CN111996180A

CN111996180A - Biosynthesis method for obtaining high-purity 6-phosphofructose-2-kinase 4

Info

Publication number: CN111996180A
Application number: CN202010984432.6A
Authority: CN
Inventors: 韩新亚; 郭彦荣; 严菊芬; 张妍; 胡威; 夏琴飞; 汪莹; 孙玉璇; 李龙杰
Original assignee: Anhui University of Technology AHUT
Current assignee: Anhui University of Technology AHUT
Priority date: 2020-09-18
Filing date: 2020-09-18
Publication date: 2020-11-27

Abstract

The invention provides a biosynthesis method for obtaining high-purity 6-phosphofructose-2-kinase 4(PFKFB4), belonging to the field of biotechnology application. The method comprises the following steps: the sequence shown as SEQ ID NO.1 is constructed on a pET28a vector to obtain pET28a-PFKFB4 recombinant plasmid, the recombinant plasmid is introduced into BL21 escherichia coli, IPTG induction expression is carried out at a proper temperature, and high-purity 6-phosphofructose-2-kinase 4 is obtained by His affinity chromatography. The purity of the obtained PFKFB4 can reach more than 90 percent by screening expression vectors and optimizing expression conditions.

Description

Biosynthesis method for obtaining high-purity 6-phosphofructose-2-kinase 4

Technical Field

The invention relates to the field of biotechnology application, in particular to a biosynthesis method for obtaining high-purity 6-phosphofructose-2-kinase 4(PFKFB 4).

Background

The change of cell metabolism is one of the important characteristics of tumor cells different from normal cells, and the dependence of the metabolic abnormality also provides a biochemical basis for specifically killing tumor cells. In recent years, with the progress of basic research on tumor metabolic molecular biology, there is a growing evidence that mutation of tumor-related genes, cellular microenvironment, transcription factors, non-coding RNAs, and metabolic enzymes or activity change of metabolic regulatory proteins can lead to reprogramming of tumor cells, so that the tumor cells have a characteristic metabolic pattern, and glucose metabolism disorder is one of them. Research shows that the metabolism of tumor cells is closely inseparable with the process of tumorigenesis and development. Therefore, the research on the molecular mechanism of the tumor metabolic abnormality is developed, effective molecular targets are searched, and the method has important theoretical significance and value for guiding clinical practice for perfecting the mechanism of tumor occurrence and development, exploring means for early diagnosis and searching novel anti-tumor drugs.

Phosphofructokinase (PFK) is a key regulatory enzyme in the glycolytic pathway. PFK exists in two forms in mammalian cells, namely I-type PFK (PFK-1 for short) for catalyzing fructose-6-phosphate to generate fructose-1, 6-diphosphate and II-type PFK (6-phosphofructose-2-kinase, PFKFB for short) for bifunctional reversible catalysis of fructose-6-phosphate to generate fructose-2, 6-diphosphate. In cancer cell lines and primary tumor tissues, PFK-1 is activated by oncogenes Ras and Src, and its activity is significantly enhanced compared to normal tissues. The enhancement of PFK-1 activity meets the high requirement of tumor cells on increasing glycolysis to a certain extent, which also makes the rate-limiting enzyme PFK-1 a basic node for controlling tumor transformation.

Researchers such as Minchenko indicated that PFKFB4 (6-phosphofructose-2-kinase 4) was over-expressed in lung, breast and colon cancer cells induced by hypoxia at the beginning of the 21 st century. In 2010, a patent in the united states indicated that selective inhibition of PFKFB4 using siRNA could inhibit the growth of human lung cancer xenografts in athymic mice, and for the first time, PFKFB4 family members were reported to be useful in inhibiting tumor metabolism and growth function. In 2012, two separate subject groups, Ros and Goidts, respectively, reported unbiased screening results for genes critical to cancer cell survival, indicating that PFKFB4 is essential for glioma cell and prostate cancer cell survival, but not for normal cells. These studies suggest that PFKFB4 may also be a potential molecular target for antineoplastic agent development. Ros project group also found that FBPase-2 of PFKFB4 is indispensable for limiting glycolytic activity and transferring NADPH-producing metabolites, and also plays an important role in tumorigenesis development. Compared with PFKFB3, the PFKFB4 has more balanced activity ratio of PFK-2 to FBPase-2, and PFKFB4 is taken as a target to research PFKFB inhibitors and regulation mechanisms thereof, so that the physiological function of FBPase-2 can be considered while paying attention to FDP production by PFK-2, and the PFKFB4 is more representative.

Therefore, how to obtain high-purity and high-efficiency 6-phosphofructose-2-kinase 4(PFKFB4) is an important prerequisite and a first problem for researching PFKFB inhibitors by taking PFKFB4 as a target.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a biosynthesis method for obtaining high-purity 6-phosphofructose-2-kinase 4(PFKFB 4).

In order to achieve the purpose, the invention is realized by the following technical scheme:

a biosynthetic method for obtaining highly pure fructose-6-phosphate-2-kinase 4(PFKFB4), comprising the steps of:

(1) constructing a PFKFB4 sequence shown in SEQ ID NO.1 on an expression vector pET28a to obtain a recombinant plasmid pET28a-PFKFB4 containing PFKFB 4;

(2) pET28a-PFKFB4 was introduced into E.coli BL21 to obtain an expression strain of PFKFB 4;

(3) under a proper temperature, IPTG induces the expression strain to express, collect and crush, and affinity chromatography purification by using His label is used for obtaining high-purity PFKFB4, namely 6-phosphofructose-2-kinase 4 (6-phosphofructose-2-kinase/fructose-2, 6-diphosphatase 4).

Preferably, the recombinant vector pET28a-PFKFB4 described in step (1) is prepared by the following steps: synthesizing and cloning the sequence of PFKFB4 shown in SEQ ID NO.1 into a vector pU19 to obtain pU19-PFKFB 4; amplifying PFKFB4 by using an upstream primer and a downstream primer of PFKFB4 by using pU19-PFKFB4 as a template; PFKFB4 and 6 His tags were constructed to the vector pET28a by restriction sites EcoR I, Hind III on the upstream and downstream primers to give pET28a-PFKFB4 recombinant plasmid.

Preferably, the PFKFB4 upstream primer is 5'-CGCGAATTCATGGCGTCCCCACGGGAA-3'; the downstream primer is 5'-CGCAAGCTTTCATCAGTGATGGTGATGGTGATGCTGGTGAGAGGCACC-3'.

Preferably, the induction conditions in step (3) are: concentration OD of pre-induction bacterial liquid₆₀₀0.8, IPTG concentration 0.3mM, induction temperature 16 ℃ and induction time 24 hours.

Preferably, the purification step in step (3) is: regenerating a His affinity chromatographic column; and (3) the thalli after the induction expression is collected, the thalli is resuspended by using a lysis buffer solution, is subjected to ultrasonic disruption and centrifugation, the supernatant is taken and loaded on a regenerated His affinity chromatography column, a 50mM imidazole eluent is used for washing the hybrid protein, and a 250mM imidazole eluent is used for washing the target protein.

Preferably, the His affinity chromatography column is regenerated in the order of washing: EDTA eluent 2CV, ddH₂Soaking in O2 CV and 0.5M NaOH 2CV for 30min, and removing ddH₂O 5CV，0.1M NiSO₄ 2CV，ddH₂O 2CV。

Compared with the prior art, the invention has the following advantages and effects: through optimizing an expression vector and expression and purification conditions, the purity of the 6-phosphofructose-2-kinase 4(PFKFB4) obtained through affinity chromatography reaches more than 90 percent, while the 6-phosphofructose-2-kinase reported in the prior literature is mostly PFKFB1-3, and the purity needs to be improved.

Drawings

FIG. 1 is a SDS-PAGE image of purified PFKFB 4.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1: construction of expression vector pET28a-PFKFB4 of 6-phosphofructose-2-kinase 4(PFKFB4)

The sequence of PFKFB4 shown in SEQ ID NO.1 was synthetically cloned into vector pU19 to obtain pU19-PFKFB 4.

(1) Extraction of plasmids

2 conical flasks containing 20mL of LB medium were inoculated with colonies containing pU19-PFKFB4 and pET28a plasmids, respectively, and cultured overnight at 37 ℃ and 220rpm, the plasmids were extracted by SDS lysis, and the extracts were stored in a refrigerator at 4 ℃ until use.

(2) Double digestion for PCR amplification of PFKFB4, PFKFB4 and pET28a

PCR amplification reaction System: plasmid (pU19-PFKFB4) 1. mu.L, 10 Xbaffer 5. mu. L, dNTPs 4. mu. L, PFKFB4 upstream primer 1. mu. L, PFKFB4 downstream primer 1. mu. L, TaqDNA polymerase 1. mu.L, plus ddH₂O to 50. mu.L. PFKFB4 was amplified using upstream and downstream primers of PFKFB4 using pU19-PFKFB4 as template.

The upstream primer of PFKFB4 is:

5’-CGCGAATTCATGGCGTCCCCACGGGAA-3’；

the downstream primer of PFKFB4 is:

5’-CGCAAGCTTTCATCAGTGATGGTGATGGTGATGCTGGTGAGAGGCACC-3’。

the PCR amplification conditions were: pre-denaturation at 94 ℃ for 5 min; 1min at 94 ℃; 1min at 56 ℃; 1min at 72 ℃ and 30 cycles; extension at 72 ℃ for 5 min.

After the agarose gel electrophoresis PCR product PFKFB4 is correct, recovering the gel, and carrying out double enzyme digestion on EcoR I and Hind III; pET28a was also double digested with EcoR I and Hind III. The enzyme digestion products are recovered by glue and then used for connection.

(3) Ligation and transformation

Digested pET28a 2 mu L, 10XT4 DNA ligase buffer 1 mu L, T4 DNA ligase 1 mu L, ddH₂mu.L of O5 and 41 mu L of enzyme-digested PFKFB are mixed evenly and put in a water bath at 16 ℃ for 16 hours.

Wherein PFKFB4 and 6 His tags are constructed on a vector pET28a through restriction sites EcoR I and Hind III on upstream and downstream primers to obtain pET28a-PFKFB4 recombinant plasmid.

The connected pET28a-PFKFB4 recombinant plasmid is introduced into an escherichia coli BL21 expression strain by a heat shock method to obtain an expression strain BL21-pET28a-PFKFB4 containing pET28a-PFKFB4 recombinant plasmid.

Example 2: expression and purification of 6-phosphofructose-2-kinase 4(PFKFB4)

(1) Expression of fructose-6-phosphate-2-kinase 4(PFKFB4)

BL21-pET28a-PFKFB4 recombinant single colonies were picked and inoculated into 20mL LB liquid medium (containing 50. mu.g/mL kanamycin) and cultured overnight at 37 ℃ and 220rpm for 12-16 hours. Then inoculating the bacteria liquid cultured overnight in the previous step into 500mL BL liquid culture medium according to the amount of 1%, performing amplification culture at 37 ℃ and 220rpm until OD is reached₆₀₀When the value is 0.8, IPTG is added to make the final concentration be 0.3mM, the temperature is changed to 16 ℃ to induce and express PFKFB for 424 hours, the cells are collected by high-speed centrifugation at 8000rpm for 10min at 4 ℃, and then the cells are washed with secondary water and 5 Xlysis buffer for 1 time respectively, and then the supernatant is discarded. The collected thalli are put into a refrigerator with the temperature of 20 ℃ below zero to be frozen for standby.

(2) Purification of 6-phosphofructose-2-kinase 4(PFKFB4)

Regeneration of His affinity chromatography column, washing order is EDTA eluent 2CV, ddH₂Soaking in O2 CV and 0.5M NaOH 2CV for 30min, and removing ddH₂O 5CV，0.1M NiSO₄ 2CV，ddH₂O 2CV。

The frozen somatic cells in the refrigerator were thawed on ice and resuspended in 30mL of cold-treated 5 × lysis buffer. The cell ultrasonic crusher is broken, and the working conditions are as follows: the voltage was 220W, (3, 5, 90). The crushed bacterial liquid is centrifuged for 30min at 10000rpm and 4 ℃, supernatant and sediment are separated, and the supernatant is filtered twice by a 0.22 mu M filter membrane. The mixture was loaded on a regenerated His affinity column, and the impurity protein was washed with 50mM imidazole eluent and the target protein was washed with 250mM imidazole eluent.

5 × lysis buffer: 50mM Tris-HCl, 100mM NaCl, 5mM Imidazole, pH 7.4.

50mM imidazole eluent: 50mM Tris-HCl, 100mM NaCl, 50mM Imidazole, pH 7.4.

250mM imidazole eluent: 50mM Tris-HCl, 100mM NaCl, 250mM Imidazole, pH 7.4.

In the above examples, the SDS-PAGE pattern of the purified PFKFB4 is shown in FIG. 1.

The gene sequence of PFKFB4 (6-phosphofructose-2-kinase 4) SEQ ID NO.1 is as follows: ATGGCGTCCCCACGGGAATTGACACAGAACCCCCTGAAGAAGATCTGGATGCCATACAGCAATGGGCGGCCCGCTCTGCACGCTTGCCAGCGCGGTGTGTGCATGACCAACTGCCCAACTCTCATTGTCATGGTGGGCCTGCCCGCCAGGGGCAAGACCTACATCTCCAAGAAGCTGACTCGATACCTGAACTGGATTGGTGTGCCCACTCGGGAGTTCAATGTTGGCCAGTATCGCCGGGACGTGGTCAAGACCTACAAATCTTTTGAATTTTTTCTCCCCGACAATGAAGAGGGCCTGAAAATCAGGAAGCAGTGTGCCCTGGCAGCCCTCCGTGACGTCCGGCGGTTCCTTAGTGAGGAGGGGGGACATGTGGCGGTTTTTGATGCCACAAACACCACCCGAGAACGGAGAGCGACCATCTTTAATTTTGGAGAACAGAATGGCTACAAGACCTTTTTTGTCGAGTCCATCTGTGTGGATCCTGAGGTCATAGCTGCCAACATCGTGCAAGTGAAACTGGGCAGCCCTGACTATGTCAACCGCGACAGTGATGAGGCTACGGAGGACTTCATGAGGCGCATTGAGTGCTATGAGAACTCCTACGAGTCGCTAGATGAGGACCTGGATAGGGACCTGTCCTATATCAAGATCATGGATGTGGGCCAGAGCTACGTGGTGAACCGTGTGGCTGACCACATCCAGAGCCGCATCGTATATTACCTCATGAACATCCACGTGACCCCCCGCTCCATCTACCTCTGCCGGCACGGGGAGAGCGAGCTCAACCTCAAGGGCCGGATTGGCGGGGACCCAGGACTGTCCCCTCGGGGCAGGGAGTTTGCCAAGAGTCTAGCCCAGTTCATCAGTGACCAAAATATCAAGGATCTGAAGGTCTGGACAAGCCAGATGAAGAGGACAATCCAGACGGCTGAGGCACTGGGTGTGCCCTATGAACAGTGGAAGGTCCTCAACGAGATCGATGCGGGCGTCTGTGAGGAAATGACCTACGAGGAAATTCAGGATAATTATCCACTGGAGTTCGCCCTGCGGGACCAGGACAAGTACCGGTACCGGTACCCTAAAGGGGAGTCCTACGAGGACCTGGTCCAGAGACTGGAGCCTGTCATCATGGAGCTGGAGAGGCAAGAGAATGTGCTGGTCATCTGCCACCAGGCTGTGATGCGCTGCCTGCTGGCCTACTTCCTCGACAAGGCAGCAGAACAGCTGCCCTACCTCAAGTG TCCGCTGCACACAGTCCTGAAGCTGACTCCTGTGGCATATGGTTGTAAAGTGGAGTCCATATTCCTGAACGTGGCTGCTGTGAACACGCACCGGGACAGGCCTCAGAACGTGGACATCTCAAGACCTCCAGAGGAAGCCCTTGTCACGGTGCCTGCTCACCAGTGATGA

The amino sequence of recombinant PFKFB4 SEQ ID No.2 is as follows:

MASPRELTQNPLKKIWMPYSNGRPALHACQRGVCMTNCPTLIVMVGLPARGKTYISKKLTRYLNWIGVPTREFNVGQYRRDVVKTYKSFEFFLPDNEEGLKIRKQCALAALRDVRRFLSEEGGHVAVFDATNTTRERRATIFNFGEQNGYKTFFVESICVDPEVIAANIVQVKLGSPDYVNRDSDEATEDFMRRIECYENSYESLDEDLDRDLSYIKIMDVGQSYVVNRVADHIQSRIVYYLMNIHVTPRSIYLCRHGESELNLKGRIGGDPGLSPRGREFAKSLAQFISDQNIKDLKVWTSQMKRTIQTAEALGVPYEQWKVLNEIDAGVCEEMTYEEIQDNYPLEFALRDQDKYRYRYPKGESYEDLVQRLEPVIMELERQENVLVICHQAVMRCLLAYFLDKAAEQLPYLKCPLHTVLKLTPVAYGCKVESIFLNVAAVNTHRDRPQNVDISRPPEEALVTVPAHQ

the above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.

Sequence listing

<110> industrial university of Anhui

<120> a biosynthesis method for obtaining high-purity 6-phosphofructose-2-kinase 4

<160> 2

<210> 1

<211> 1413

<212> DNA

<213> Artificial sequence

<400> 1

atggcgtccc cacgggaatt gacacagaac cccctgaaga agatctggat gccatacagc 60

aatgggcggc ccgctctgca cgcttgccag cgcggtgtgt gcatgaccaa ctgcccaact 120

ctcattgtca tggtgggcct gcccgccagg ggcaagacct acatctccaa gaagctgact 180

cgatacctga actggattgg tgtgcccact cgggagttca atgttggcca gtatcgccgg 240

gacgtggtca agacctacaa atcttttgaa ttttttctcc ccgacaatga agagggcctg 300

aaaatcagga agcagtgtgc cctggcagcc ctccgtgacg tccggcggtt ccttagtgag 360

gaggggggac atgtggcggt ttttgatgcc acaaacacca cccgagaacg gagagcgacc 420

atctttaatt ttggagaaca gaatggctac aagacctttt ttgtcgagtc catctgtgtg 480

gatcctgagg tcatagctgc caacatcgtg caagtgaaac tgggcagccc tgactatgtc 540

aaccgcgaca gtgatgaggc tacggaggac ttcatgaggc gcattgagtg ctatgagaac 600

tcctacgagt cgctagatga ggacctggat agggacctgt cctatatcaa gatcatggat 660

gtgggccaga gctacgtggt gaaccgtgtg gctgaccaca tccagagccg catcgtatat 720

tacctcatga acatccacgt gaccccccgc tccatctacc tctgccggca cggggagagc 780

gagctcaacc tcaagggccg gattggcggg gacccaggac tgtcccctcg gggcagggag 840

tttgccaaga gtctagccca gttcatcagt gaccaaaata tcaaggatct gaaggtctgg 900

acaagccaga tgaagaggac aatccagacg gctgaggcac tgggtgtgcc ctatgaacag 960

tggaaggtcc tcaacgagat cgatgcgggc gtctgtgagg aaatgaccta cgaggaaatt 1020

caggataatt atccactgga gttcgccctg cgggaccagg acaagtaccg gtaccggtac 1080

cctaaagggg agtcctacga ggacctggtc cagagactgg agcctgtcat catggagctg 1140

gagaggcaag agaatgtgct ggtcatctgc caccaggctg tgatgcgctg cctgctggcc 1200

tacttcctcg acaaggcagc agaacagctg ccctacctca agtgtccgct gcacacagtc 1260

ctgaagctga ctcctgtggc atatggttgt aaagtggagt ccatattcct gaacgtggct 1320

gctgtgaaca cgcaccggga caggcctcag aacgtggaca tctcaagacc tccagaggaa 1380

gcccttgtca cggtgcctgc tcaccagtga tga 1413

<210>2

<211>469

<212> PRT

<213> Artificial sequence

<400> 2

Met Ala Ser Pro Arg Glu Leu Thr Gln Asn Pro Leu Lys Lys Ile Trp Met Pro

1 5 10 15

Tyr Ser Asn Gly Arg Pro Ala Leu His Ala Cys Gln Arg Gly Val Cys Met

20 25 30 35

Thr Asn Cys Pro Thr Leu Ile Val Met Val Gly Leu Pro Ala Arg Gly Lys Thr

40 45 50

Tyr Ile Ser Lys Lys Leu Thr Arg Tyr Leu Asn Trp Ile Gly Val Pro Thr Arg

55 60 65 70

Glu Phe Asn Val Gly Gln Tyr Arg Arg Asp Val Val Lys Thr Tyr Lys Ser Phe

75 80 85

Glu Phe Phe Leu Pro Asp Asn Glu Glu Gly Leu Lys Ile Arg Lys Gln Cys

90 95 100 105

Ala Leu Ala Ala Leu Arg Asp Val Arg Arg Phe Leu Ser Glu Glu Gly Gly

110 115 120

His Val Ala Val Phe Asp Ala Thr Asn Thr Thr Arg Glu Arg Arg Ala Thr

125 130 135 140

Ile Phe Asn Phe Gly Glu Gln Asn Gly Tyr Lys Thr Phe Phe Val Glu Ser Ile

145 150 155

Cys Val Asp Pro Glu Val Ile Ala Ala Asn Ile Val Gln Val Lys Leu Gly Ser

160 165 170 175

Pro Asp Tyr Val Asn Arg Asp Ser Asp Glu Ala Thr Glu Asp Phe Met Arg

180 185 190

Arg Ile Glu Cys Tyr Glu Asn Ser Tyr Glu Ser Leu Asp Glu Asp Leu Asp

195 200 205 210

Arg Asp Leu Ser Tyr Ile Lys Ile Met Asp Val Gly Gln Ser Tyr Val Val Asn

215 220 225

Arg Val Ala Asp His Ile Gln Ser Arg Ile Val Tyr Tyr Leu Met Asn Ile His

230 235 240 245

Val Thr Pro Arg Ser Ile Tyr Leu Cys Arg His Gly Glu Ser Glu Leu Asn Leu

250 255 260

Lys Gly Arg Ile Gly Gly Asp Pro Gly Leu Ser Pro Arg Gly Arg Glu Phe

265 270 275 280

Ala Lys Ser Leu Ala Gln Phe Ile Ser Asp Gln Asn Ile Lys Asp Leu Lys Val

285 290 295

Trp Thr Ser Gln Met Lys Arg Thr Ile Gln Thr Ala Glu Ala Leu Gly Val Pro

300 305 310 315

Tyr Glu Gln Trp Lys Val Leu Asn Glu Ile Asp Ala Gly Val Cys Glu Glu Met

320 325 330 335

Thr Tyr Glu Glu Ile Gln Asp Asn Tyr Pro Leu Glu Phe Ala Leu Arg Asp

340 345 350

Gln Asp Lys Tyr Arg Tyr Arg Tyr Pro Lys Gly Glu Ser Tyr Glu Asp Leu

355 360 365

Val Gln Arg Leu Glu Pro Val Ile Met Glu Leu Glu Arg Gln Glu Asn Val

370 375 380 385

Leu Val Ile Cys His Gln Ala Val Met Arg Cys Leu Leu Ala Tyr Phe Leu

390 395 400

Asp Lys Ala Ala Glu Gln Leu Pro Tyr Leu Lys Cys Pro Leu His Thr Val

405 410 415 420

Leu Lys Leu Thr Pro Val Ala Tyr Gly Cys Lys Val Glu Ser Ile Phe Leu Asn

425 430 435

Val Ala Ala Val Asn Thr His Arg Asp Arg Pro Gln Asn Val Asp Ile Ser

440 445 450 455

Arg Pro Pro Glu Glu Ala Leu Val Thr Val Pro Ala His Gln

460 465 469

Claims

1. A biosynthesis method for obtaining high-purity 6-phosphofructose-2-kinase 4, which is characterized by comprising the following steps:

(3) under a proper temperature, IPTG induces expression strain expression, collects bacteria, breaks, and uses affinity chromatography of His label to purify to obtain high-purity 6-phosphofructose-2-kinase 4PFKFB 4.

2. The method for biosynthesis of 6-phosphofructose-2-kinase 4 having high purity according to claim 1, wherein the recombinant vector pET28a-PFKFB4 in step (1) is prepared by the following steps: synthesizing and cloning the sequence of PFKFB4 shown in SEQ ID NO.1 into a vector pU19 to obtain pU19-PFKFB 4; amplifying PFKFB4 by using an upstream primer and a downstream primer of PFKFB4 by using pU19-PFKFB4 as a template; PFKFB4 and 6 His tags were constructed to the vector pET28a by restriction sites EcoR I, Hind III on the upstream and downstream primers to give pET28a-PFKFB4 recombinant plasmid.

3. The method for biosynthesis of high purity fructose-6-phosphate-2-kinase 4 according to claim 1, wherein the primer upstream of PFKFB4 is 5'-CGCGAATTCATGGCGTCCCCACGGGAA-3'; the downstream primer is 5'-CGCAAGCTTTCATCAGTGATGGTGATGGTGATGCTGGTGAGAGGCACC-3'.

4. The method for biosynthesis of high purity fructose-6-phosphate-2-kinase 4 according to claim 1, wherein the induction conditions in step (3) are: concentration OD of pre-induction bacterial liquid₆₀₀0.8, IPTG concentration 0.3mM, induction temperature 16 ℃ and induction time 24 hours.

5. The method for biosynthesis of high purity fructose-6-phosphate-2-kinase 4 according to claim 1, wherein the purification step in the step (3) is: regenerating a His affinity chromatographic column; and (3) the thalli after the induction expression is collected, the thalli is resuspended by using a lysis buffer solution, is subjected to ultrasonic disruption and centrifugation, the supernatant is taken and loaded on a regenerated His affinity chromatography column, a 50mM imidazole eluent is used for washing the hybrid protein, and a 250mM imidazole eluent is used for washing the target protein.

6. The method for biosynthesis of high purity fructose-6-phosphate-2-kinase 4 according to claim 5, wherein the His affinity column is regenerated in the order of washing: EDTA eluent 2CV, ddH₂Soaking in O2 CV and 0.5M NaOH 2CV for 30min, and removing ddH₂O 5CV，0.1M NiSO₄ 2CV，ddH₂O 2CV。