga aaaaccctac 3720

ctgaactaaa taaaaatatt acctg 3745

<210> 2

<211> 17

<212> DNA

<213> Artificial Synthesis

<400> 2

cacctctctt aattgtg 17

<210> 3

<211> 19

<212> DNA

<213> Artificial Synthesis

<400> 3

ctctagaagt gggctactt 19

<210> 4

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 4

tcattccttt actctagacc 20

<210> 5

<211> 16

<212> DNA

<213> Artificial Synthesis

<400> 5

gctgtttagc ctcagc 16

<210> 6

<211> 24

<212> DNA

<213> Artificial Synthesis

<400> 6

ctttccctaa gagctgtgag ccct 24

<210> 7

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 7

agggtgtgaa tgtggcttaa cctca 25

<210> 8

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 8

gctggacgag aatgccaatg tc 22

<210> 9

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 9

tgccgatctc tgccaatcac tg 22

Claims

1. A method for constructing a Cyp1a1 gene knockout mouse model is characterized by comprising the following steps:

(1) determining a target site of a gene to be knocked out of a mouse, and designing sgRNA aiming at a Cyp1a1 gene, wherein the sgRNA comprises Cyp1a1-Sg1, Cyp1a1-Sg2, Cyp1a1-Sg3 and Cyp1a1-Sg4, and the sequences of the sgRNA are respectively shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5;

(2) co-injecting or co-electrotransfering the active sgRNA and Cas9 mRNA or Cas9 Protein into cytoplasm or nucleus of mouse zygote, transplanting the zygote into a receptor mother mouse for inoculation, and obtaining an F0 generation Cyp1a1 gene knockout mouse;

(3) a F0 generation Cyp1a1 gene knockout mouse is hybridized with a normal wild type mouse to obtain a F1 generation Cyp1a1 gene knockout mouse model.

2. The method for constructing a mouse model of Cyp1a1 gene knockout according to claim 1, wherein said step (1) further comprises: and carrying out in-vitro amplification on the designed sgRNA to construct a plasmid for expressing the sgRNA, and testing the in-vitro activity of the sgRNA.

3. The method for constructing a mouse model of Cyp1a1 gene knockout according to claim 1, wherein said step (2) further comprises: and extracting genome DNA of the F0 generation mouse for genotype identification to obtain a F0 generation mouse with successfully knocked-out Cyp1a1 gene.

4. The method for constructing a Cyp1a1 gene knockout mouse model according to claim 1, wherein the strain of mouse and mother mouse in step (2) is C57 BL/6J.

5. The method for constructing a mouse model of Cyp1a1 gene knockout according to claim 1, wherein said step (3) further comprises: and (3) carrying out genotype identification on the F1 generation mice to obtain a F1 generation mice model with successfully knocked-out Cyp1a1 gene.

6. The application of a Cyp1a1 gene knockout mouse model to sepsis, comprising the steps of: (1) constructing a Cyp1a1 knockout mouse by the method of any one of claims 1 to 5, (2) and then modeling sepsis in the Cyp1a1 knockout mouse.

7. Use according to claim 6, characterized in that it comprises the following steps: the sepsis modeling method comprises: when the survival condition of a Cyp1a1 gene knockout mouse for endotoxemia is researched, 15-20 mg/kg lipopolysaccharide is injected into the abdominal cavity of the Cyp1a1 gene knockout mouse; when the survival condition of the Cyp1a1 gene knockout mouse to gram-negative bacteria is researched, the intraperitoneal injection of 5 multiplied by 10 is adopted for the Cyp1a1 gene knockout mouse⁷~1×10⁸CFU E.coli; when the change of macrophages and monocytes after the Cyp1a1 gene knockout mouse is infected is researched, 3-7 multiplied by 10 intraperitoneal injection is adopted for the Cyp1a1 gene knockout mouse⁷CFU E.coli.

8. The use according to claim 6, wherein Cyp1a1 knock-out mice are also used in the sepsis "arginine-agmatine-polyamine/γ -aminobutyric acid" metabolic study, comprising the steps of:

a1, constructing Cyp1a1 gene knockout mice by the method of any one of claims 1 to 5;

a2, injecting 5-10 mg/kg lipopolysaccharide into the abdominal cavity of a Cyp1a1 gene knockout mouse;

a3, detecting the activity of arginase, agmatinase, diamine oxidase and arginine decarboxylase in mice.