CN112011467B - Rhizopus oryzae, microbial inoculum, bran koji, preparation methods thereof, application of rhizopus oryzae, microbial inoculum and bran koji, wine and preparation method of wine - Google Patents

Rhizopus oryzae, microbial inoculum, bran koji, preparation methods thereof, application of rhizopus oryzae, microbial inoculum and bran koji, wine and preparation method of wine Download PDF

Info

Publication number
CN112011467B
CN112011467B CN202011087540.XA CN202011087540A CN112011467B CN 112011467 B CN112011467 B CN 112011467B CN 202011087540 A CN202011087540 A CN 202011087540A CN 112011467 B CN112011467 B CN 112011467B
Authority
CN
China
Prior art keywords
rhizopus oryzae
koji
bran
bran koji
wine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011087540.XA
Other languages
Chinese (zh)
Other versions
CN112011467A (en
Inventor
李皓然
丁子元
殷红
郑晓卫
杨鑫
程军
樊林
赵湖
杨娟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiugui Liquor Co ltd
Cofco Nutrition and Health Research Institute Co Ltd
Original Assignee
Jiugui Liquor Co ltd
Cofco Nutrition and Health Research Institute Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiugui Liquor Co ltd, Cofco Nutrition and Health Research Institute Co Ltd filed Critical Jiugui Liquor Co ltd
Priority to CN202011087540.XA priority Critical patent/CN112011467B/en
Publication of CN112011467A publication Critical patent/CN112011467A/en
Application granted granted Critical
Publication of CN112011467B publication Critical patent/CN112011467B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/145—Fungal isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/845—Rhizopus
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23C—DAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; MAKING THEREOF
    • A23C20/00—Cheese substitutes
    • A23C20/02—Cheese substitutes containing neither milk components, nor caseinate, nor lactose, as sources of fats, proteins or carbohydrates
    • A23C20/025—Cheese substitutes containing neither milk components, nor caseinate, nor lactose, as sources of fats, proteins or carbohydrates mainly containing proteins from pulses or oilseeds
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L27/00—Spices; Flavouring agents or condiments; Artificial sweetening agents; Table salts; Dietetic salt substitutes; Preparation or treatment thereof
    • A23L27/20—Synthetic spices, flavouring agents or condiments
    • A23L27/24—Synthetic spices, flavouring agents or condiments prepared by fermentation
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L27/00—Spices; Flavouring agents or condiments; Artificial sweetening agents; Table salts; Dietetic salt substitutes; Preparation or treatment thereof
    • A23L27/50—Soya sauce
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
    • C12G3/00—Preparation of other alcoholic beverages
    • C12G3/02—Preparation of other alcoholic beverages by fermentation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
    • C12G3/00—Preparation of other alcoholic beverages
    • C12G3/02—Preparation of other alcoholic beverages by fermentation
    • C12G3/021—Preparation of other alcoholic beverages by fermentation of botanical family Poaceae, e.g. wheat, millet, sorghum, barley, rye, or corn
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
    • C12G3/00—Preparation of other alcoholic beverages
    • C12G3/02—Preparation of other alcoholic beverages by fermentation
    • C12G3/021—Preparation of other alcoholic beverages by fermentation of botanical family Poaceae, e.g. wheat, millet, sorghum, barley, rye, or corn
    • C12G3/022—Preparation of other alcoholic beverages by fermentation of botanical family Poaceae, e.g. wheat, millet, sorghum, barley, rye, or corn of botanical genus Oryza, e.g. rice
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12J—VINEGAR; PREPARATION OR PURIFICATION THEREOF
    • C12J1/00—Vinegar; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Polymers & Plastics (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Nutrition Science (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Botany (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to the field of microorganisms and brewing processes, in particular to rhizopus oryzae, microbial inoculum, bran koji and preparation methods thereof, application of the rhizopus oryzae, the microbial inoculum and the bran koji, wine and a preparation method thereof. The Rhizopus oryzae (A), (B), (CRhizopus oryzaeAC 01) is CGMCC No. 20247. The rhizopus oryzae provided by the invention has the function of remarkably improving and stabilizing the activity of the saccharifying enzyme of the bran koji, has important significance for developing bran koji products with high saccharifying power, and has the characteristics of high saccharifying power, honey aroma production and the like when the bran koji prepared by the rhizopus oryzae is applied to the production of fermented foods.

Description

Rhizopus oryzae, microbial inoculum, bran koji, preparation methods thereof, application of rhizopus oryzae, microbial inoculum and bran koji, wine and preparation method of wine
Technical Field
The invention relates to the field of microorganisms, and particularly relates to rhizopus oryzae, a microbial inoculum, bran koji and a preparation method thereof, application of rhizopus oryzae, microbial inoculum and bran koji in production of fermented food, wine and a preparation method thereof.
Background
Compared with the traditional starter propagation, the pure rhizopus koji has the remarkable advantages of high saccharification and fermentation capacity, short preparation period, low production cost and the like, and part of the existing wineries using the starter propagation are used for producing white spirit by using the pure rhizopus koji. The seed of the koji is the seed for making the koji as the name implies, namely the process of expanding culture of the test tube strains on the culture material, and the position of the seed is very important in the field of pure-strain koji making. In Japan, Aspergillus oryzae koji is used in the sake brewing industry, and specialized and large-scale production has been realized. In China, some wineries adopt pure rhizopus oryzae koji to replace used starter, so that the saccharification degree is improved, the saccharification time is shortened, and the flavor of the wine body is beneficially improved.
Rhizopus oryzae (A), (B), (CRhizopus oryzae) Is commonly used in food fermentation in east Asia and south-east Asia, contains abundant diastatic amylase, and can cut off alpha-1, 4 bond and alpha-1, 6 bond in glutinous rice starch structure to convert most starch into fermentable sugar such as glucose, maltose and maltotriose. The Rhizopus oryzae produces aromatic flavor substances such as ethyl acetate, ethyl propionate, n-propanol, 3-methylbutanol, acetaldehyde, etc. during fermentation. The rhizopus oryzae cells also contain a small amount of an enzyme system which produces an organic acid such as lactic acid, so that the wine fermented by rhizopus oryzae has a unique flavor. In addition, Rhizopus oryzae can be used for fermenting condiments such as fermented soybean (Tempeh), fermented bean curd, and edible vinegar.
Therefore, the screening of the mould with high glucoamylase activity, particularly the screening of the mould strain with good fermentation performance is one of the main measures for improving the glucoamylase activity of the bran koji for brewing, producing the bran koji suitable for different brewing environments and stabilizing and improving the brewing quality. However, the bran koji used in the liquor brewing industry at present has the problems of complex strain composition, bad fragrance, improvement of saccharification capacity and the like, and the large-scale application and large-scale production of the bran koji products in the liquor brewing industry are hindered.
Disclosure of Invention
The invention aims to overcome the problems of complex strain composition, bad fragrance, pending improvement of saccharification capacity and the like of bran koji used in the liquor brewing industry, and provides rhizopus oryzae, a microbial inoculum, bran koji and a preparation method thereof, application of the rhizopus oryzae, the microbial inoculum and the bran koji in producing fermented foods, and liquor and a preparation method thereof. The rhizopus oryzae provided by the invention has the function of remarkably improving and stabilizing the activity of the saccharifying enzyme of the bran koji, and the bran koji prepared by the rhizopus oryzae has the advantages of high saccharifying capacity and honey fragrance production when being used for brewing white spirit.
In order to achieve the above object, the present invention provides, in a first aspect, a strain of Rhizopus oryzae (A)Rhizopus oryzae BC 70107), the preservation number of the rhizopus oryzae is CGMCC No. 20247.
In a second aspect, the present invention provides a microbial inoculum comprising Rhizopus oryzae (Rhizopus oryzae) as described aboveRhizopus oryzae BC 70107）。
In a third aspect of the present invention, there is provided a method for preparing bran koji, comprising: rhizopus oryzae (A) as described aboveRhizopus oryzae BC 70107) were inoculated into a koji medium for culture.
In a fourth aspect of the present invention, there is provided bran koji prepared by the method as described above.
In a fifth aspect, the present invention provides the use of rhizopus oryzae, inoculant, or bran koji as described above in the production of fermented food products.
In a sixth aspect, the present invention provides a method for brewing wine, the method comprising: the bran koji is inoculated into brewing clinker for brewing wine.
In a seventh aspect, the present invention provides wine brewed by the brewing process as described above.
The rhizopus oryzae of the invention (Rhizopus oryzae BC 70107), has the characteristics of high saccharinity and honey aroma production, and has important significance for developing bran koji products with high saccharinity and aroma production requirements.
Biological preservation
The strain Rhizopus oryzae of the present inventionRhizopus oryzae BC 70107) was deposited at 26 months on year 2020 at the common microorganism center of the china committee for culture collection (address: west road No. 1, north west of the township, beijing, ministry of sciences, china, institute of microbiology, zip code: 100101) (abbreviated as CGMCC for preservation unit), and the preservation number is CGMCC No. 20247.
Drawings
FIG. 1 is a view showing the appearance of Rhizopus oryzae according to the present invention;
FIG. 2 is a microscopic view of Rhizopus oryzae according to the present invention;
FIG. 3 is a radar chart of the sensory evaluation of the fermentation experiment of brewing wine by using different Rhizopus oryzae and bran koji according to example 3 of the invention.
Detailed Description
The endpoints of the ranges and any values disclosed herein are not limited to the precise range or value, and such ranges or values should be understood to encompass values close to those ranges or values. For ranges of values, between the endpoints of each of the ranges and the individual points, and between the individual points may be combined with each other to give one or more new ranges of values, and these ranges of values should be considered as specifically disclosed herein.
In a first aspect, the present invention provides a strain of Rhizopus oryzae (A)Rhizopus oryzae BC 70107), the preservation number of the rhizopus oryzae is CGMCC No. 20247.
According to the present invention, a strain having better performance can be obtained by screening by a method comprising the following steps. Specifically, the screening method comprises the following steps: (1) collecting samples at different fermentation stages in the wine brewing process, and separating, purifying and primarily screening to obtain a strain with a saccharification function; (2) performing secondary screening on the strain with the saccharifying function obtained in the step (1) through a fermentation test, and selecting rhizopus oryzae strains with high saccharifying enzyme activity; (3) and (3) fermenting the rhizopus oryzae strains with high glucoamylase activity obtained in the step (2) by using fermentation raw materials for re-screening, and selecting the rhizopus oryzae strains with good flavor and honey aroma.
According to a preferred embodiment of the present invention, wherein, in step (1), the purification culture may be repeated as many times as practical in order to ensure the separation and purification effect.
Wherein, the separation and purification can be performed in a solid culture medium conventionally used in the art, and preferably, the solid culture medium is a solid culture medium of Bengal.
During the isolation and purification process, single colonies with typical mold colony characteristics were picked.
According to the invention, the Rhizopus oryzae (A), (B), (C), (Rhizopus oryzae BC 70107) was isolated from the material of the brewing process. Collecting brewing materials of different brewing stages in brewing process, pulverizing under aseptic condition, accurately weighing 5g of brewing materials, placing in an aseptic container containing 45mL of physiological saline, shaking at room temperature for 10min, and making into 10-1The sample homogeneous solution is slowly injected into a test tube containing 9mL of sterile physiological saline along the tube wall, and is gradually diluted to 10-2，10-3，10-4，10-5. The method comprises the steps of performing gradient dilution under aseptic operation, coating the obtained product in a Bengal red culture medium, performing static culture in an incubator at 28 ℃ for 2-3 days, randomly selecting a single colony with typical mold colony characteristics, performing streak separation and purification for 2-3 times to obtain a single pure colony, and performing microscopic examination to determine the single colony to be the mold, and storing the single colony on a Potato Dextrose Agar (PDA) slope for later use.
In the present invention, the primary screening may be performed in a manner conventional in the art, and preferably, the isolated mold strain is inoculated on a glucoamylase activity screening medium plate by a dibbling method, and the primary screening of the mold with high glucoamylase activity is performed by a transparent ring method.
Among them, the medium for screening strains having saccharification function, which is conventionally used in the art, for the saccharification enzyme activity screening medium, preferably, comprises: soluble starch 5-20 g/L, yeast extract powder 0.5-3 g/L, NaNO3 0.5-3 g/L，K2HPO4 0.5-3 g/L，NaCl 0.5-2 g/L，MgSO4 0.5-2 g/L，FeSO40.001-0.03 g/L of agar and 10-40 g/L of agar.
Wherein, the primary screening is carried out by comparing the sizes of the transparent rings, and the strains with large transparent rings are strains with high glucoamylase activity.
In a preferred embodiment of the invention, the mould strains are sequentially inoculated on a saccharifying enzyme activity screening culture medium by using a sterile inoculating needle by adopting an inoculation method, the normal culture is carried out for 48 to 84 hours at the temperature of between 25 and 35 ℃, then iodine solution is added into a culture dish, and after 2 to 8 minutes, the diameter of a transparent ring is measured, and the strain with the large transparent ring is the strain with high saccharifying enzyme activity.
According to a preferred embodiment of the present invention, wherein, in the step (2), the fermentation test comprises: preparation of bran koji and saccharification force determination and optionally sensory determination.
Wherein, the preparation method of the bran koji preferably comprises inoculating the rhizopus oryzae into a bran koji culture medium for culture.
The bran koji medium may be one conventional in the art, and preferably, the bran koji medium comprises bran and water.
Preferably, the bran content in the bran koji culture medium is 50 to 70 wt%.
The preparation method of the bran koji medium may be a method conventional in the art, for example, the preparation of the bran koji medium includes: 30-50g of bran is weighed and put into a 500mL triangular flask with a thickness of about 2-4cm, and water is added so that the content of bran in the koji medium is 50-70 wt% (preferably 55-65 wt%). And (5) performing high-temperature and high-pressure sterilization treatment. After sterilization, gently shaking while hot, scattering the cakes, allowing the bottle wall condensed water and bran to fall into the culture medium, and cooling to 30-35 deg.C.
The Rhizopus oryzae can be inoculated by conventional inoculation methods in the field, such as inoculating in the form of spore suspension, or picking a ring of strains from Rhizopus oryzae slant for inoculation.
Preferably, the Rhizopus oryzae is inoculated in the form of a spore suspension in an amount of 107-108Spores/g of bran koji medium.
According to a preferred embodiment of the invention, the conditions of the culture comprise: the temperature range is 25-35 ℃, and the time is 40-90 h. More preferably, the conditions of the culture include: the temperature is 28-32 ℃, and the time is 48-72 h.
For sensory evaluation of the bran koji, in a preferred embodiment of the present invention, the rhizopus oryzae is inoculated into a bran koji medium, mixed uniformly and cultured at 25-35 ℃ for 48-72 hours, and then the culture is continued for 20-24 hours by bottle-buckling (the mycelium is covered with the bran medium, and after the bran is connected into a cake shape, the bottle-buckling is performed to increase the area of air contact). Then drying at 35-40 deg.C for 20-24 hr to make water content of the obtained bran koji below 12%, and stopping thallus growth.
Sensory evaluation results of the bran koji prepared by the rhizopus oryzae BC 70107 comprise: the mouldy bran cake is compact and elastic, has no heartburn and dry skin, no black spore, and no foreign flavor.
According to the present invention, the saccharification ability and sensory evaluation of koji were measured in accordance with QB/T4257-2011.
And selecting the rhizopus oryzae strain with high glucoamylase activity according to the detection result.
According to a preferred embodiment of the present invention, wherein the step of fermenting the fermentation feedstock comprises: preparing bran koji, preparing a fermentation medium and fermenting. Then, the fermentation product is subjected to sensory evaluation, and rhizopus oryzae strains which have good flavor and produce honey aroma are screened out.
The preparation method of the bran koji can be referred to the content mentioned above, and is not described herein again.
According to the invention, the method for preparing the fermentation medium preferably comprises: soaking the starchy raw material, and then cooking to obtain the fermentation medium.
The starchy raw material may be a starchy raw material commonly used in the art, including but not limited to sorghum, rice, glutinous rice, corn, wheat, and the like, and preferably, the starchy raw material is selected from at least one of sorghum, rice, glutinous rice, corn, and wheat.
The soaking time can be selected in a wide range, and the soaking time of different starchy raw materials is different, for example, the soaking time of sorghum is 12-36h, and the soaking time of glutinous rice, corn and the like is 0.2-3 h.
Wherein, the cooking time is different according to different types of starchy raw materials. For example, the sorghum is steamed for 4-5 h, and the glutinous rice, corn and the like are steamed for 1-2 h.
One or more of the starchy raw materials can be selected to prepare the fermentation culture medium, when a plurality of starchy raw materials are selected, the starchy raw materials can be soaked and cooked according to the difference of types, and then the cooked starchy raw materials are uniformly mixed to obtain the fermentation culture medium.
The method of fermentation may be a method conventional in the art, and preferably, the method of fermentation includes: inoculating the prepared bran koji into a fermentation medium for fermentation.
Preferably, the inoculation amount of the bran koji is 3 to 6 weight per mill based on the weight of the fermentation medium.
Preferably, the conditions of the fermentation include: the temperature is 25-40 ℃ and the time is 14-48 h. More preferably, the conditions of the fermentation include: the temperature is 30-37 ℃ and the time is 24-40 h.
In a preferred embodiment of the present invention, the washed glutinous rice is mixed with distilled water at a weight ratio of 1:0.5-3 to ensure uniform distribution of the rice, and cooked for 30-90 min. The weight loss after cooking is made up with cold boiled water. When the temperature of the cooked rice is reduced to 30-35 ℃, uniformly spreading the bran koji sample on the cooked rice and uniformly stirring, wherein the addition amount of the bran koji is 0.3-0.6 wt% of the cooked rice. The rice is poured to one side of the lunch box, is uniformly pressed into an inclined plane, and is subjected to nest building operation to increase the contact surface between the wine rice and the air, thereby being beneficial to saccharification. Covering the cover, placing into a constant temperature incubator at 30-37 deg.C, culturing for 24-40h, and taking out.
According to the invention, the reducing sugar content is determined by a GB 5009.7-2016 method. And selecting rhizopus oryzae strains with high saccharification capacity according to the content of reducing sugar.
The fermentation product can be subjected to sensory evaluation on aspects of fragrance, taste, mouthfeel and the like. The criteria for such sensory evaluation can be found in GB 12313-.
Through the screening, the rhizopus oryzae strain with high saccharification capacity, good fermentation flavor and honey aroma is obtained.
According to the invention, the saccharification ability refers to the evaluation of the saccharification ability of the mouldy bran, and is referred to QB/T4257-2011; the saccharification ability is the saccharification ability of the detection strain on the starchy raw material and is characterized by the content of reducing sugar.
The strains obtained by screening are identified, and the identification method can comprise morphological identification and molecular identification (ITS 1 sequence determination).
Wherein, the form identification mode can comprise: the obtained strain with high glucoamylase activity was subjected to static culture in a Bengal culture medium at 28 ℃ to observe the culture characteristics, and the forms of hyphae, aerial hyphae, and spore filaments of the isolated and purified strain were observed by an optical microscope. The colonies were fluffy, initially white, then grayish brown, dry, large, loose, opaque, intertwined with each other, easily picked up, and spread over the entire plate (FIG. 1 shows the morphology after 72h of incubation). As shown in FIG. 2, the Rhizopus oryzae exhibited creeping, developed rhizoids, and brown branches under a microscope (400 times). The cyst stalks are upright or slightly bent, and the cyst spores are oval or spherical and have different sizes.
The means of molecular identification may include: extracting genome DNA by using a CTAB method, carrying out molecular identification by using a biological engineering (Shanghai) corporation, carrying out homology comparison analysis on a sequencing result through an NCBI database, and determining the rhizopus oryzae according to the result.
Rhizopus oryzae of the present invention (A)Rhizopus oryzae BC 70107) is shown in SEQ ID NO: 1:
CTGCGGAAGGATCATTAATTATGTTAAAGCGCCTTACCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGTACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGTTTTTCTATAGAGTACGCCTGCTTCAGTATCATCACAAACCCACACATAACATTTGTTTATGTGGTGATGGGTCGCATCGCTGTTTTATTACAGTGAGCACCTAAAATGTGTGTGATTTTCTGTCTGGCTTGCTAGGCAGGAATATTACGCTGGTCTCAGGATCTTTTTTTTTGGTTCGCCCAGGAAGTAAAGTACAAGAGTATAATCCAGTAACTTTCAAACTATGATCTGAAGTCAGGTGGGATTACCCGCTGAACTTAAGCATATC。
among them, Bengal culture medium and PDA culture medium are commercially available, and those skilled in the art can prepare solid culture medium according to the conventional preparation method in the art.
The rhizopus oryzae BC 70107 disclosed by the invention has the characteristics of high saccharification capacity and honey aroma production.
The strain Rhizopus oryzae of the present inventionRhizopus oryzae BC 70107) was deposited at 26 months on year 2020 at the common microorganism center of the china committee for culture collection (address: west road No. 1, north west of the township, beijing, ministry of sciences, china, institute of microbiology, zip code: 100101) (abbreviated as CGMCC for preservation unit), and the preservation number is CGMCC No. 20247.
In a second aspect, the present invention provides a microbial inoculum comprising Rhizopus oryzae (Rhizopus oryzae) as described aboveRhizopus oryzae BC 70107）。
The form of the microbial inoculum can be a microbial inoculum form common in the field, such as a solid or liquid microbial inoculum. Preferably, the microbial inoculum is present in the form of at least one of a koji, a bran koji, a wheat koji, a mycelium and a spore suspension.
The preparation methods of the wheat koji, the bran koji and the wheat koji can be prepared by the conventional preparation methods in the field, and are not described in detail. Wherein the wheat koji comprises raw wheat koji and cooked wheat koji.
The preparation method of the mycelium and spore suspension may be a conventional preparation method in the art, and will not be described herein.
In a third aspect of the present invention, there is provided a method for preparing bran koji, comprising: rhizopus oryzae (A) as described aboveRhizopus oryzae BC 70107) were inoculated into a koji medium for culture.
The preparation method of the bran koji can be referred to the content in the first aspect, and is not described herein again.
In a fourth aspect of the present invention, there is provided bran koji prepared by the method as described above.
In a fifth aspect, the present invention provides the use of rhizopus oryzae, inoculant, or bran koji as described above in the production of fermented food products.
The fermented food may be any fermented food that can be fermented with rhizopus oryzae, including but not limited to fermented foods such as wine (including white spirit, yellow wine, rice wine, etc.), vinegar, soy sauce, fermented bean curd, fermented glutinous rice, fermented soybean, etc.
In a preferred embodiment of the invention, the wheat koji prepared by the rhizopus oryzae is used for preparing yellow wine, and the wheat koji is cooked wheat koji.
Preferably, the preparation method of the cooked wheat koji comprises the following steps: the wheat grains are milled by a wheat mill into 3-4 pieces, and then mixed with water in an amount such that the water content of the cooked wheat koji is 10-30 wt%. Inoculating bran koji prepared from Rhizopus oryzae BC 70107 with an inoculum size of 3-15 wt% of wheat, and culturing for 24-48 hr to obtain cooked wheat koji.
The culture can be carried out in a yeast pool which is thoroughly sterilized by adopting a sulfur fumigation method or a formaldehyde method before use.
Preferably, the brewing method of the yellow wine comprises the following steps: soaking Oryza Glutinosa for 8-24h, draining, and steaming until cooked without sticking and without core to obtain cooked rice. Cooling, and dropping into jar at 20-30 deg.C, wherein the addition amount of cooked wheat koji is 10-30 wt% of cooked rice. And then carrying out harrowing, after-fermentation, filter pressing and wine decocting to prepare the yellow wine.
The person skilled in the art can produce fermented food products according to methods conventional in the art and will not be described in detail here.
In a sixth aspect, the present invention provides a method for brewing wine, the method comprising: the bran koji is inoculated into brewing clinker for brewing wine.
The preparation method of the bran koji can be referred to the content mentioned above, and is not described herein again.
According to the invention, the preparation method of the brewing clinker preferably comprises the following steps: and soaking the starchy raw materials, and then cooking to obtain the brewing clinker.
The starchy raw material may be a starchy raw material commonly used in the art, including but not limited to sorghum, rice, glutinous rice, corn, wheat, and the like, and preferably, the starchy raw material is selected from at least one of sorghum, rice, glutinous rice, corn, and wheat.
The content of the components in the starchy material can be selected within a wide range.
According to a preferred embodiment of the present invention, the starchy raw material comprises sorghum, rice, glutinous rice and optionally corn, wherein the starchy raw material comprises 60 to 80 wt% of sorghum, 10 to 25 wt% of rice, 5 to 15 wt% of rice and 0 to 10 wt% of corn.
The time for soaking and cooking can be seen in the first aspect and will not be described further herein.
One or more of the starchy raw materials can be selected to prepare the brewing clinker, when a plurality of starchy raw materials are selected, the starchy raw materials can be soaked and cooked according to the difference of types, and then the cooked starchy raw materials are uniformly mixed to obtain the brewing clinker.
Preferably, the inoculation amount of the bran koji is 3-6 weight per mill based on the weight of the brewing clinker.
The brewing temperature can be different according to the types of the wines, for example, when the brewed wine is white wine, the brewing temperature can be 5-45 ℃, and more preferably 15-25 ℃.
The brewing time can be selected in a wide range, and a person skilled in the art can select the appropriate brewing time according to needs.
In a seventh aspect, the present invention provides wine brewed by the brewing process as described above.
The present invention will be described in detail below by way of examples.
In the following examples, the raw materials and reagents used were all obtained commercially unless otherwise specified.
In the following examples, the medium used for isolation and purification was Bengal red medium, which was prepared by the following method: weighing 36.6 g of synthetic culture medium, heating and dissolving in 1000 mL of distilled water, subpackaging, and autoclaving at 121 ℃ for 20 min.
Saccharifying enzyme activity screening culture medium: 10g/L of soluble starch, 1.5g/L of yeast extract powder and NaNO3 1.5g/L，K2HPO41g/L，NaCl 0.5g/L，MgSO4 0.5g/L，FeSO40.01g/L and agar 20 g/L.
ITS sequencing was performed by the firm Biotech engineering (Shanghai) Inc.
Sensory evaluation and glycation ability measurement were carried out according to QB/T4257-2011.
The sensory evaluation of brewing was carried out with reference to the GB 12313-1990 standard.
Saccharomyces cerevisiae was purchased from Angel Yeast, Inc.
Example 1
This example illustrates the isolation, purification, screening and identification of a strain of Rhizopus oryzae provided by the present invention.
(1) Separation, purification and prescreening
Collecting brewing materials of different brewing raw materials at fermentation stage, pulverizing under aseptic condition, accurately weighing 5g of brewing process sample, placing in an aseptic container containing 45mL of normal saline, shaking at room temperature for 10min, and making into 10-1The sample homogeneous solution is slowly injected into a test tube containing 9mL of sterile physiological saline along the tube wall, and is gradually diluted to 10-2，10-3，10-4，10-5. Performing gradient dilution under sterile operation, spreading on Bengal culture medium, performing static culture in 28 deg.C incubator for 2 days, and randomly selectingAnd (3) streaking, separating and purifying the single colony with the characteristics of the mold colony for 3 times to obtain a single pure colony, and storing a potato glucose agar (PDA) inclined plane for later use after the single colony is determined to be the mold through microscopic examination.
By adopting a point inoculation method, mould strains are sequentially inoculated on a glucoamylase activity screening culture medium (three strains are parallel) by using a sterile inoculating needle, the culture medium is vertically cultured for 72 hours at the temperature of 28 ℃, then 4mL of diluted iodine solution is added into a culture dish, after 5 minutes, the diameter of a transparent ring is measured, and the strain with the large transparent ring is the strain with high glucoamylase activity. The inclined plane is stored for standby.
(2) Two sieves
Preparing a bran culture medium: weighing 45g of bran, putting into a 500mL triangular flask, adding 30g of distilled water, autoclaving at 121 ℃ for 30min, cooling to 30 +/-2 ℃, and scattering for later use.
Selecting one loop from the inclined plane by using an inoculating loop, inoculating the loop into a bran culture medium, and uniformly mixing. Culturing at 30 deg.C for 3 days, placing into sterile kraft paper bag under sterile condition, and oven drying at 40 deg.C for 24 hr in a drying oven with water content controlled at about 10%. The resulting bran koji was subjected to sensory evaluation and screened according to the following criteria: the mouldy bran cake is compact and elastic, has no heartburn and dry skin, no black spore, and no foreign flavor. And (3) carrying out diastatic power determination on the obtained bran koji, and selecting the rhizopus oryzae strain with high diastatic enzyme activity according to the result.
(3) Double sieve
Weighing appropriate amount of Oryza Glutinosa, washing twice, and draining water with a drain basin. Adding washed raw rice and distilled water into sterile aluminum box at weight ratio of 1:1.5 to ensure uniform distribution of rice, and steaming for 60 min. The weight loss after cooking is made up with cold boiled water. 40g of steamed rice is weighed and placed in a sterile aluminum box. When the temperature of the cooked rice is reduced to 30-35 ℃, the bran koji is respectively and evenly sprinkled on the cooked rice, and the adding amount of the bran koji is 0.5 percent of the weight of the cooked rice. Stirring rice to one side of the lunch box, uniformly pressing into an inclined plane, covering the lunch box with a cover, putting the lunch box into a constant-temperature incubator at 30 ℃, and taking out the lunch box after culturing for 24 hours. The mixture of the fermentation products (mixture of fermented glutinous rice and juice) was subjected to sugar test. And selecting the rhizopus oryzae strain with high saccharification capacity according to the detection result. And selecting strains with good flavor according to sensory evaluation.
(4) Identification
And (3) carrying out strain identification on the strain with high glucoamylase activity, wherein the identification method comprises morphological identification and molecular identification (ITS 1 sequence determination).
And (3) morphological identification: and (3) statically culturing the strain with good flavor and high saccharification capacity obtained by screening in the step (3) in a Bengal red culture medium at the temperature of 28 ℃, observing the culture characteristics, and observing the forms of hypha, aerial hypha and spore silk of the separated and purified strain by using an optical microscope. The colonies were fluffy, initially white, then grayish brown, dry, large, loose, opaque, intertwined with each other, easily picked up, and spread over the entire plate (FIG. 1 shows the morphology after 72h of incubation). As shown in FIG. 2, the Rhizopus oryzae exhibited creeping, developed rhizoids, and brown branches under a microscope (400 times). The cyst stalks are upright or slightly bent, and the cyst spores are oval or spherical and have different sizes.
ITS sequencing: extraction of mould DNA genomic DNA was extracted by CTAB method. DNA was sent to Biotechnology engineering (Shanghai) Co., Ltd for molecular identification, ITS1 was sequenced, the results of the sequencing were analyzed by homology comparison using NCBI database, and Rhizopus oryzae was determined based on the results.
The strain Rhizopus oryzae of the present inventionRhizopus oryzae BC 70107) was deposited at 26 months on year 2020 at the common microorganism center of the china committee for culture collection (address: west road No. 1, north west of the township, beijing, ministry of sciences, china, institute of microbiology, zip code: 100101) (abbreviated as CGMCC for preservation unit), and the preservation number is CGMCC No. 20247.
Sensory evaluation results of the bran koji prepared by the rhizopus oryzae BC 70107 comprise: the mouldy bran cake is compact and elastic, has no heartburn and dry skin, no black spore, and no foreign flavor.
The rhizopus oryzae BC 70107 disclosed by the invention has the characteristics of high saccharification capacity and good flavor.
Example 2
This example is intended to illustrate the measurement of the saccharifying ability of Rhizopus oryzae strain provided by the present invention.
The Rhizopus oryzae BC 70107 obtained by the separation screen of example 1 was used for koji culture, and the koji obtained at different culture times was evaluated for saccharification ability and saccharification ability.
(1) Preparing a bran culture medium: weighing 45g of bran, putting into a 500mL triangular flask, adding 30g of distilled water, autoclaving at 121 ℃ for 30min, cooling to 30 +/-2 ℃, and scattering for later use.
(2) Selecting one loop from Rhizopus oryzae slant by using inoculating loop, inoculating to bran culture medium, and mixing. Culturing at 30 deg.C for 3 days, 5 days, and 7 days, respectively, placing into aseptic kraft paper bag under aseptic condition, and oven drying at 40 deg.C for 24 hr in a drying oven with water content controlled at about 10%.
The saccharification force of the koji is detected at different times of culture, and the test results are shown in table 1.
(3) Evaluation of fermentation ability:
weighing appropriate amount of Oryza Glutinosa, washing twice, and draining water with a drain basin. Adding washed raw rice and distilled water into sterile aluminum box at weight ratio of 1:1.5 to ensure uniform distribution of rice, and steaming for 60 min. The weight loss after cooking is made up with cold boiled water. 40g of steamed rice is weighed and placed in a sterile aluminum box. And (3) when the temperature of the rice is reduced to 30-35 ℃, respectively and uniformly spreading the bran koji prepared in the step (2) for different culture times on the rice, and uniformly stirring, wherein the addition amount of the bran koji is 0.5 wt% of the rice. Stirring rice to one side of the lunch box, uniformly pressing into an inclined plane, covering the lunch box with a cover, putting the lunch box into a constant-temperature incubator at 30 ℃, and taking out the lunch box after culturing for 24 hours.
The appearance of the fermented product was observed, and the mixture of the fermented product (mixture of fermented glutinous rice and juice) was subjected to sugar test and sensory evaluation, and the results are shown in Table 2.
TABLE 1
Figure DEST_PATH_IMAGE001
TABLE 2
Figure 389874DEST_PATH_IMAGE002
Example 3
This example illustrates the method of brewing white spirit and the evaluation of the brewery mash using the bran koji prepared from Rhizopus oryzae BC 70107 provided by the present invention.
(1) Selecting starchiness raw materials: the starchy material contains 70 wt% of sorghum, 10 wt% of rice, 15 wt% of glutinous rice and 5 wt% of corn.
(2) Pretreatment of raw materials: soaking sorghum for 24h, and cooking for 5 h; mixing and soaking glutinous rice, rice and corn, and steaming for 2h and boiling for 2 h; and uniformly mixing all the cooked materials to obtain the brewing clinker.
(3) Inoculating bran koji and brewing: the brewing clinker was divided into 4 portions on average, and inoculated with each of the 3-day-cultured koji of rhizopus oryzae BC 70107 obtained in example 2, commercial koji (xiaoxian sweet koji purchased from gaku scientific and technological development ltd., precious state) and two pure koji of rhizopus oryzae (rhizopus oryzae AC31 and rhizopus oryzae AC07 obtained by screening in the same batch as rhizopus oryzae BC 70107) having a high saccharifying power in an amount of 5% by weight of the brewing clinker.
Fermenting at 30 deg.C for 48 h.
The saccharification ability of the bran koji was measured, and the results are shown in table 3.
(4) Sensory evaluation: sensory evaluation was performed on the fermentation process and the fermented glutinous rice material after the end of fermentation, and the results are shown in table 3.
And specifically aiming at the flavor dimensions of grain flavor, honey flavor, ester flavor, yeast flavor and the like, sensory evaluation is carried out according to the strength (see GB/T12313-. FIG. 3 shows radar maps of sensory evaluation of fermentation experiments of brewing wine by using different Rhizopus oryzae bran koji, and it can be seen from FIG. 3 that the Rhizopus oryzae BC 70107 disclosed by the invention is prominent in honey aroma.
TABLE 3
Figure DEST_PATH_IMAGE003
Example 4
The embodiment is used for optimizing the initial moisture content of rhizopus oryzae BC 70107 mouldy bran, and the specific method comprises the following steps:
1) respectively adding distilled water into 500mL triangular flasks filled with 45g of bran to prepare a bran culture medium, wherein the amount of the distilled water is 40 wt%, 45 wt%, 50 wt%, 55 wt%, 60 wt%, 65 wt% and 70 wt%, autoclaving at 121 ℃ for 30min, cooling to 32 +/-2 ℃, and scattering for later use.
2) Inoculating the spore suspension of Rhizopus oryzae BC 70107 into bran culture medium (10) with different initial water contents in an inoculum size of 0.5 wt%7-108spores/mL), mixed well, and cultured at 30 ℃ for 72 h. The flask is buckled, and the culture is continued for 24 h. Drying for 24h at 40 ℃ in a drying oven.
The results of the saccharification ability of the koji prepared by the koji culture medium with different moisture contents are shown in table 4.
TABLE 4
Figure 854484DEST_PATH_IMAGE004
Example 5
This example illustrates the use of Rhizopus oryzae bran koji as described in the present invention in yellow wine brewing
(1) Ripe wheat koji was prepared using rhizopus oryzae BC 70107 moldy bran obtained by culturing for 3 days in example 2.
(2) Preparing cooked wheat koji: the cleaned wheat is crushed by a wheat roller, each grain is rolled into 3-4 pieces, and then 21 wt% of water is added. Inoculating bran koji prepared from Rhizopus oryzae BC 70107 with an inoculation amount of 3-15 ‰ of wheat weight, and mixing. And (4) putting the mixed wheat koji into a koji pool to culture for 36 hours to obtain the cooked wheat koji. The yeast pool should be thoroughly sterilized by sulfur fumigation or formaldehyde before use.
(3) Brewing yellow wine: weighing 1000 g of glutinous rice, soaking for 12h, draining, cooking until the glutinous rice is cooked but not sticky and has no raw core inside, and cooling and then dropping into a jar. The addition amount of cooked wheat koji is 18 wt% of cooked rice, and the temperature of dropping in the jar is controlled at 20-30 deg.C. Then the yellow wine is prepared by the process steps of harrowing, after-fermentation, filter pressing, wine decocting and the like.
The results of the detection of the yellow wine obtained by brewing (see GB/T13662-2018) are shown in Table 5.
Sensory evaluation results: the wine body is light yellow, has the characteristic of yellow wine, is rich and mellow, has no peculiar smell, and is harmonious.
TABLE 5
Figure DEST_PATH_IMAGE005
Example 6
This example is for application of the Rhizopus oryzae BC 70107 bran koji in rice wine brewing
Weighing 500g of glutinous rice, soaking for 12h, draining, cooking until the glutinous rice is cooked and is not sticky, scattering the glutinous rice by using a proper amount of water, putting the glutinous rice into a beaker, inoculating rhizopus oryzae mouldy bran and saccharomyces cerevisiae into the glutinous rice, uniformly stirring by using a sterile glass rod, sealing by using a preservative film, puncturing holes, and culturing for 3 days at 30 ℃. Wherein the inoculation amount of the rhizopus oryzae moldy bran is 5 per mill of the weight of the cooked glutinous rice, and the inoculation amount of the saccharomyces cerevisiae is 10 percent of the weight of the cooked glutinous rice.
The sugar content, alcohol content, acidity and sensory evaluation results of the rice wine obtained by brewing are shown in Table 6.
TABLE 6
Figure 653463DEST_PATH_IMAGE006
The preferred embodiments of the present invention have been described above in detail, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, many simple modifications can be made to the technical solution of the invention, including combinations of various technical features in any other suitable way, and these simple modifications and combinations should also be regarded as the disclosure of the invention, and all fall within the scope of the invention.
Sequence listing
<110> Zhongliang Nutrition and health research institute Co., Ltd
<120> rhizopus oryzae, microbial inoculum, bran koji, preparation methods of rhizopus oryzae and microbial inoculum and bran koji, application of rhizopus oryzae and bran koji, wine and preparation method of wine
<130> YSI64722COF
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 601
<212> DNA
<213> Rhizopus oryzae (Rhizopus oryzae)
<400> 1
ctgcggaagg atcattaatt atgttaaagc gccttacctt agggtttcct ctggggtaag 60
tgattgcttc tacactgtga aaatttggct gagagactca gactggtcat gggtagacct 120
atctggggtt tgatcgatgc cactcctggt ttcaggagta cccttcataa taaacctaga 180
aattcagtat tataaagttt aataaaaaac aacttttaac aatggatctc ttggttctcg 240
catcgatgaa gaacgtagca aagtgcgata actagtgtga attgcatatt cagtgaatca 300
tcgagtcttt gaacgcagct tgcactctat ggtttttcta tagagtacgc ctgcttcagt 360
atcatcacaa acccacacat aacatttgtt tatgtggtga tgggtcgcat cgctgtttta 420
ttacagtgag cacctaaaat gtgtgtgatt ttctgtctgg cttgctaggc aggaatatta 480
cgctggtctc aggatctttt tttttggttc gcccaggaag taaagtacaa gagtataatc 540
cagtaacttt caaactatga tctgaagtca ggtgggatta cccgctgaac ttaagcatat 600
c 601

Claims (13)

1. Rhizopus oryzaeRhizopus oryzae BC 70107, characterized in that the preservation number of the Rhizopus oryzae is CGMCC No. 20247.
2. A microbial preparation comprising the Rhizopus oryzae as claimed in claim 1Rhizopus oryzae BC 70107。
3. The microbial inoculant of claim 2 wherein the inoculant is in the form of at least one of a koji, a bran koji, a wheat koji, a mycelium and a spore suspension.
4. A preparation method of bran koji is characterized by comprising the following steps: rhizopus oryzae as claimed in claim 1Rhizopus oryzae BC 70107 was inoculated into koji medium for culture.
5. The method according to claim 4, wherein the Rhizopus oryzae BC 70107 is inoculated in the form of a spore suspension in an amount of 107-108Spores/g of bran koji medium.
6. The method of claim 4, wherein the bran koji medium comprises bran and water;
wherein the bran content in the bran koji culture medium is 50-70 wt%.
7. The method of any one of claims 4-6, wherein the culturing conditions comprise: the temperature is 28-30 ℃ and the time is 40-90 h.
8. Bran koji produced by the method according to any one of claims 4 to 7.
9. Use of the rhizopus oryzae as claimed in claim 1, the microbial agent as claimed in claim 2 or 3, or the bran koji as claimed in claim 8 for producing fermented foods.
10. Use according to claim 9, wherein the fermented food product is wine, vinegar, soy sauce, fermented bean curd, fermented glutinous rice or fermented soya beans.
11. A method for brewing wine, characterized in that the method comprises: inoculating the bran koji as claimed in claim 8 into brewing clinker for brewing wine.
12. The method of claim 11, wherein said bran koji is inoculated in an amount of 3-6% by weight based on the weight of brewers clinker.
13. Wine brewed by the brewing process according to claim 11 or 12.
CN202011087540.XA 2020-10-13 2020-10-13 Rhizopus oryzae, microbial inoculum, bran koji, preparation methods thereof, application of rhizopus oryzae, microbial inoculum and bran koji, wine and preparation method of wine Active CN112011467B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011087540.XA CN112011467B (en) 2020-10-13 2020-10-13 Rhizopus oryzae, microbial inoculum, bran koji, preparation methods thereof, application of rhizopus oryzae, microbial inoculum and bran koji, wine and preparation method of wine

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011087540.XA CN112011467B (en) 2020-10-13 2020-10-13 Rhizopus oryzae, microbial inoculum, bran koji, preparation methods thereof, application of rhizopus oryzae, microbial inoculum and bran koji, wine and preparation method of wine

Publications (2)

Publication Number Publication Date
CN112011467A CN112011467A (en) 2020-12-01
CN112011467B true CN112011467B (en) 2021-01-29

Family

ID=73527847

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011087540.XA Active CN112011467B (en) 2020-10-13 2020-10-13 Rhizopus oryzae, microbial inoculum, bran koji, preparation methods thereof, application of rhizopus oryzae, microbial inoculum and bran koji, wine and preparation method of wine

Country Status (1)

Country Link
CN (1) CN112011467B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113341020A (en) * 2021-06-21 2021-09-03 贵州茅台酒股份有限公司 Flavor dimension-based white spirit similarity evaluation method
CN115491315B (en) * 2022-11-15 2023-04-25 中粮营养健康研究院有限公司 Rhizopus oryzae for space breeding and application thereof in preparation of bran koji and brewing

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003116502A (en) * 2001-09-27 2003-04-22 Taiwan Tobacco & Liquor Corp Method for producing fermented vegetable lactic acid beverage and sweetener used for non-alcohol beverage
KR20120045558A (en) * 2010-10-29 2012-05-09 대한민국(농촌진흥청장) Method for producing cereal fermented drinks using cereal starters and cereal fermented drinks produced by the same
CN109207306A (en) * 2018-11-28 2019-01-15 广东省九江酒厂有限公司 It improves rice spirit content of ethyl lactate and reduces the brewing method of fusel oil content
CN109971657A (en) * 2019-05-10 2019-07-05 西藏自治区农牧科学院农产品开发与食品科学研究所 A kind of Rhizopus oryzae of high-yield glucoamylase and its application
CN110144298A (en) * 2019-06-06 2019-08-20 劲牌有限公司 A kind of Novel Rhizopus oryzae bacterial strain G1 and its cultural method and application

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003116502A (en) * 2001-09-27 2003-04-22 Taiwan Tobacco & Liquor Corp Method for producing fermented vegetable lactic acid beverage and sweetener used for non-alcohol beverage
KR20120045558A (en) * 2010-10-29 2012-05-09 대한민국(농촌진흥청장) Method for producing cereal fermented drinks using cereal starters and cereal fermented drinks produced by the same
CN109207306A (en) * 2018-11-28 2019-01-15 广东省九江酒厂有限公司 It improves rice spirit content of ethyl lactate and reduces the brewing method of fusel oil content
CN109971657A (en) * 2019-05-10 2019-07-05 西藏自治区农牧科学院农产品开发与食品科学研究所 A kind of Rhizopus oryzae of high-yield glucoamylase and its application
CN110144298A (en) * 2019-06-06 2019-08-20 劲牌有限公司 A kind of Novel Rhizopus oryzae bacterial strain G1 and its cultural method and application

Also Published As

Publication number Publication date
CN112011467A (en) 2020-12-01

Similar Documents

Publication Publication Date Title
CN107475012B (en) Production method for brewing fen-flavor liquor by multi-strain enhanced Daqu fermentation
JP2019526228A (en) Yeast strain for sake brewing producing high yield of β-phenethyl alcohol and use thereof
CN110760471B (en) Acetobacter pasteurianus, microbial agent and application thereof, and vinegar preparation method
CN112011467B (en) Rhizopus oryzae, microbial inoculum, bran koji, preparation methods thereof, application of rhizopus oryzae, microbial inoculum and bran koji, wine and preparation method of wine
CN110951629B (en) Aroma-producing yeast with low alcohol yield as well as screening method and application thereof
JP7159492B2 (en) Binary compound fermentation agent and its use
CN105112226B (en) A kind of preparation method of highland barley original plasm wine
CN109182155B (en) Ester-producing yeast, extraction method and application of ester-producing yeast in red date distilled liquor
CN112852646B (en) Monascus purpureus H5-3 with high lovastatin yield and application thereof
CN105400656B (en) A kind of brewing method of yellow rice wine
CN114606152B (en) Bacillus bailii, microbial agent and application thereof
CN113528361B (en) Saccharomyces cerevisiae suitable for brewing rice wine by liquefaction method and application thereof
CN110734830A (en) method for producing lucid ganoderma style white spirit by solid-liquid combined fermentation
CN113684140B (en) Saccharomyces cerevisiae with low yield of fusel and high yield of ester, composition and application of saccharomyces cerevisiae in fermented food
CN113151005B (en) Monascus purpureus W-4 capable of producing lovastatin at high yield and application thereof
CN111621429B (en) High-yield ester Mao Zhenbi red yeast and application thereof in fermentation of jujube fruit wine
JP6175697B2 (en) Method for obtaining yeast, method for producing food and drink using this yeast
CN115491315B (en) Rhizopus oryzae for space breeding and application thereof in preparation of bran koji and brewing
CN113637546A (en) Production method of rice-flavor liquor
CN113801806A (en) Bacillus solitarius and application thereof in aflatoxin degradation
CN102604840B (en) Rice wine yeast, rhizopus and application thereof
CN114644989A (en) High-sugar saccharomyces cerevisiae and high-sugar leavening agent and application thereof in high-sugar fermented food
CN105524851A (en) Saccharomyces cerevisiae and application thereof
CN111187692A (en) Method for brewing fermented flavor sweet wine by using long-shaped rice
CN114763517B (en) High-temperature resistant saccharomyces cerevisiae and high-temperature fermentation process development of saccharomyces cerevisiae in fermented food

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant