CN1119545A - Production and transferring of protein - Google Patents

Abstract

The invention relates to a composed body containing the following components: a) a target-striking sequence; b) a regulating sequence; c) exons and d) a no-coupled donor site. The invention also relates to a protein production method for either body-inside or body-outside, and the method includes that a homologous recombination of the composed body is carried out in a cell; then a homologous recombination cell is preserved under the condition that transcription and translation are permitted, so as to trigger the expression of protein. The invention also relates to the homologous recombination cell, including elementary, secondary or permanent vertebrate cells, a method for preparing the cells, a method for generating a fusion gene by homologous recombination, a method for changing gene expressions in cells and a method for making proteins in the cell by adopting the composed body of the invention.

Description

Proteinic production and proteinic conveying

In recent years developed the method for using therapeutic protein treatment disease, it comprises the treatment protein of produced in vitro for conventional medicine conveying (for example intravenous injection, subcutaneous injection or intramuscular injection), and has set up gene therapy method recently.

The protein of tool therapeutic activity generally imports in the suitable cell by the proteinic foreign DNA of therapeutic activity of will encoding and prepares.For example, with the proteinic foreign DNA of the required treatment of coding, import in the carrier of plasmid and so in the cell as the permanence cell, the protein that is encoded is therein expressed.And existing people proposes, and foreign cell gene and expression thereof can be hit target by gene and be modified, for example referring to U.S. Patent No. 527071, WO 91/06666, WO 91/06667 and WO 90/11354.

Present admissible gene therapy method is to utilize infectious vector, retrovirus vector for example, and it comprises the hereditary material that desire is expressed.This method has limitation, for example may produce the virus of tool replication capacity at the carrier production period; Reorganization between therapeutic virus and the endogenous retrovirus retrovirus genome might produce and has new cell-specific, host range or increased toxicity and Cytotoxic infectant; Independently be incorporated in a large amount of cells, increased tumorigenesis and inserted active danger; The limited clone's ability (it has limited the treatment suitability) and the short life expression in vivo of useful products in the retrovirus retrovirus.A kind of method that gene outcome is provided preferably, particularly a kind of limitation and the dangerous method that can avoid present method therefor to be associated is valuable.

The present invention relates to treatment and produce and transmit treatment protein improvement method with proteinic produced in vitro and by gene therapy.In the method, the expression of required target gene in cell (being a kind of required endogenous cell gene), by will comprising the DNA that regulates sequence, exon and splice donor site at least, giving selected earlier site in homologous recombination transfered cell genome and change.These compositions import among chromosome (group group) DNA in such a way, promptly will make it to cause producing new transcript unit (the adjusting sequence, exon and the splice donor site that wherein are present in the DNA construct are operably connected on the endogenous gene).Because these compositions are introduced in the chromosomal DNA, have consequently changed the expression of required endogenous gene.

As used herein, the gene expression that changes comprises that activation (perhaps making it to express) is in the gene of static (not expressing) state usually when obtaining in cell, improving can not be with the expression of gene level of significance level expression on the physiology in cell when obtaining, change and regulate or inducing properties, so that it occurs in cell when obtaining is different, and the gene expression dose of in cell, expressing when reducing (comprising eliminations) former acquisition.

The invention still further relates to the DNA construct that is applicable in the method that changes expression of target gene.This DNA construct comprises: (a) hit target sequence; (b) regulate sequence; (c) exon; (d) unpaired splice donor site.This hits target sequence tutorial element (a)～(d) and is integrated in the intracellular target gene in the DNA construct so that element (b) but～(d) be connected on the endogenous target gene sequence with mode of operation.In another embodiment, this DNA construct comprises: (a) hit target sequence, (b) regulate sequence, (c) exon, (d) splice donor site, (e) intron, and (f) acceptor splicing site site, wherein hit the integration of target sequence tutorial element (a)～(f) so that element (b) but～(f) be connected on the endogenous gene with mode of operation.Hit target sequence and be with cell chromosome DNA (homologous recombination takes place by it) in give and select the site homologous.In this construct, exon generally be regulate 3 of sequence ', and splice donor site be 3 of interior apparent son '.

Following content is used to describe two embodiments of the present invention, wherein the sequence upstream with human forcing erythrogenin (hEPO) gene changes, so that hEPO can be expressed in elementary, secondary or permanence cell, and these cells are in firm acquisition, can not reach EPO with detectable scale when being in not transfected state.In first embodiment, hit the target construct and contain two and hit target sequence.First hits target sequence and comes from the second 5 ' sequence of hitting target sequence together, and two sequences are upstreams of hEPO coding region.Hit the target construct and also contain control band (mMT-1 promoter), exon (human growth hormone (hGH) exons 1) and unpaired splice donor site.Having this homologous recombination product that hits the target construct is shown among Fig. 1.

In the embodiment 2, hit the target construct and also contain two and hit target sequence.First hits the sequence homology in target sequence and the endogenous hEPO control band, and second hit and show sub 1 homology in target sequence and the hEPO.Hit the target construct and also comprise control band (mMT-1 promoter), exon (hGH exons 1) and unpaired splice donor site.Have this homologous recombination product that hits the target construct and be shown in Fig. 2.

In two embodiments, the product that hits the target process is a chimeric transcription unit, first exon that this chimeric transcription unit produces a kind of hGH gene is positioned the ripe mRNA of hEPO exon 2～5 upstreams, the product of transcribing, splicing and translate is a kind of protein, and wherein the amino acid/11 of hEPO signal peptide～4 are replaced by the amino acid residue 1～3 of hGH.These two embodiments, at the relative position of the relevant adjusting sequence of hitting the target construct that is inserted into, the splicing specificity mode aspect of the processed transcript required appearance last with being generation is different.

The invention still further relates to by homologous recombination, above-mentioned construct is imported among the host cell chromosome DNA and produce the homologous recombination somatic cell in external or body, to produce method of protein.Then this homologous recombination somatic cell is maintained can make its transcribe, translate with excretory condition under, thereby produce useful proteins matter.

The present invention relates to be used to produce protein, the transfected cell of therapeutic protein particularly, for example transfected elementary or secondary cell (being impermanentization cell) and transfected permanence cell, make this class cell method, use this class cell in produced in vitro method of protein and gene therapy methods.Cell of the present invention derives from vertebrates, mammal particularly, more specifically be to derive from the people.The cell that produces by method of the present invention contain coding treatment product DNA, itself be the DNA of treatment product and/or can cause transfected cell high level expression gene or have and be different from the corresponding not adjusting that transfected cell occurred or induce the DNA of mode.

The invention still further relates to so as to making cell, for example elementary, secondary and permanence cell transfected with the method that comprises exogenous genetic material, produce the method for clonal cell line or allos cell strain and use transfected elementary, secondary or permanence cellular immunization animal, or in the immunized animal body, produce the method for antibody.

The present invention be more particularly directed in eukaryotic cell, for example fungus, plant or animal vertebrates for example particularly feeds animal, more particularly the method that gene hits target or homologous recombination in the cell in people source.Promptly relate to by homologous recombination, DNA is imported the method in elementary, the secondary or permanence cell in vertebrates source, this DNA is imported into giving of elementary, secondary or permanence cell genomic dna and selects the site like this.The used target sequence that hits can be selected with reference to hitting the site that DNA prepares to insert in the target DNA construct.The invention still further relates to elementary, the secondary or permanence cell of producing by method of the present invention of homologous recombination body, be referred to as elementary, the secondary or permanence cell of homologous recombination body (HR), and HR is elementary, secondary or the use of permanence cell.

In one embodiment of the invention, expression of gene is changed, and gene is activated.Promptly be present in the primary and secondary of vertebrates source or the permanence cell, the gene of not expressed in archeocyte usually during acquisition is activated, and coded protein is expressed as a result.In this embodiment, use homologous recombination with replace, impairment or destroy control band, this zone usually with can cause that by insertion the cytogene that the adjusting sequence of gene with the horizontal expression that is higher than corresponding not transfected cell obtains is relevant.

In one embodiment, the gene that is activated can further be increased by the method that comprises the alternative marker gene of an amplification property, this marker gene is that such character is arranged, but promptly contain the cell of the copy that increases of selected marker gene, can be selected by cultured cell in the presence of the suitable factor selected.But activated endogenous gene is to be amplified in placed in-line mode with amplification property selected marker gene.The cell that contains many copies of the endogenous gene that is activated can be used for produced in vitro protein and gene therapy.

As of the present invention, gene hits target and amplification effect is useful especially to activating the expression of gene that forms transcript unit, said transcript unit is enough greatly to cause it to be difficult to separate and to express, perhaps for activating that whole protein coding zone can not utilize or being not useful especially by cloned genes as yet.

In another embodiment, the expression when the expression of gene ratio has just obtained in cell is improved, and perhaps demonstrates to be different from adjusting or the induced character that occurs under the corresponding not transfected cell situation.Expression low (reducing or eliminating) when in yet another embodiment, expression of gene is than acquisition just in cell.Be used for external protein production in yeast or the antibacterial for transferring to, the present invention has also described and has utilized homologous recombination that gene conversion is become not have the interior method that shows the cDNA copy of son.

Transfected cell of the present invention has a lot of purposes in humans and animals.In one embodiment, in this cell human implantable or the animal body, so as in human body or animal body, carrying protein.For example, be therapeutic purposes, can be with hGH, hEPO, people's pancreotropic hormone and other protein whole body or be transported in the human body partly.In addition, also can produce generation growth hormone, plain, the proteinic transfected inhuman cell of pancreotropic hormone and other inhuman source of short cell generation.

The barrier device (but by this device treatment product free permeation) that contains the transfected cell of expression treatment product can be used in body internal fixation position restrictive cell, or protects protection and isolated cell from host immune system.Barrier device is of great use, and it can make transfected permanence cell, transfected heterogenous cell or transfected homogeneous variant cell implanted, with treatment human or animal's disease or be applied to agricultural (for example produce long hormone and be used for Milk Production).When making Therapeutic Method be subjected to stoping because of some reason, barrier device can carry out short-term (being temporary transient) treatment easily because the approaching easily cell that will remove can be provided.In addition, transfected xenogenesis and homogeneous variant cell can not have to be used to the short-term gene therapy under the situation of barrier device, and the gene outcome that is produced by cell will be transferred in vivo like this, till cell is repelled by host's immune system.

Transfected cell of the present invention also can be used for exciting antibody to produce, or immune humans and animals is with the antagonism virulence factor.The transfected cell of implanting can be used for carrying the immunizing antigen of energy stimulation of host cell and humoral immune reaction.These immunoreation can design protects the host to infect (being immune fitting) to avoid following infectant; exciting and to improve resistance against diseases, or produce the antigenic antibody that produces in vivo at by the transfected cell that can be used for treating with diagnostic purpose at the infection of continuous development.The removable barrier device that contains this cell can be used as termination and stands antigenic simple tool.In addition, the cell of being ostracised the most at last (the transfected cell of xenogenesis or allogeneic) also can be used for restriction and stands antigen, because when cell is ostracised, antigenic generation will stop.

Method of the present invention can be used to produce elementary, the secondary or permanence cell that can produce the useful product of various widely treatment and comprises (but not being only limited to): hormone, cytokinin, antigen, antibody, enzyme, thrombin, transport protein matter, receptor, adjusting protein, structural protein, transcription factor, ribozyme (ribozymes) or antisense RNA.In addition, method of the present invention also can adopt the cell of ribozyme (ribozy-mes), protein or the nucleic acid (they are used to external generation treatment product or are used for gene therapy) of the appearance of production capacity generation in next life non-natural.

Brief Description Of Drawings

Fig. 1 is the sketch map of expression transcriptional activation hEPO genetic method; Thick line: mouse metal sulfur hydrochloride I promoter; Vertical bar line square frame: 5 of hGH ' does not translate the district; Filled box: hGH exons 1; Horizontal stripe line square frame: the 10bP splicing donor sequences of hEPO introne 1; 5 of crosshatch square frame: hEPO ' does not translate the district; Hollow numbering square frame: hEPO coded sequence; Draw oblique line square frame: hEPO 3 ' and do not translate sequence; The HIII:HindIII site.

Fig. 2 is the sketch map that shows transcriptional activation hEPO genetic method; Thick line: mouse metal sulfur hydrochloride I promoter; Vertical bar line square frame: 5 of hGH ' does not translate the district; Filled box: hGH exon I; Hollow numbering square frame: hEPO coded sequence; Draw slanted bar stricture of vagina square frame: hEPO 3 ' does not translate sequence; The HIII:HindIII site.

Fig. 3 represents the sketch map of plasmid pXGH5, and this plasmid comprises the hGH gene that is under the control of mouse metal sulfur hydrochloride promoter.

Fig. 4 represents the sketch map of plasmid pE3neoEPO.Wherein pointed out the position of human erythropoietin gene and neomycin phosphotransferase gene (neo) and ampicillin (amp) resistant gene.Arrow is indicated each gene transcription direction.PmMT1 represents mouse metal sulfur hydrochloride promoter (driving hEPO expresses), and pTK represents herpes simplex virus thymidine kinase promoter (driving neo expresses).The gene map midpoint area is represented from person-time position of the on-site sequence of xanthine-guanine phosphoribosyl transferase (HPRT).Wherein marked the relative position of restriction endonuclease recognition site.

Fig. 5 represents the sketch map of plasmid pcDNEO, this plasmid comprises the neo coding region from plasmid pSV2neo (BamHI-BglII fragment) in the BamHI site that is inserted into plasmid pcD, from Amp-R and the pBR 322 Ori sequences of pBR 322, and polyA, 16S splicing bonding land and from the early promoter zone of SV40.

Fig. 6 represents plasmid pREPO4 sketch map.

The erythropoietin that Fig. 7 is shown in the human cell line that hits who stands progressively to select in 0.02,0.05,0.1, the 0.2 and 0.4 μ M methotrexate is expressed.

Fig. 8 represents the sketch map of plasmid pREPO15.The filling frame table shows the fragment from genome hEPO sequence.Between BamHI (3537) and BglII '/HindIII ' zone is equivalent to Genba-nK and charges to the sequence on 1～4008 among the HUMERPALU.Zone between BglII '/HindIII ' (11463) is equivalent to Genbank and charges to the DNA sequence on 4009～5169 among the HUMERPALU.Zone between HindIII (11463) and XhoI (624) is contained and is equivalent to 7～624 the sequence that Genbank charges to HUMEPA.Hollow frame is represented the CMV promoter sequence, wherein contains the sequence from nucleotide 546～2105 among the Genbank sequence HS5MIEP.The hollow frame of band arrow is represented the neo gene.Draw the hachure frame table and show that the thymidine that drives neo gene expression swashs nurse (tk) promoter.Fine rule represents to comprise the pBSIISK+ sequence of amp gene.

Fig. 9 A lists restriction map, and observed product (top) behind the diagram digestion endogenous hEPO gene, and with the activated hEPO gene (below) behind the target fragment homologous recombination that hits of pREO15.

Fig. 9 B lists the result (referring to embodiment 7) who (T1) human fibroblasts clone HF342～15 of being untreated (HF) and hitting is carried out digestion with restriction enzyme and Southern hybridization analysis.

Figure 10 represents the sketch map of plasmid pREPO18.Fill frame and represent the fragment that derives from genome hEPO sequence.Zone between BamHI (3537) and ClaI (7554) is equivalent to Genbank and charges to the sequence on 1～4008 among the HUMERPALU.Zone between ATG (12246) and HindIII (13426) is equivalent to Genbank and charges to the DNA sequence on 4009～5169 among the HUMERPLAU.Zone between HindIII (13426) and the XhoI (624) is contained and is equivalent to the sequence that Genbank charges among the HUMERPA 7～624.The CMV promoter sequence represents with hollow frame, and contains the sequence from nucleotide 546～2015 among the Genbank sequence HS5MIEP.Dihydrofolate reductase (dhfr) transcript unit shows with the some frame table of band arrow.The neo gene is represented with the hollow frame of band arrow.The tk promoter that drives the neo gene is shown to draw the hachure frame table.The fine rule representative contains the pBSIISK+ sequence of amp gene.

Figure 11 illustrates the intronless gene that is used for activating and increasing of the present invention, the construct of alpha-IFN gene, wherein this construct comprises: first hit target sequence (1), the marker gene that can increase (AM) but selected marker gene (SM), regulate sequence, CAP site, splice donor site (SD), intron (fine rule), acceptor splicing site site (SA) and second and hit target sequence (2).Black surround is represented coding DNA, and sequence is not translated in the representative of some frame.

Figure 12 illustrates that the present invention is used to activate and the construct of the endogenous gene that increases, wherein first exon impels signal peptide, human GM-CSF gene, described construct comprise first hit target sequence (1), the marker gene that can increase (AM) but selected marker gene (SM), regulate sequence, CAP site, splice donor site (SD) and second and hit target sequence (2).Dark square is represented coding DNA and is put the square frame representative and do not translate sequence.

Figure 13 illustrates that the present invention is used to activate and the construct of the endogenous gene that increases, wherein first exon impels signal peptide, human G-CSF gene, this construct comprises and first hits target sequence (1), the marker gene (AM) that can increase, selectable marker gene (SM), regulates sequence, CAP site, and splice donor site (SD) and second hits target sequence (2).Dark square is represented coding DNA and is spent the representative of some square frame not translate sequence.

Figure 14 illustrates that the present invention is used to activate and the construct of the endogenous gene that increases, wherein first exon is non-coding, people FSH β gene, this construct comprises first and hits target sequence (1), the marker gene that can increase (AM) but selected marker gene (SM), regulate sequence, CAP site, splice donor site (SD) and second and hit target sequence (2).Black surround is represented coding DNA and is put the frame representative and do not translate sequence.

The present invention is based on discovery and can be binned in the cytogene group preliminary election site by homology and inserts The construct that enters DNA changes regulating action or its activity of useful endogenous gene in the cell, Described construct comprises: (a) hit target sequence; (b) regulate sequence; (c) extron and (d) non-The pairing splice donor site wherein hits the integration that target sequence instructs element (a)～(d), so that Element composition (b)～(d) be operably connected on the endogenous gene. In another embodiment side In the case, DNA construct comprises: (a) hit target sequence, (b) regulate sequence, and (c) extron, (d) splice donor site, (e) introne and (f) acceptor splicing site site wherein hit the target order Row instruct the integration of element (a)～(f), so that in element (b)～(f) is operably connected to On the First Exon of source property gene. Can according to the site that is inserted into DNA select use Hit target sequence. In two embodiments, hit the target process for generation of new transcript unit, It is a kind of fusion product of the sequence by hitting the importing of target DNA construct and endogenous cellular gene Thing. As discussed in this article, for example can be by in the genomic DNA of host cell, leading Enter construct of the present invention to form new transcript unit, transcribe silent gene (namely thereby make Can not be at the cell inner expression gene before the transfection) in host cell, be activated. Also such as this Literary composition is discussed, but the method for the application of the invention and DNA construct change at cell The expression of the endogenous gene of interior expression wherein can be raising, the reduction bag of expression Draw together elimination, perhaps can change and regulate or induced character.

As mentioned above, the present invention relates to the eucaryon derived cell, as fungi, plant or Animal, such as vertebrate, mammal particularly is more specifically in the cell in people source Gene or the DNA method of hitting target. In other words, the present invention relates to recombinate by the homology of DNA Or hit cell such as elementary, the secondary or permanence cell that target imports DNA in vertebrate source Interior method, wherein said DNA is in the genomic DNA of the pre-site transfered cell of selecting. More particularly, the present invention relates to homology restructuring, wherein by use comprise hit target sequence, The DNA construct of adjusting sequence, extron and splice donor site is modified endogenous gene Transcribe and/or translational product. It is thin to the invention still further relates to the homology recombinant that produces by this method The application of born of the same parents and homology recombinant cell.

The present invention also relates to activate the primary cell, the secondary cell that are present in the vertebrate source Or in the permanence cell, but usually not in the method for the gene of these cells. Use Homology is recombinated or is hit target with in the genome sequence with the DNA transfered cell, causes gene being subjected to Expressed in the body cell. In another embodiment, by importing DNA construct, carry Adjusting or the induced character of the expression of high gene gene in cell or change gene. Knot Fruit makes the product that is encoded to be expressed than level higher in corresponding non-transfected cell. This Inventive method and DNA construct also can be used for producing such cell, i.e. required product wherein Low at corresponding not transfected intracellular expression at transfected intracellular expression ratio. Just Be to say, in the resulting archaeocyte of transfected cell internal ratio, produce protein (bag still less Draw together nonprotein).

In another embodiment, encode the normal silent gene of required product transfected Be activated and increase in elementary, the secondary or permanence cell. This embodiment is a kind of passing through Import common on function, the connection with endogenous gene with the restructuring of genomic DNA homology The method of dna sequence dna, wherein (1) when this dna sequence dna the endogenous gene place or near quilt insert When entering in the host gene group, can be in order to changing the expression of (as activating) endogenous gene, and And the cell of (2) being selected those endogenous genes that wherein activate to be amplified. In addition, exist The expression of the gene of usually expressing in the gained archaeocyte is improved and gene is also expanded Increase.

Hereinafter describe DNA construct of the present invention, produce transfected thin with these DNA constructs The application of born of the same parents' method, transfectional cell and these cells.

DNA construct

DNA construct of the present invention comprises following composition at least: hit target sequence, regulate sequence, Extron and the splice donor site that do not match. In this construct, extron is being regulated sequence 3 ' side, and do not match the 3 ' side of splice donor site at extron. In addition, have at side joint Do not match the extron front (5 ' direction) of splice donor site can have a plurality of extrons and / or introne. As discussed herein, additional construct composition is arranged usually, as optional Select the sign sign that maybe can increase.

DNA can be called as ectogenic in the construct. Term used herein " exogenous " Be defined as by method of the present invention, import to such as the DNA construct that limits by this paper Intracellular DNA. Exogenous DNA can have and be present in intracellular endogenous before the transfection The sequence that DNA is identical or different.

Hit target sequence

Hit target sequence and be and allow the recombinate selected cell that contains useful gene of reasonable homology Dna sequence dna in the genome. Hit target sequence generally with normal presence in the gained archaeocyte Dna sequence dna in the genome (as is positioned at transcription initiation site upstream, the transfection of useful gene Coding or the noncoding DNA in the termination site or downstream are perhaps deposited by original modification Be the sequence in the genome) homology (namely identical with cell DNA or have enough similar, The homology restructuring can take place so that hit target sequence and cell DNA) dna sequence dna. Can be with reference to inciting somebody to action Select the used target sequence that hits to the site of the DNA that wherein inserts DNA construct.

Can utilize one or more target sequences that hit. For example, circular plasmids or dna fragmentation are preferred Use the single target sequence that hits. Linear plasmid or dna fragmentation preferably use two to hit target sequence. Hit target sequence can be at random useful gene (such as the sequence of extron and/or introne) it In, directly be contiguous on the useful gene (namely in the code area of hitting target sequence and useful gene it Between do not have other nucleotides), in the upstream of useful gene (such as the order of upstream noncoding region Row or endogenous promoter sequence) or in the upstream of gene and leave certain distance (as The upstream sequence of endogenous promoter). Hit target sequence can comprise those at present known or The quilt of having measured sequence hits the zone of gene, and/or does not determine on the structure but can make The more upstream of making gene map and being determined by these those skilled in the art with restriction enzyme The territory.

As teaching herein, available gene hit Target process will separate from heterogeneic, by Separation from the assembling of the composition of different cells and/or viral source or as new adjusting order Row with the synthetic adjusting sequence of gene engineering method be inserted in the endogenous cell gene, with it straight Connect adjacent, upstream or have with it in the site of suitable distance. In addition, can be by hitting target Replace, remove, add or modify the structure that can affect the RNA that produces or protein or steady Sequence qualitatively. For example, can modify the RNA molecule rna stability element, splicing site and / or targeting sequencing, to improve or to change function, the stability of RNA molecule and/or translate energy Power. Also can change protein sequence such as burst, former peptide sequence, avtive spot and/ Or structure sequence is to improve or to modify transportation, secretion or the functional characteristic of protein. According to this Method imports normal expression character and/or protein or RNA that foreign DNA can cause gene The change of architectural characteristic.

Regulate sequence

The adjusting sequence of DNA construct can by one or more promoters (as consist of or can The promoter of inducing), enhancer, skeleton bonding pad or matrix connect site, the negative unit that regulates The bond of part, transcription factor binding site point or described sequence.

Regulate sequence and can comprise inducible promoter, can be imported into individuality during so former generation Cell when interior not expression product can be induced to express (in transfected cell generation Rear but be induced expression before implanting or after implanting). Certainly, can advance when importing The mode that row is expressed (for example, under the promoter condition that consists of) the required product of will encoding In the DNA transfered cell. Can be from cell or viral genome the separation adjusting sequence, such Regulating sequence comprises and regulates the early stage or late gene of SV40, the big late gene of adenovirus, mouse Metallothioneins-I gene, elongation factor-1 α gene, the huge viral gene of cell, collagen egg White gene, actin gene, immunoglobulin gene or HGM-CoA reductase gene table The sequence that reaches. Regulate sequence and contain preferably the transcription factor binding site point, as the TATA box, CCAAT box, AP1, SP1 or NF-κ B binding site.

Additional DNA construct element

DNA construct also comprises one or more extrons. Herein extron is defined as The dna sequence dna that is copied into RNA and exists with ripe mRNA molecule. Extron optionally contains It (is codon that coding one or more amino acid and/or certain seed amino acid of partly encoding are arranged One or two base) DNA. In addition, extron also contains and is equivalent to 5 ' noncoding region DNA. Such as the one or more amino acid of exogenous exons coding and/or certain amino acid whose Part, design dna construct so that make when transcribing and splice are understood the of code and target gene Two extrons or code area are in the code. Term used herein " in the code " refers to when the When the coded sequence of one extron and Second Exon merges, nucleotides just with do not change by The suitable mode of understanding code of the mRNA part that Second Exon is derived links together.

First Exon such as middle target gene contains the sequence ATG that translates in order to startup, then structure The exogenous extron of building body preferably contains ATG, and also contains one or many in case of necessity Individual nucleotides, thus make second of target gene in the comprising of gained and continue after extron The mRNA code area is in code. This wherein First Exon contains the target gene of ATG Example comprises granulocyte/macrophage colony stimulatory factor (hGM of coding hEPO, hGH, people-CSF) and the gene of people's granulocyte colony stimulating factor (hG-CSF).

As target gene coding erythropoietin, exogenous exon can be derived from any gene, and exon comprises the part of ATG start codon and coded protein in the described gene.Exon further terminates in first nucleotide place of codon.Example comprises degreasing protein E gene (exons 1 and 2), Placenta Hominis prolactin antagonist gene (by hCS-A and hCS-B gene code), prolactin antagonist gene, human growth hormone's variant gene (hGH-B), human chorionic somatomammotropin-L gene (hCS-L) and granulocyte/M-CSF gene (EM-CSF).

Splice donor site is to instruct the sequence of an exon splicing to another exon.Usually, first exon is positioned at 5 ' side of second exon, and overlapping and side joint first exon is discerned the acceptor splicing site site of side joint second exon on second exon, 5 ' side at the splice donor site of first exon on its 3 ' side.It is the characteristic of the representative sequence that conforms to that splice donor site has with (A/C) AGGURAGU (wherein R represents purine nucleotides), and requiring on the 4th and the 5th is GU (Jakson, I.J., Nucleic Acids Research 19:3715-3798 (1991).Conform to first three base in site of splicing donor is back three bases of exon.Splice donor site is to be limited by the ability that they influence appropriate reaction in the mRNA splicing approach on function.

The splice donor site that do not match herein is defined as being present in and hits in the target construct and with in the construct be not positioned at the splice donor site that accompanies in this acceptor splicing site site of not matching splice donor site 3 ' side.The splice donor site that do not match causes the splicing with endogenous acceptor splicing site site.

The same with splice donor site, the acceptor splicing site site in the sequence also is the splicing of instructing an exon and another exon.Based on the effect of performance during splice donor site combines, splicing body uses the acceptor splicing site site to remove intron.The acceptor splicing site site has the characteristic sequence with YYYYYYYYYYNYAG representative, and wherein Y represents any pyrimidine bases and N represents any nucleotide (Jackon, I.J., Nacleic Acids Research 19:3715-3798 (1991)).

Intron is defined as between two exons, and the sequence of one or more nucleotide of removing from precursor rna molecule by splicing in mRNA molecule forming process.

Regulating sequence is for example to be operably connected on the ATG start codon, and it can start translates.Optionally, CAP site (link to each other with regulatory region and be conditioned the specific mrna initiation site that the district utilizes) is operably connected to and regulates on sequence and the ATG start codon.In addition, and regulate that sequence links to each other and this CAP site of being conditioned the sequence utilization is not included in and hits in the target construct, and transcribe mechanism and will limit a new CAP site.For most of genes, the CAP site sees about 25 the nucleotide places of TATA box 3 ' side usually.In one embodiment, splice donor site is positioned at and ATG direct neighbor place, for example when second exon of exogenous exon and target gene be that just not necessarily there are one or more nucleotide in requirement when coexisting in the sign indicating number.Encode the coded sequence of the DNA of one or more aminoacid or amino acid moiety and target gene in sign indicating number the time, and then it preferably is positioned at directly and the ATG adjacent on its 3 ' side.In such embodiment, splice donor site is positioned at directly adjacent with the coding DNA on its 3 ' side.

That settles on that be operably connected or the function is meant a kind of configuration, wherein exogenous adjusting sequence, exon, splice donor site, randomly certain sequence of Cun Zaiing and acceptor splicing site site suitably hit target with the corresponding position of endogenous gene on, thereby make regulating element instruct the generation of elementary rna transcription thing, this transcript to begin (can randomly be included in and hit in the target construct) in the CAP site and comprise the sequence of the exon and the splice donor site that are equivalent to hit the target construct, be positioned at endogenous gene and regulate the DNA of regulatory region (if present) upstream, the regulatory region of endogenous gene (if present), endogenous its because of 5 ' nontranscribed domain (if present), exon and intron (if present) with endogenous gene.In the configuration that is operably connected, the splice donor site that hits the target construct instructs a process of splicing mutually with the acceptor splicing site site of one of exon of side joint endogenous gene, thus the required protein of mature transcript generation that can connect from spelling.In one embodiment, the acceptor splicing site site is endogenic, and splicing is at the endogenous exon like this, for example the endogenous exon of endogenous gene.In another embodiment, the acceptor splicing site site is included in to be hit in the target construct, and this splicing can be removed by hitting the intron that the target construct imports.

Used coding DNA (as in the exons 1 that hits the target construct) one or more aminoacid of can randomly encoding, and/or certain amino acid whose part, they are same with the coding DNA of endogenous protein.DNA sequences encoding used herein for example can be corresponding to first exon of useful gene.This coding DNA codified is different from one or more aminoacid or certain amino acid whose part of useful proteins first exon in addition.Proteinic one or more activity are not that such embodiment is significant especially under the very crucial situation for this when the aminoacid of useful proteinic first exon.For example, when making up, then can utilize the sequence of first exon of coding hGH with endogenous hEPO gene formation fusant.In this example, the fusion of hGH exons 1 and hEPO exon 2 causes having the formation of the active heterozygosis signal peptide of function.In relevant construct, can use the aminoacid that wherein is encoded not hinder anyone or the exon in inhuman source of the function of heterozygosis signal peptide.In a related embodiment, also can use this technology to see sudden change in the target gene with correction.

As required product is endogenous protein and when hitting the fused protein of coded sequence in the target construct, be incorporated into intracellular exogenous coding DNA by this method and comprise the DNA of one or more exons that encodes, or be equivalent to be fused to translating or the cDNA sequence of transcription product on the endogenous target gene product.In this embodiment, use is hit Target process and is prepared chimeric or multifunctional protein, and it will be combined in the polypeptide from two or more proteinic structures, enzymatic or aglucon or receptors bind character.For example, the foreign DNA codified is localized anchorage peptide or signal peptide on the target protein plasma membrane, to provide or to improve emiocytosis, targeting sequencing, enzymatic zone, stride film dominant area, cofactor calmodulin binding domain CaM or other functional regions.Do not secrete under the normal condition but can merge to provide excretory protein example to comprise DOPA decarboxylase, NlmR, alpha-galactosidase and white horse with a black mane propylhomoserin hydroxylase with signal-proteins.

First exon as target gene is equivalent to noncoding region (for example first exon of follicle-stimulating hormone β (FSH β) gene), then needn't have or better deletes external source ATG.

Can obtain from natural origin, or use technique for gene engineering or synthetic method to produce the DNA of construct.

Target gene and products therefrom

After in cell such as elementary, secondary or permanence cell are arrived in transfection, DNA construct is the expression of the active or functional part of the required product of may command such as protein or RNA.Product for example can be hormone, cytokine, antigen, antibody, enzyme, thrombin, transport protein matter, receptor, adjusting albumen, structural protein, transcription factor, antisense RNA or ribozyme (ribozyme).In addition, product also can be non-existent protein of nature or nucleic acid (being fusant protein or nucleic acid).

Method as herein described can produce one or more treatment products, as erythropoietin, calcitonin, growth hormone, insulin, insulinotropic hormone, insulin like growth factor, parathyroid hormone, interferon beta and nerve growth factor, FSH β, TGF-β, tumor necrosis factor, glucagon, skeletal growth factor 2, skeletal growth factor 7, TSH-β, interleukin-11, interleukin-22, interleukin-13, interleukin 6, interleukin 11, interleukin 12, the CSF-granulocyte, the CSF-macrophage, CSF one granulocyte/macrophage, immunoglobulin, catalytic antibody, Protein kinase C, grape sugar cerebrosidase, the peroxide dismutase, tissue plasminogen activator, urokinase, Antithrombin III, DNAse, alpha-galactosidase, tyrosine hydroxylase, labile factor, proconvertin, blood coagulation factor VIII, plasma thromboplastin component, Stuart factor, Hageman factor I, degreasing protein E or degreasing protein A-I, globin, low density lipoprotein receptor, the IL-2 receptor, the IL-2 antagonist, α-1 antitrypsin, immune response modifier and solubility CD4.

But selection marker and amplification

Can use one or more selectable marker gene to be beneficial to identify the target process of hitting.These signs can be included in and hit in the target construct or appear on the different constructs.But selection marker can be divided into two classes: positive selectable and negative selectable (in other words, promptly carrying out positive the selection or the negative sign of selecting).In the positive is selected, (CAD, aspartate carbamyl-transferase and dihydro milk surum enzyme, glutamine synthetase (GS), multi-drug resistance 1 (mdrl) and histidine D (his D) survival as neo, xanthine one guanine phosphoribosyltransferase (gpt), dhfr, ADA Adenosine deaminase (ada), puromycin (pac), hygromycin (hyg), encoding carbamoyl phosphate synthetase are handled, and wherein hit the target construct and have been incorporated into the interior cell of host cell gene group thereby can select but the cell of expressing positive selection marker can enough selective agents.In feminine gender is selected, but the cell of expression feminine gender selection marker is destroyed in the presence of selective agent.Can use one or more marker gene that present negative selectivity characteristic to be beneficial to identify the target process of hitting, but the feminine gender selection marker is connected on the foreign DNA, but but form arrange the relation be to make the feminine gender selection marker be connected the flank that hits target sequence, but thereby and with the host cell gene group in sequence form the stable integration (Mansour that correct homologous recombination can not cause the feminine gender selection marker, S.L.etal., Nature 336:348-352 (1988)).The sign that is used for this purpose comprises herpes simplex virus thymidine kinase (TK) gene or antibacterial gpt gene.

But can be incorporated into various selection markers elementary, secondary or the permanence cell in.For example, but can use to have and can select phenotype such as drug resistance, auxotroph, the resistance of pair cell toxic agents or the selection markers such as expression of surface protein.But spendable selected marker gene comprises neo, gpt, dhfr, ada, pac, hyg, CAD, GS, mdrl and hhisD.The phenotype selected of being given makes to be had the possibility evaluation and separates recipient cell.

But the amplifiable gene (as ada, GS, dhfe and multi-functional CAD gene) of coding selection marker has the feature of adding, but this feature can make them can select to contain the cell of the copy that increases of the selection marker that is inserted in the genome.This feature provides a kind of mechanism of copy number of adjacent or continuous gene of remarkable increase expectation amplification.But also can use his extension increasing sequence of the mutant that shows these sequences improved selectivity characteristic and other.

The ordering of each component part can be different in the DNA construct.When construct was circular plasmids, the order of each element can be in the resulting structures: hit target sequence-plasmid DNA (constituting) by the sequence that is used for selecting and/or duplicate microorganism or other suitable hosts hit the target plasmid but-selection marker-adjusting sequence-exon-splice donor site.Be to use the restricted enzyme cutting of cutting one or many in hitting target sequence to contain the plasmid that hits target sequence and foreign DNA element preferably, linear or the notched molecule with generation before importing recipient cell, thus make the terminal frequency that increases expection homologous recombination process as described herein of dissociative DNA.In addition, available exonuclease handle the dissociative DNA end with generation dangle outstanding 5 ' or 3 of single-stranded DNA end ', thereby increase the frequency of expection homologous recombination process.In this embodiment, the homologous recombination that hits between target sequence and the cellular targets will produce the copy that hit target sequence of two side joints on being included in the element that is imported in the plasmid.

As construct is linear, and this subsequence is as being: but first hit target sequence-selection marker-adjusting sequence-exon-splice donor site-second and hit target sequence; Perhaps can be but that first DNA-second that hits target sequence-adjusting sequence-exon-connect donor site-coding selection marker hits target sequence.Stably the cell of construction and integration body will be handled with the selective agent survival; A subgroup of the cell of stable transfection will be the homologous recombination somatic cell.Available PCR, Southern hybridization and phenotypic screen multiple technologies are identified the homologous recombination somatic cell.

In another embodiment, the order of construct each several part can be: but first hit target sequence-selection marker-adjusting sequence-exon-splice donor site-intron-acceptor splicing site site-second and hit target sequence.

Perhaps, the subsequence of each ingredient is as being in the DNA construct: but but first hit target sequence-selection marker 1-and regulate sequence-exon-splice donor site-second and hit target sequence-selection marker 2, but but perhaps can be first to hit target sequence-adjustings sequence-exon-splicing donor confession point-selection marker 1-second and hit target sequence-selection marker 2.In this embodiment, but selection marker 2 performance has the negative feature of selecting.In other words, can according to not contain certain reagent (generally being medicine or metabolite analog) but the appropriate culture medium formulation in growth select the gene outcome of selection marker 2, but wherein said reagent can kill the cell of expression selection marker 2.But but side joint selection marker 1 hit the positioning integration that the reorganization between homologous sequence in target sequence and the host cell gene group causes selection marker 1, but selection marker 2 then is not integrated.But but such regrouping process produce by selection marker 1 stable transfection but not by the cell of selection marker 2 stable transfections, but but and can be according at the selective agent that contains selection selection marker 1 and do not select the growing state in the culture medium of selective agent of selection marker 2 select these cells.

But DNA construct also can comprise the positive selection marker of the cell of the copy that increases that allows selection to contain this sign.Such sign that increases causes the coamplification of side joint DNA sequence.In this embodiment, the ordering of each component of construct for example is: but but first positive selection marker-second selection marker (the optional)-adjusting sequence-exon-splice donor site-second that hits target sequence-can increase hits the target DNA sequence.

In this embodiment, but can be by comprising the further gene that is activated of amplification of selected marker gene, but described marker gene has the character of cell that can select to contain the copy that increases of selected marker gene by cultured cell in the culture medium that suitably can select preparation is arranged.But the endogenous gene that is activated will be amplified in succession with the selected marker gene that has increased.The cell that contains the copy of many endogenous genes that are activated can produce the very desired protein of a large amount, and can be used for external protein production and gene therapy.

In any embodiment, can select and can increase marker gene all needn't be directly adjacent to each other.

Randomly but DNA construct can contain antibacterial replication origin and cell antibiotic resistance sign or other selection markers of permission a large amount of propagation plasmids in antibacterial or any other suitable clone/host system.But can use the DNA that comprises the coding selection marker together with the DNA construct at appended sequence such as promoter and splicing abutment to give transfected cell can select phenotype (as the plasmid pcDNEO that schematically illustrates among Fig. 4).Can use methods described herein that such DNA construct is arrived in elementary or the secondary cell together with hitting target DNA sequence cotransfection.

Transfection and homologous recombination

According to this method, as in unique DNA construct or separated DNA sequence transfered cell such as elementary, secondary or the permanence cell, wherein the separated DNA sequence is incorporated in the chromosome or nuclear DNA of transfected cell gradually with construct.

But can will contain at the unique DNA construct or on isolating construct hit target sequence, regulate sequence, the hitting in the target DNA construct transfered cell of exon, splice donor site and selected marker gene.The total length of DNA construct will be decided according to the number of component (but routine forward play target sequence, adjusting sequence, exon selected marker gene and its element of base) and the length of each component.The length of whole construct is generally at least about 200 nucleotide.In addition, this DNA can be used as line style, bifilar (being with or without the sub-thread district at an end or two ends), sub-thread or cyclic DNA and is imported into.

Then that the construct transfered cell of any form disclosed by the invention is interior to obtain transfected cell.Under the condition that allows the generation homologous recombination as known in the art, keep transfected cell (Capecchi, M.R., Science 244:1288-1292 (1989).When keeping the homologous recombination cell under the condition that is being enough to transcription DNA, the regulatory region (as promoter) that is hit the importing of target construct is with the activated transcription process.

Can be by multiple physics or chemical method with in the DNA construct transfered cell, these methods comprise the transfection of electroporation, microinjection, micropellet bombardment, calcium phosphate precipitation and liposome, polyethylene (polybrene-) or deae dextran mediation.Also can use relevant parotitis of infectiousness carrier such as retrovirus retrovirus, herpesvirus, adenovirus, adenovirus and poliovirus carrier to import DNA in addition.

Randomly also can will hit in the target DNA transfered cell by the segmental form of two or more separated DNA.Using under two segmental situations, one segmental 3 ' terminal and another is segmental 5 ' terminally share DNA sequence homology (overlapping), and fragment is carried first and is hit target sequence and another and carry second and hit target sequence.When transfered cell, two fragments can be carried out homologous recombination to form single fragment, wherein first and second overlapping regions that hit between target sequence side joint two original segments.The products therefrom fragment is the homologous recombination that is applicable to the cellular targets sequence like this.Also can use plural fragment, design will make these fragments can carry out homologous recombination each other, is suitable for as stated above product with the reorganization of cellular targets sequence homology with last formation.

The homologous recombination somatic cell

Hit the target process and cause hitting the insertion of the adjusting sequence of target construct, endogenous gene is under their control (for example inserting promoter or enhancer by the upstream at endogenous gene or regulatory region).Randomly, hit the disappearance that the target process can cause endogenous regulating element simultaneously, as the disappearance of the negative regulating element of tissue specificity.Hit the replaceable existing element of target process, for example tissue-specific enhancer can be had wideer than natural element or different cell type-specific enhancer replaces, and perhaps presenting has adjusting or the induced character that is different from corresponding non-transfected cells.In this embodiment, naturally occurring sequence is deleted and added new sequence.In addition, also can be that endogenous regulating element is not removed or replaces, but make it to destroy or lose activity as the target process of hitting at exogenous array in the endogenous regulating element by hitting the target process.

After with the DNA transfered cell, known in the art, be suitable under the condition that homologous recombination takes place between genomic DNA and the DNA that is introduced into part, keeping cell (Capecchi, M.R., Science 244:1288-1292 (1989)).

Homologous recombination between genomic DNA and the DNA that is imported into produces homology recombinant cell such as fungus, plant or zooblast, particularly elementary, secondary or permanence people or other mammalian cell, the sequence that wherein changes the endogenous gene expression is operably connected on the endogenous gene of certain product of coding, produces to have expression that is different from endogenous gene and/or the new transcript unit of encoding potential.Specifically, the present invention includes and contain the homologous recombination somatic cell of regulating sequence and exon, said adjusting sequence and exon side joint have splice donor site, import and are operably connected on second exon of endogenous gene at predetermined site by hitting the target DNA construct.Randomly, external source exon (coding or noncoding) and intron on a plurality of any exons that are operably connected to endogenous gene also can be arranged.Selecting the amplification coding resulting homologous recombination somatic cell of cultivation under the condition of DNA of sign and new transcript unit's (as suitable) of can increasing.No matter whether increase, all can under the condition that is suitable for protein expression known in the art, cultivate cell, thereby, perhaps cell is used for delivering therapeutic protein in the body (being gene therapy) at produced in vitro protein with this method generation.

The said primary cell of this paper comprise be present in from vertebrates tissue source isolated cells suspension (with them auxilliary apply be combined in tissue culture such as plate or culture bottle shortly before) cell, be present in cell (these two kinds of cells all are to be used for the prototype cell of bed board for the first time) in the explant of self-organizing and the cell suspension that obtains from these bed board cells.Term secondary cell or cell strain be meant in cultivation all continue after the cell of step.In other words, from culture matrix, remove the primary cell of bed board for the first time and (the going down to posterity) of bed board again, and continue after all cells this paper of going down to posterity be called secondary cell.Secondary cell is the cell strain that the secondary cell by the one or many that goes down to posterity constitutes.A kind of cell strain that is made of secondary cell is: one or many 1) has gone down to posterity; 2) in culture, have the average population multiplication of limited number characteristic; 3) performance have contact inhibition, anchorage dependence growth characteristics (anchorage dependence also is not suitable for value-added cell in suspension culture); And 4) non-ly change forever.

The permanence cell is cell line (fixed " cell strain " this definition is relative with aiming at the primary and secondary cell), and its principal character is that they show the obviously unlimited life-span in culture.

The cell of selecting for use for this subject methods can be divided into four types or big class: the cell of not making or contain protein or product (as the fused protein that is not had usually by the protein of cellular expression or nature usually) during 1) as former obtaining; 2) make or contain the cell of certain protein or product, but its manufacturing or amount are not desired amount (be lower than as its amount on the physiology of its archeocyte when resultant common low-level); The common low-level manufacturing protein or the cell of product on one physiology of the archeocyte during 3) as former obtaining, but its content or output will be enhanced or increase; And 4) be expected to change wherein the encode adjusting of certain proteinic gene or the cell of induced character.

Can obtain using elementary, the secondary and permanence cell of this method transfection from various tissues, and comprise the cell type that all can be kept in culture.For example, the primary and secondary cell of available this method transfection comprises formation composition (as lymphocyte, medullary cell), myocyte and these somatic precursors of fibroblast, horn cell, epithelial cell (as galactophore epithelial cell, intestinal epithelial cell), endotheliocyte, glial cell, neurocyte, blood.Will be used for gene therapy as the homology recombinant cell, primary cell better is to obtain in the individual body that will accept transfected elementary or secondary cell.But primary cell can obtain from donor of the same race (individuality beyond the receptor).

Also can produce homologous recombination body permanence cell and be used for protein production or gene therapy with this method.Be used for comprising but be not only limited to HT1080 cell (ATCC CCL 121) by the example that this method is produced the permanence human cell line of protein or gene therapy, the derivant of HeLa cell and HeLa cell (ATCC CCL 2,2.1 and 2.2), MCF-7 breast cancer cell (ATCC BTH 22), κ-562 leukaemia (ATCC CCL 243), κ B cancerous cell (ATCC CCL 17), 2780AD ovarian cancer cell (Van der Blick, A.M.et al., Cancer Res., 48:5927-5932 (1988)), Raji cell (ATCC CCL 86), Jurkat cell (ATCC TIB 152), Namalwa cell (ATCC CRL 1432), HL-60 cell (ATCC CCL 240), Daudi cell (ATCC CCL 213), RPMI 8226 cells (ATCC CCL 155), V-937 cell (ATCC CRL 1593), Bowes melanoma cells (ATCC CRL 9607), WI-38VA13 subbreed 2R4 cell (ATCC CCL 75.1) and MO LT-4 cell (ATCC CRL1582), and through merging the xenogenesis hybridoma that people's cell and another kind cell are produced.Can use secondary human fibroblasts cell strain such as WI-38 (ATCC CCL 75) and MRC-5 (ATCC CCL 171).In addition, can use elementary, secondary and permanence people cell, and elementary, the secondary or permanence cell that demonstrates other kind of outer-gene amplification character carry out external protein production or gene therapy.

Gene conversion is become the method for cDNA copy

The invention still further relates to and use homologous recombination gene conversion to be become the method for cDNA copy (gene copy that does not have intron).CDNA copy can be transformed in yeast or the antibacterial to carry out external protein production, perhaps the cDNA copy be inserted in the mammalian cell to carry out external or the production of body internal protein.If cDNA will be transferred in the microbial cell, can import two through homologous recombination and contain the DNA construct of hitting target sequence, one is the upstream construct of the people's gene of coding therapeutic protein, one is the downstream construct of said gene.For example, the sequence that imports the upstream comprises the DNA that starts the excretory leader peptide of microbial cell with the coding that repeats (LTR) for a long time, is coded in the sequence that is used for the sign selected in the microbial cell, the regulating element of function is arranged and have a splice donor site at microbial cell through first amino acid whose DNA of the therapeutic protein of processing or the homologous DNA sequence of its upstream gene group DNA sequence, retrovirus retrovirus of encoding mature.The sequence that imports the upstream is near the first amino acid whose genomic DNA of the therapeutic protein through processing of encoding mature and the upstream is imported into.The sequence that imports the downstream comprise with encoding mature through proteinic last amino acid whose DNA of processing or the homologous DNA sequence of genomic dna sequence in its downstream, the transcription terminator of microorganism, the sequence and the retrovirus retrovirus LTR that can instruct DNA in microbial cell, to duplicate.The sequence that imports the downstream is to be imported in the DNA adjacent and the downstream of the termination codon of the therapeutic protein through processing of encoding mature.After these two DNA construct are imported in the cell, under the condition that is suitable for being imported into generation homologous recombination between DNA and genomic DNA, keep the gained cell, thereby produce the homologous recombination somatic cell.Sometimes, one of DNA construct or both codifieds are used to contain one or more signs that the positive or negative of the cell of DNA construct is selected, and can select step with increasing by one in the method behind one of them or the two kinds of DNA construct transfered cells.In addition, the sequence that is coded in the sequence of the selection marker in the microbial cell and can instructs DNA to duplicate in microbial cell can be that the both is present in the upstream or down in the guerrilla warfare target construct, perhaps can be that the sign that is used for selecting in microbial cell is present in guerrilla warfare target construct down and the sequence that can instruct DNA to duplicate may reside in the guerrilla warfare target construct in microbial cell.Under the condition of the processing of the RNA product of the gene that is suitable for the therapeutic protein of transcribing, encode that LTR instructs and reverse transcription, cultivate the homologous recombination somatic cell then.The product of reverse transcription is the DNA construct that contains the intronless DNA copy of the therapeutic protein of encoding.It is operably connected on the DNA sequence that contains above-mentioned two foreign DNA constructs.To import in the microbial cell by the intronless DNA construct that this method is produced then.Under expression that is suitable for therapeutic protein and excretory condition, cultivate this microbial cell.

The body internal protein is produced

Homologous recombination somatic cell of the present invention can be used as colony, the colony as the elementary secondary cell of homologous recombination body, homologous recombination body clonal cell line or cell line, homologous recombination body allos cell strain or the cell line of homologous recombination somatic cell system, and uses as the cell mixture of at least a representative cell that wherein contains one of aforementioned four class homology recombinant cells.Such cell can be used for treating suffering from the therapeutic product is transmitted unusually or the not transfer system of the individuality in expectation state react, and said therapeutic product is: 1) therapeutic protein (do not have in for example individual body, under production with respect to the physiological need of individuality, individual defective or ineffectually or the protein that utilizes inadequately; The protein that new function such as enzymatic or transportation function are arranged), or 2) therapeutic nucleic acids (as inhibition of gene expression or have the active RNA of intrinsic enzymatic).In the method that therapeutic protein or nucleic acid is provided of the present invention; give suffer to be treated or prevention unusually or the individuality of the pathological state of not expecting; with homologous recombination body primary cell, clonal cell line or the allos cell strain of suitable approach use capacity, with this protein or the foreign DNA of on the physiology related levels, expressing or preparation can get.The physiology related levels is near the normal product level that produces in the body or causes unusually or product level that the state of not expecting is improved.According to embodiment of the present invention as herein described, be ready to use in individual homologous recombination body permanence cell line and can be changed in one or more semipermeable barrier devices.The penetration property of device is can stop the cell separating device after will be in implanting animal body, and the therapeutic product can freely see through and also can leave barrier device and enter the local space around the implant or enter systemic circulation.For example, can make hGH, hEPO, people's insulinotropic hormone, hGH-CSF, hG-CSF, people α phoresy and help treatment in disturbing element or people FSH β whole body in human body.

Barrier device is useful especially, and can make the homologous recombination body permanence cell that will implant, from the homologous recombination somatic cell (the external source cell of homologous recombination) of other kind, or mate the pathological state of the cell (homologous recombination body homogeneous variant cell) of donor from non-histocompatibility, or on agricultural, use (promptly being used for meat and milk production) in order to the treatment human or animal.When because any former thereby will stop to treat the time, barrier device can be by providing promptly near carry out short-term (promptly of short duration) treatment easily with the approach of removing cell.

There are many synthetic, semisynthetic or natural filter membranes all to can be used for this purpose, they comprise, but be not limited to the polymer of cellulose, cellulose acetate, celluloid, polysulfones, polyvinylidene fluoride, polyvinyl chloride polymer and polrvinyl chloride derivant.When utilizing barrier device, can make the gene therapy that also can be used for the people from elementary, the secondary or permanence cell of another kind.

External protein production

According to the present invention, also can be used for external protein production from the homologous recombination somatic cell of people or inhuman kind.Under condition known in the art, as to cause protein expression, keep cell.Be the required protein of purification, can use stated method with expressed protein with purification in cellular lysate or the cell conditioned medium liquid.The protein that makes according to this method comprises therapeutic protein, and its available conventional route of administration known in the art (as oral, intravenous, intramuscular, intranasal or approach such as subcutaneous) is transported in people or the non-human animal's body.These protein comprise hGH, hEPO and people's insulinotropic hormone, hGM-CSF, hG-CSF, FSH β or interferon-alpha.These cells can be permanence, elementary or secondary cell.When inhuman cell helps carrying out therapeutic or commercial non-human protein's protein production, can use cell from other kind, for example use the cell that derives from salmon to produce salmon calcitonin see calcimar, use derives from the cell of pig with the production Iletin II (Lilly), and uses the cattle cell with the production bovine growth hormone.

In another embodiment, the invention describes the method that in transfected elementary, secondary or permanence cell, activates the endogenous gene of (promptly opening) and the required product of amplification coding.Promptly the present invention relates to the method that imports through with the genomic DNA homologous recombination, DNA sequence is not connected with the endogenous gene function usually, and (1) when inserting it in host genome on endogenous gene or near it, be used for changing the expression of (as activating) endogenous gene, and also have (2) to allow the cell of selecting those wherein activated endogenous genes to be amplified.But being used for DNA amplification sequence of the present invention comprises, but be not limited to, but the sequence and the CAD gene (encode three functional protein carbamyl phosphate synthase, aspartate carbamyl-transferase and dihydroora tase) of coding selection marker dihydrofolate reductase, ADA Adenosine deaminase.But also can use the variant of the improvement of these sequences and other extension increasing sequence.The method according to this invention, but but with the DNA amplification sequence of coding selection marker and the DNA sequence that changes the regulatory function that endogenous gene expresses the preselected site of cellular genome import elementary, secondary in the mode that interrelates with the homologous DNA sequence of genomic DNA or the permanence cell in.This preselected site generally is within the gene of coding therapeutic product or its upstream, or on the site of the required gene function of an influence.Can be used as the unique DNA construct, or as physically becoming the separated DNA sequence that is connected transfected gene expression of cells, but but with change DNA sequence that endogenous gene expresses, coding selection marker extension increasing sequence and with genomic DNA in the preselected homologous sequence in site import in elementary, secondary or the permanence cell.In addition, can be linear, the distrand DNA that is with or without the sub-thread zone at an one end or two ends imports DNA, or with annular DNA DNA imported.After with the foreign DNA transfered cell, under the condition that homologous recombination takes place between the part of the DNA that is suitable for genomic DNA and is imported into, keep this cell.Genomic DNA and the homologous recombination that is imported between the DNA cause elementary, the secondary or permanence cell of homologous recombination body, but but sequence that the change endogenous gene is expressed in these cells and coding selection marker extension increasing sequence all are operably connected on the endogenous gene of coding therapeutic product.But the homology group group somatic cell of cultivating gained under the amplification condition of the DNA amplification of selecting the coding selection marker, but generation contains the cell of the endogenous gene of selection marker that has increased and the coamplification that has changed its expression.Can under the condition of the expression that is suitable for therapeutic protein, cultivate the cell that produces with the method, thereby, maybe cell can be used for transmit in the body therapeutic protein (being gene therapy) at external generation therapeutic protein.

The invention still further relates to the method in the genomic DNA that will hit target DNA sequence transfered cell, wherein construct comprises the foreign DNA of coded product, the marker gene of hitting target sequence and can increase, after like this in being incorporated into the genome of cell, cell contains the DNA of the coding maker that has increased and the exogenous gene of coamplification, and wherein these cells can be expressed the exogenous gene of own coamplification.

But DNA construct comprises positive selection marker, and it can be used for selecting to contain the cell that increases and copy of this sign.Such sign that increases causes the coamplification of side joint DNA sequence.In this embodiment, the order formed of construct for example can be: but but the DNA-that hits DNA-second selection marker of coding (if any) of the positive selection marker that target sequence-coding can increase be equivalent under suitable promoter control, to treat expressed exogenous gene or in the DNA sequence of having only its location with the promoter of activation endogenous gene-hit target DNA sequence.

Advantage

Methodology of the present invention, DNA construct, cell and gained protein have many-sided function and surpass many other advantages that gene hits present method therefor in the target technology.By from the useful gene of direct neighbor (directly merging mutually) to endogenous gene with the transcriptional domain of normal gene by transcriptional domain upstream 30kb or upstream end more; or the location of the diverse location in the intron of endogenous gene external source adjusting sequence, be particularly advantageous for the ability that activates endogenous gene aspect the intracellular gene expression.For example, it can be used for being positioned at usually regulating element static or gene being had the upstream or the downstream in the zone of negative regulatory function.Upstream or downstream location regulating element in such zone can be eliminated the main negative effects that this common inhibition is transcribed.In addition, can use the DNA zone that the deletion of target construct suppresses to transcribe or expression of gene is had other adverse effect usually of hitting as herein described.

In addition, because known promoter function depends on local environment to a great extent, so be suitable for the local environment of function performance and the location that can grope wide region in order to find out those.Yet, because of the ATG start codon sees (approximately per 48 base pairs occur 1) in the mammalian DNA continually, so any position of upstream region of gene simply transcriptional start and be created in correct ATG start codon before contain the transcript of long preambles sequence will hinder translating of correct gene product and information was lost efficacy because the ATG codon in such targeting sequencing, frequently occurs.Therefore, mix external source exon, splice donor site and can be randomly in the target construct containing hitting of regulatory region, a kind of intron and acceptor splicing site site, can allow to be tested and appraised that optimized site reaches the optimum expression of gene for control band, and needn't be subjected to avoid showing the restriction that unsuitable ATG start codon is applied at the mRNA that is produced.So just obvious greater flexibility is provided and has made it to activate the more gene of wide region for the location construct.DNA construct of the present invention also is useful in the fusant method of protein of making by recombinant or exogenous array and endogenous sequence coding for example.

Gene mentioned above hits target and is specially adapted to change the expression of gene (said transcript unit is sufficiently greatly to cause them to be difficult to separate and express) that forms transcript unit with amplification, or is applicable to and opens that those wherein complete protein coding regions can not obtain or as yet not by cloned genes.Therefore, above-mentioned DNA construct is applicable in a certain way the external source regulating element is operably connected on the endogenous gene, said mode is accurately to limit transcript unit, for the relative localization of external source regulating element and endogenous gene provides motility, finally enable to become one obtain and adjustment of treatment on the system of height control of valuable gene expression.

Explanation to embodiment

As described herein, the applicant has proved and can will also can be incorporated in the genome of transfected cell through homologous recombination in DNA transfered cell such as elementary, secondary or the permanence vertebrate cells.They show that further foreign DNA has the function of expection in homologous recombination body (HR) cell, and can identify correct target cell based on the detected phenotype of being given by suitable target DNA.

The applicant describes in order to the structure of the plasmid that hits particular seat in the people's gene group (HPRT seat) with based on the selection (embodiment 1a) of drug resistance phenotype.This plasmid is named is pE3Neo, and it is incorporated at the HPRT seat in the cellular genome to produce has hprt-, 6-TG resistant phenotype and also have the cell of G418 resistance.As mentioned above, by proof, be imported into the location of DNA in the exon 3 of hprt gene in the cell line set up after, they have shown and have hit at gene that pE3Neo can suitably bring into play function (embodiment 1b) in the target in the human fibroblast cell line who has set up.

In addition, applicant's proof can be used pE3Neo to carry out gene in the primary and secondary human skin fibroblast and hit target (embodiment 1c).The application proves that further the modification to the DNA end can improve the hit rate (embodiment 1c and 1e) that DNA enters genomic DNA.The applicant has also described and has hit target technology with gene and gene is inserted method (embodiment 1d) in the genome of cell such as elementary, secondary or permanence cell in the site of preliminary election.

In addition, the present invention relates to use transfected cells produce method of protein.This method comprises with the foreign DNA of coding treatment product or with being enough to hit to coding treats the DNA of endogenous gene of product and transfectional cell, as elementary cell, secondary cell or permanence cell.For example, embodiment 1g, 1h, 1j, 1k, 2,3,4 and 6-9 described by the endogenous gene of selecting being hit target with the production method of protein with changing the DNA sequence element that endogenous gene expresses.

The applicant has also described to be used to increase and has hit the DNA construct and the method (embodiment 3,6,8 and 9) of the activated endogenous cellular gene of target by gene.

Embodiment 1f～1h, 2,4 and 6 has described embodiment of the present invention, wherein change the upstream normal regulating sequence of people EPO gene, express hEPO to allow under not transfected state to reach in the elementary or secondary fibroblast strain of EPO with detectable scale.In one embodiment, the product that hits target has kept normal epo protein matter intact just, but must be under the control of mouse metal sulfur hydrochloride promoter.Embodiment 1i and 1j proof can be used and similar hit the target construct to activate the endogenous growth hormone gene in the elementary or secondary human fibroblasts.The EPO that has described in other embodiments to activating in the human fibroblasts expresses, and the product that hits the target process is chimeric transcript unit, and wherein first exon of human growth hormone gene is positioned in the upstream of EPO exon 2～5.The product of transcribing (controlled by the mouse metal sulfur hydrochloride promoter), splice and translating is a protein, and wherein the amino acid/11 of hEPO signal peptide～4 are replaced by the amino acid residue 1-3 of hGH.This proteinic telescoping part, signal peptide are being removed before the secretion from cell.Embodiment 5 has described the expressed cDNA copy (intronless) that gene (intron is arranged) is changed into this gene in order to produce, and reclaim in microorganism (as yeast or antibacterial) cell that these can express the cDNA molecule hit target construct and method.Embodiment 6 has described cell that wherein hhfr gene has been amplified and has carried out double selection and selection, names the structure into the hit target carrier of pREPO4.Plasmid pREPO4 has been used to people EPO (hEPO) seat that increases in HT 1080 cells (a kind of permanence human cell line) after activating endogenous hEPO gene by homologous recombination.As previously mentioned, substep is selected to make and is had the hEPO volume of production in the cell of resistance to increase by 70 times to 0.4 μ M methotrexate in containing the methotrexate culture medium.

Embodiment 7 and 8 has described in the upstream of normal EPO promoter and has inserted the method for regulating sequence and use such construct to produce the method for EPO.In addition, embodiment 8 has described the method for amplification by the target EPO gene of the method production of embodiment 7.Embodiment 9 has described target human alpha interferon, GM-CSF, G-CSF and FSH β gene are used for the cell of protein production with generation the method for hitting.

Embodiment provides by gene and has hit the method for target with activation or activation and amplification endogenous gene, does not wherein need to operate or use in addition the protein coding region of target gene.Use method and DNA construct or plasmid or its conspicuous for those of ordinary skills modified forms of this paper instruction; can change the characteristic (as producing medicine) that expectation has external protein production, or have the gene expression in the cell of the feature that is suitable for body internal protein transfer approach (as gene therapy).Two kinds of schemes that activate the hEPO gene are transcribed in Fig. 5 and 6 graphic extensions.

Use the conspicuous to those skilled in the art modified forms of method disclosed herein and DNA construct or plasmid or its, the foreign DNA of therapeutic product (as protein, ribozyme, antisense RNA) of can will encoding in the site of pre-selected inserts in the gene cell of the elementary or secondary cell of vertebrates (as people and non-human mammal).

Now the present invention is described by the following example, but these embodiment and not limiting the present invention in any way.

Embodiment

Embodiment 1 hits target by gene and produces transfected cell strain

Producer hits target when by homologous recombination transfection DNA being incorporated into or partly replace chromosomal DNA sequence.Though this situation may occur in the process of any specific transfection experiment, they are usually by too much being covered up by the caused plasmid DNA integration of nonhomologous or irrational regrouping process.

A. be used for the generation of selecting people's cell gene to hit the construct of target

A kind of method that the target consequence is hit in selection is to select because the gene function that integration the caused forfeiture of transfection DNA by heredity.People HPRT seat coding hypoxanthine-phosphoribosyl transferase.Can select the hprt-cell according to growing state in the culture medium that contains nucleoside analog 6-sulfenyl guanine (6-TG): have the allelic cell of wild type (HPRT+) and killed, can survive and have the allelic cell of mutant (hprt-) by 6-TG.Therefore can in the 6-TG culture medium, select to contain the cell of the target that destroys the hprt gene function.

In order to make up the plasmid that hits the HPRT seat, with HPRT sequence (Genedank title HUMHPRTB; Edwards, A.et al., Genomics 6:593-608 (1990)) in from the position 11,960～18,869 exon 2s that extend and that comprise hprt gene and 3 6.9kbHindIII fragment sub-clone in the HindIII site of pUC12.Cutting institute's DCRP and insertion contain the 1.1kb SalI-XhoI fragment from the neo gene of pMClNeo (Stratagene) on unique XhoI site in the segmental exon 3 of hprt gene, destroy the coded sequence of exon 3.Select one to have directed person and the called after pE3Neo that transcribes opposite neo transcriptional orientation with HPRT.Replace normal HPRT exon 3 with the destructive variant of neo and will produce hprt-, the 6-TG resistant phenotype.Such cell also will be the G418 resistance.

B. the gene in the human fibroblast cell line who has set up hits target

As hitting the evidence of target in permanence cell line, and determining to hit at gene that pE3Neo suitably brings into play function in the target, is HT 1080 (ATCC CCL 121) by electroporation with pE3Neo transfection human fibrosarcoma cell.

Before electroporation, HT 1080 cells are maintained and be added with the containing among the 15% calf serum DMEM (Hyclone) of HAT (hypoxanthine/aminopterin/xanthine).Electroporation a few days ago with cell transfer in the same culture medium of no aminopterin.Dilute with the trypsinization index growthing cell and in the DMEM/15% calf serum, centrifugal, and with every milliliter 13.3 * 10 ⁶The cell final volume of cell is suspended among the PBS (phosphate-buffered saline) again.Digest pENeo with HindIII, 8kb HPRT-neo fragment is separated with PUC 12 main chains, carry out purification through the ethanol precipitation of extract with phenol, and suspend again with the concentration of 600 μ g/ml.Get 50ml (30 μ g) together with 750 μ l cell suspension (10 * 10 ⁶Cell) is added in the electroporation Xiao Chi (0.4cm electrode spacing, Bio-Rad Laboratories).Electroporation conditions is 450 volts, 250 microfarads (Bio-Rad Gene Pulser; Bio-Rad Laboratories).The Xiao Chi content is added to immediately obtains every 25ml culture medium among the DMEM that contains 15% calf serum and contain 1 * 10 ⁶The cell suspension of cell.The cell suspension shop that 25ml is treated is applied in 150mm diameter tissue culture dish and at 37 ℃ and is contained 5%CO ₂Be incubated in the environment.After 24 hours, G418 solution directly is added on the plate, obtains the G418 that final concentration is 800 μ g/ml.After 5 days, replace culture medium with DMEM/15% calf serum/800 μ g/ml G418.Behind the electroporation 9 days, replace culture medium with DMEM/15% calf serum/800 μ g/ml G418 and 10 μ m 6-sulfenyl guanines.The colony that used the collection of clone's cylinder G418 and 6-TG to be had resistance in 14～16 days after the beginning double selection.

5 representative target result of experiment of hitting of carrying out in the HT1080 cell are shown in Table 1.

The number G418 of cell is handled in table 1 transfection ^rAnd 6-TG ^r

Clone's number 11 * 10 ⁷32 21 * 10 ⁷28 31 * 10 ⁷24 41 * 10 ⁷32 51 * 10 ⁷66

For transfection experiment 5, design is to determine G418 ^rThe contrast plate of the total yield of colony shows can be from initial 1 * 10 ⁷Individual processed cell produces 33,700 G418 ^rColony.Therefore, by the person of hitting to being not 66/37,700 or 1: 510 by the person's of hitting ratio.With 5 experiment joint accounts, the person's of hitting frequency is 3.6 * 10 ⁶, or account for 0.00036% of processed cell.

Restriction Enzyme and use Southern hybrid experiment that the probe be derived from neo and hprt gene carries out with neo gene mapping in the HPRT exon, give the HPRT seat of anchor point.

C. gene hits target in the primary and secondary human skin fibroblast

Digest pE3Neo with HindIII, from the pUC12 main chain, separate 8kb HPRT-neo fragment, and through extract with phenol and ethanol precipitation purification.With the concentration of the 2mg/ml DNA that suspends again.With 100 μ g HindIII pE3Neo (50 μ l), under 250 volts and 960 microfarad conditions, be 3 * 10 of 0.5ml to volume ⁶Individual secondary human foreskin fibroblast is carried out electroporation.To altogether 9 * 10 ⁶Individual processed cell carries out the transfection that separates for three times.Processed is also selected the G418 resisting cell.Every 150mm culture dish middle berth applies 500,000 cells and carries out the G418 selection.Select to cultivate after 10 days down, culture medium is changed into the human fibroblasts Nutrient medium that contains 400 μ g/ml G418 and 10 μ M 6-TG.Being used in combination two kinds of medicines continues to select 10 days again.The test under microscope plate is to locate the human fibroblasts colony that two kinds of medicines is all had resistance.G418 ^rT-TG ^rColony partly is per 9 * 10 ⁶The cell of individual processing has 4 colonies.These colonies account for 0.0001% (perhaps 1,000,000/) of all cells that can form colony.G418 is determined in design ^rThe contrast plate of the gross production rate of colony shows can be from initial 9 * 10 ⁶The cell of individual processing produces 2,850 G418 ^rColony.Therefore, the ratio to missing that hits is 4/2,850 or 1 to 712.Carry out the Southern hybrid experiment with Restriction Enzyme and the probe that is derived from neo and hprt gene, determine the HPRT seat of neo gene mapping, and prove that hitting target occurs in these four clonal cell lines to the interior site of being scheduled to of HPRT exon 3.Also by transfection primary cell (1/3.0 * 10 ⁷) separate colony to two kinds of drug resistants.

These pE3Neo hit the target result of experiment and summarize in table 2.Direct transfection or handle the pE3Neo of HindIII digestion before transfection, to produce 5 ' sub-thread ledge (seeing embodiment 1c) with exonuclease III.Test has the DNA preparation in the sub-thread zone of length from 175 to 930 base pairs.Only use a pE3neo, cut enzyme and Sou-thern hybridization analysis method identifies 1/799 G418 resistance colony (being separated to 24 clones that hit altogether) according to have the neo gene that inserts that hits on the HPRT seat by restricted through HindIII digestion.When using the 175bp ledge, hit target and be subjected to maximum stimulation (about 10 times of stimulations), 1/80 G418 ^rColony demonstrates for hitting target at the HPRT place the restriction fragment of the effect of detecting (isolating 9 clones that hit altogether).Therefore, use condition as herein described and recombinant DNA construction body, observe the target that hits in the normal person fibroblast at an easy rate, and by giving prominence to the target that hits of afterbody with containing sub-thread, press method transfection described in the embodiment 1e, can stimulate total target frequency (the clone's number that hits is the clone's of G418 resistance a sum divided by being stabilized the ground transfection) of hitting.

Table 2

In human fibroblasts, the HPRT seat is hit target PE3neo and handle each G418 of number of experiments ^rSeveral total HindIII of clone that hit that hit of clone digest 6 1/799 24175bp ledges, 1 1/80 9350bp ledges, 3 1/117 20930bp ledges 1 1/,144 1

D. the generation that is used for the construct in the gene target insertion people's gene group that treatment is useful is hit the application of target with it at gene

Can use wherein adjacent or approach neo gene place and will treat the variant that useful gene inserts the pE3Neo in the HPRT coding region, will treat the ad-hoc location in the elementary or secondary cell genome of useful gene site-directed guiding receptor.Can make up this variant that the hGH gene is hit to the pE3Neo at HPRT seat.

Digest pXGH5 (being illustrated among Fig. 3) with EcoRT, and separate the 4.1kb fragment that contains the hGH gene and connect mouse metal sulfur hydrochloride (mMT) promoter.Be used for filling the EcoRI ledge from the Klenow of escherichia coli archaeal dna polymerase fragment.Be used in the XhoI digestion pE3Neo that the joint (insert 3 ' joint in exon 3) of neo fragment and HPRT exon 3 cuts individually.Be used for XhoI protruding terminus from the Klenow of escherichia coli archaeal dna polymerase fragment filling linearization plasmid, and the gained fragment is connected on the 4.1kb blunt end hGH-mMT fragment.The single copy of analyzing on the hGH-mMT fragment with Restriction Enzyme inserts, and is pE3Neo/hGH to screen from the deutero-antibacterial colony of coupled reaction mixture, to select the hGH genetic transcription location identical with neo gene direction and name.Digest pE3Neo/hGH with HindIII, discharge the 12.1kb fragment that contains HPRT, neo and mMt-hGH sequence.Press described in the embodiment 1c and to handle through the DNA of digestion and transfection in elementary or secondary human fibroblasts.The method described in the embodiment 1c of pressing is selected G418 ^rTG ^rColony is also analyzed mMT-hGH and the decide target of neo sequence in hprt gene inserts.The hGH that commodity in use immune detection medicine box (Nichols Instit-ute) is analyzed single colony expresses.

With the secondary human fibroblasts of pE3Neo/hGH transfection, the stable hGH that analyzes thioguanine resistance colony expresses, and limiting it property enzyme and Southern hybridization analysis.13 TG that analyzed ^rIn the colony, identifying 8 has the hGH gene to be inserted into colony in the endogenous HPRT seat.All 8 bacterial strains have all stably been expressed the hGH of significant quantity, and average expression is 22.7 μ g/10 ⁶Cell/24 hour.In addition, also plasmid pE3neo EPO shown in Figure 4 can be used for the EPO gene is decided target guiding people HPRT seat.

Use homologous recombination will treat useful gene and decide lead ad-hoc location in the cell genomic dna of target, this technology can enlarge and make it more to be applicable to the product (as medicine, gene therapy) by the production for treating purpose of inserting gene, makes cellular exposure select to contain the cell of this gene copy that has increased under suitable medicament selection environmental condition by insert gene in cell.For example, can be in being directly adjacent to pE3neo/hGH the position of hGH or neo gene insert dhfr, ada or CAD gene, thereby modify pE3neo/hGH (embodiment 1d).Elementary, the secondary or permanence cell of available such plasmid transfection also identifies that the correct target of deciding inserts the result.Further with these cells of drug treating (selective agent to dhfr is a methotrexate, and the selective agent of CAD is N-(phosphoric acid acetyl group)-L-aspartic acid (PALA), is ribosidoadenine (as the nitro serine) to the selective agent of ada) of cell that are suitable for selecting to contain amplification gene of cumulative concentration.The integration of useful gene will be able to selecteed gene together with the copy of its amplification by this way by coamplification in the treatment.Therefore, can control the genetic engineering of cell at an easy rate by preselected specific site, with the gene that production for treating is used, hit wherein that the target construct is incorporated in the cellular genome in said site and the copy of amplification in this site is kept at expanded cells.

E. the modifying DNA end hits target efficient with raising

There is the evidence of several respects to show that 3 ' outstanding end participates in some homologous recombination approach of escherichia coli, phage, beer yeast and Xenopus laevis.In the xenopus oocyte cell, have the molecule that length reaches 3 ' protruding terminus of a hundreds of base pair and more promptly recombinating than the molecule that has through the very short protruding terminus (4bp) of restriction endonuclease digestion back generation after the micro-injection to the molecule of similar processing.In yeast, the rate-limiting step in the generation meiosis seemingly of 3 ' protruding terminus of this hundreds of of the length base pair reorganization.Still the evidence that is not reported and in the reorganization of people's cell, has 3 ' protruding terminus to participate in, and not expression have the adorned DNA substrate of any kind can be in office which kind of promote to hit the situation of target (a kind of form of homologous recombination) in belonging to.The experiment prompting of describing among the following example and the embodiment 1c, 5 ' outstanding end is effective for stimulating the target that hits in elementary, secondary and the permanence human fibroblasts.

Also do not hit the report of target efficient about improving by the end of modifying the transfection DNA molecule.Present embodiment is intended to illustrate by the end with the molecule of bifilar form and changes the sub-thread form into and the end of linear DNA molecule is modified, and can stimulate that the genomic target that hits inserts in the primary and secondary human fibroblasts.

Digest 1100 μ g plasmid pE3Neo (embodiment 1a) with HindIII.Can directly use this DNA behind extract with phenol and ethanol precipitation, perhaps available gel electrophoresis is isolated the 8kb HindIII fragment that only contains HPRT and neo gene from pUC12 carrier sequence.With the DNA that ExoIII digestion digest with HindIII, cause in the circumscribed hydrolytic digestion of nucleic acid widely that originates in each free 3 ' end and produce 5 ' end given prominence to.Therefore can control the degree of the circumscribed Digestion of nucleic acid and the length of gained 5 ' jag by the time that changes ExoIII digestion.The condition of recommending according to supplier digests 30 seconds, 1 minute, 1.5 minutes, 2 minutes, 2.5 minutes, 3 minutes, 3.5 minutes, 4 minutes, 4.5 minutes and 5 minutes with ExoIII with the pE3Neo of 100 μ g HindIII digestion already.In order to monitor the degree of digestion, under the condition that supplier recommends, handle the aliquot sample of the DNA that contains 1 μ g ExoIII processing on each time point with Semen phaseoli radiati (mung bean) nuclease (Promega), and through the gel electrophoresis sample separation.The same intermolecular difference in size that detects the pE3Neo untreated, that HindIII digests and handle with ExoIII and mung-bean nuclease.This magnitude difference is divided by 2 average lengths that obtain each end 5 ' ledge of molecule.At above-mentioned time point, and in 30 ℃ of digestion, the 5 ' ledge length range that is produced should be 100 to 1,000 bases.

The DNA (total HindIII digestion product of pE3Neo) that the 60 μ g ExoIII that obtain on each time point of purification handle, and under the described condition of embodiment 1c with its electroporation in elementary, secondary and permanence human fibroblasts.Calculate G418 ^r6-TG ^rThe number of colony is also compared these numbers with the target that hits that the pE3Neo of the HindIII digestion of not handling with ExoIII carries out, thus the target degree of hitting that the preparation that each ExoIII of quantitative analysis handles improves.

Also can use the effect of the quantitative 3 ' protruding terminus of similar system.In this case, under the condition that supplier recommends, handle the pE3Neo of HindIII digestion at interval with different time with phage t7 gene 6 exonucleases (Vuited Stat-es Biochemicals).Determining of digestion program (average length of each terminal 3 ' ledge that produces) is identical with the DNA that above-mentioned ExoIII handles with electroporation conditions.Calculate G418 ^r6-TG ^rThe number of colony is also compared with the colony number that pE3Neo of those HindIII digestion of handling without T7 gene 6 exonucleases hit target, the degree of hitting target that improves with the preparation of quantitatively being handled by each T7 gene 6 exonuclease.

Produce 5 ' and other method of 3 ' protruding terminus be feasible, for example, two linear molecule degeneration that partly overlap are each other also annealed and will be produced the mixture of molecule, each molecule has 3 ' ledge or at two ends 5 ' ledge is arranged at two ends, and the annealed again fragment that can not divide with initial linear molecular regime.Determine the length of ledge according to the length of non-shared DNA between two dna fragmentations.

F. be used for putting into the structure that hits the target plasmid of elementary, secondary and permanence human fibroblasts with being in human erythropoietin gene under the mouse metal sulfur hydrochloride promoter control

Following embodiment is in order to explanation one embodiment of the invention, wherein the normal positive of human forcing erythrogenin (hEPO) upstream region of gene and the negative sequence of regulating are changed, to allow expressing human erythropoietin in elementary, the secondary or permanence human fibroblasts of not expressing hEPO originally with significant quantity.

Available PCR method amplification is positioned at the zone of people EPO upstream of coding region individually.[Genbank names HUMERPA analyzing disclosed people EPO sequence; Lin, F-K, et al., Proc.Natl.Acad.Sci., USA 82:7580-7584 (1985)] three groups of primers that are used for this purpose of back design.These primers are to increasing 609,603 or the fragment of 509bp.

Table 3

HUMERPA primer location sequence fragment size Fl 2 → 20 5 ' AGCTTCTGGGCTTCCAGAC

(SEQ?ID?NO?1)R2 610→595 5′GGGGTCCCTCAGCGAC 609bp

(SEQ?ID?NO?2)F2 8→24 5′TGGGCTTCCAGACCCAG

(SEQ?ID?NO?3)R2 610→595 5′GGGGTCCCTCAGCGAC 603bpF3 21→40 5′CCAGCTACTTTGCGGAACTC

(SEQ?ID?NO?4)R2 610→595 5′GGGGTCCCTCAGCGAC 590bp

These three fragments overlap basically and can change mutually for this purpose.Will be terminal two with the connection of ClaI linker from-623 609bp fragments (HUMERPA nucleotide position 2 to 610) that extend to-14 with respect to the rotaring intertranslating start site.Digest the fragment of the ClaI connection of gained with ClaI, and be inserted in the ClaI site of pBluescriptII SK/+ (Stratagene), its direction is to make HUMERPA nucleotide position 610 adjacent with the SalI site in the many linkers of plasmid.Peculiar FspI in the fragment of people EPO upstream or SfiI site (the HUMERPA nucleotide position is respectively 150 and 405) locate to cut this plasmid p5 ' EPO respectively, and are connected on the mouse metal sulfur hydrochloride promoter.Generally the 1.8kb EcoRI-BglII fragment from the mMT-I gene [does not contain the mMT coded sequence; Hamer, D.H.and WallingM., J.Mol.Appl.Gen.1:273-288 (1982); Also can use the designed PCR primer of mMT sequence that derives from Genbank (being MUSMTI, MUSMTIP, MUSMTIPRM) by analysis, from mouse gene group DNA, separate this fragment by known method] available known method accomplishes tack with it and is connected with (also the accomplishing tack) of SfiI digestion or the p5 ' EPO of FspI digestion.Analyze institute's DCRP direction and will be wherein the former mMT BglII site be used for hitting target near those of SalI site in the many linkers of plasmid and import the primary and secondary human fibroblasts.This future orientation mMT HUMERPA nucleotide position 610 in final construction is transcribed.The resulting plasmid that is used for mMT is inserted FspI and SfiI site is called p5 ' EPO-mMTF and p5 ' EPO-mMTS.

Modify in hope, deletion and/or the negative regulating element of displacement or be positioned under the situation of enhancer of upstream of primary target sequence, additional upstream sequence is useful.Under the situation of EPO, can delete suppress EPO liver outside and kidney organize outward in the negative regulating element (Semenza, G.L.et.al., Mol.Cell.Biol.10:930-938 (1990)) of expression.A series of deletion sequence in the preparation 6kb fragment.The available zone that the active enhancer of wide host cell (as the enhancer from the huge virus of cell (CMV)) displacement disappearance is arranged.

Because the HUMERPA sequence is after its 5 ' end is positioned at BamHI (far-end) and HindIII (near-end) site, thereby can select the segmental direction of 609bp 5 ' EPO in the pBluescriptIISK/+ carrier.Therefore, available known method separates the 6bp BamHI-HindIII fragment (semenza, G.L.et.al., Mol.Cell.Biol.10:930-938 (1990)) that is normally at 609bp fragment upstream from genomic DNA.For example, the fragment of available 609bpPCR amplification is screened phage, Ke Shi plasmid or yeast artificial chromosome library as probe.Required clone will have a 6kb BamHI-HindIII fragment, and can be by its restriction map and the people EPO gene of measuring with known method restriction map are on every side compared its homogeneity of susceptible of proof.In addition, also can use the restriction map of 609bp fragment, derive between HUMERPA equivalent 2 and 609 and the segmental enzyme in BamHI site, extend through upstream identify to produce as the people's gene group upstream of probe manufacturing EPO gene; Available gel electrophoresis separates this fragment from human gene group DNA's suitable digestion product, and is connected in antibacterial or the yeast clone carrier.Correct clone will and contain a 6kb BamHI-HindIII fragment with 609bp 5 ' EPO probe hybridization.Isolating 6kb fragment is being inserted (the HindIII site is adjacent to HUMERPA nucleotide position 2 like this) among p5 ' EPO, p5 ' EPO-mMTF or the p5 ' EPO-mMTS with suitable direction.Can use known methods such as chromosome walking technology or separation to separate additional upstream sequence with the yeast artificial chromosome of 609bp 5 ' EPO probe hybridization.

Above-mentioned cloning process will allow the sequence upstream of EPO to be able to external modification, with continue after elementary, secondary or permanence human fibroblasts decided the target transfection.These methods are addressed the simple insertion of mMT promoter, and the disappearance of the disappearance of negative regulatory region and negative regulatory region and with having the displacement that the active enhancer of extensive host cell carries out.

G. activate people EPO gene and separate elementary, the secondary and permanence human fibroblasts of target with screening method

In order to hit target, use the Restriction Enzyme cutting plasmid of the insertion section of from the plasmid major key, dissociating.When cutting p5 ' EPO-mMTS, what HindIII and SalI digestion discharged 2.4kb hits the target fragment, and this fragment comprises by the 405bp of the DNA of the regulatory region that will be used to make this construct targeting people EPO gene and 204 base pairs and is attached to 5 respectively ' and the 1.8kb mMT promoter of 3 ' side.With extract with phenol and with this DNA of ethanol precipitation purification or 2.4kb single hit the target fragment and under condition described in the embodiment 1c transfection in elementary or secondary human fibroblasts.The cells transfected shop is applied in the 150mm of human fibroblasts Nutrient medium plate.After 48 hours with cell with 10,000 cells/cm ²Density shop be applied to (about 20,000 cells in every hole in the 24 hole plates; If hit the target incidence rate is per 10 ⁶But one (embodiment 1c) arranged in the individual clone cell, then need to detect 50 holes) to isolate single expression colony.Wherein the transfection DNA cell that hit the upstream, homology zone of people EPO gene will be expressed hEPO under the control of mMT promoter.After 10 days, use the EPO expression in the supernatant of the whole hole of immunity test medicine box available on the market (Amgen) detection.The use known method is isolated to derive from and is showed the cell clone that has in the synthetic hole of hEPO, generally by detection be assigned to the allos cell colony in each hole or the plate each several part, detect the each several part in these positive holes and repeat where necessary, by screening with 96 hole titer plate of 1 cell inoculation in every hole the last colony that hits that separates.Also can use the DNA that derives from whole dull and stereotyped lysate in conjunction with the mMT Auele Specific Primer that is positioned at the primer of HUMERPA nucleotide position 1 upstream by PCR with amplified fragments analysis.This primer is to the big or small dna fragmentation that should be able to increase based on this DNA sequence accurately predicting.Positive dull and stereotyped and with the dilution factor that lowers in succession bed board again with trypsinization, target cell repeats DNA preparation and PCR step in separating as needs.

Also can use the target scheme of hitting as herein described to activate permanence people cell (as HT 1080 cells (ATCC CCL 121), the strain of deriving (the ATCC CCL 2 of Hela cell and HeLa cell, 2.1 and 2.2), MCF-7 breast cancer cell (ATCC HBT 22), K-562 leukaemia (ATCC CCL 232), KB cancerous cell (ATCC CCL 17), 2780 AD ovarian cancer cells (Van der Blick, A.M.et al., Cancer Res.48:5927-5932 (1988)), Raji cell (ATCC CCL 86), Jurkat cell (ATCC TIB 152), Namalwa cell (ATCC CRL 1432), HL-60 cell (ATCC CCL 240), Daudi cell (ATCCCCL 213), RPMI 8226 cells (ATCC CCL 155), U-937 cell (ATCC CRL1593), Bowes melanoma cells (ATCC CRL 9607), MI-38VA13 subbreed 2R4 cell (ATCC CLL 75.1), MOLT-4 cell (ATCC CRL 1582) and various different hybridoma) in hGH express the purpose that is used for the hGH that common medicine transmits with production.

H. activate people EPO gene and use positive or bonded male/female selective system to separate elementary, the secondary and permanence human fibroblasts that hits

Making up p5 ' EPO-mMTF, p5 ' EPO-mMTS and their strategy that has the additional segmental derivant of upstream 6kbBamHI-HindIII can then carry out at this additional step of adjacent mMT promoter place insertion neo gene.In addition, can in the pBluescriptIISK/+ polylinker, insert a negative selection marker such as gpt (from pMSG (Pharmacia) or other appropriate sources) by HUMERPA sequence adjacent.In the previous case, separate with DNA that the Southern hybridization analysis makes from the colony gleanings and screen G418 through pcr amplification or Restriction Enzyme ^rColony is with the evaluation colony that hits.Under latter event, with G418 ^rThe integration (Besna-rd, C.et al., Mol.Cell.Biol.7:4139-4141 (1987)) of selecting the gpt gene in containing the xanthic culture medium of 6-sulfydryl with contrast is applied in the colony shop.In addition, the HSV-TK gene can be placed on and insert the opposite sides of section, select neo and stop gpt and TK by cultured cell in the human fibroblasts Nutrient medium that contains 400 μ g/ml G418,100 μ M 6-sulfydryl xanthine and 25 μ g/ml gancyclovir with permission as gpt.Dual negative selection will provide almost the consequence that truly hits and select utterly, and the Southern engram analysis will provide last confirmation.

For production is suitable for the hEPO that conventional medicine transmits, also can use the target scheme of hitting as herein described to activate at permanence people cell (as HT 1080 cells (ATCC CCL 121), the strain of deriving (the ATCC CCL 2 of Hela cell and HeLa cell, 2.1 and 2.2), MCF-7 breast cancer cell (ATCC HBT 22), K-562 leukaemia (ATCC CCL 232), KB cancerous cell (ATCC CCL 17), 2780 AD ovarian cancer cells (Van der Blick, A.M.et al., Cancer Res.48:5927-5932 (1988)), Raji cell (ATCC CCL 86), Jurkat cell (ATCC TIB 152), Namalwa cell (ATCC CRL 1432), HL-60 cell (ATCC CCL 240), Daudi cell (ATCC CCL 213), RPMI 8226 cells (ATCC CCL 155), U-937 cell (ATCC CRL 1593), Bowes melanoma cells (ATCC CRL 9607), WI-38VA13 subbreed 2R4 cell (ATCC CLL 75.1), MOLT-4 cell (ATCC CRL 1582) and various different hybridoma) in hGH express.

I. be used for being placed on the human growth hormone elementary, secondary or the structure that hits the target plasmid of permanence human fibroblasts under the control of mouse metal sulfur hydrochloride promoter

The following example is used to illustrate one embodiment of the invention, and wherein human growth hormone's normal sequence upstream is changed, to allow expressing human growth hormone in elementary, secondary or permanence human fibroblasts.

The fragment of cloned DNA that use is derived from 5 of human growth hormone N gene ' end produces and to be used to hit EPO Gene regulation district, similar to person described in the embodiment 1f target molecule that hits.The PCR primer that use designs based on analyzing the HUMGHCSA sequence in this zone is crossed over about 1.8kb fragment of HUMGHCSA (Genbank Entry) nuclear former times acid position 3787-5432 (position in the segmental EcoRI site of size has been determined in two generations easily, and said fragment can be used for the clone or the property identified digestion comprises this segmental sub-clone) with amplification.This zone extends to the upstream position of about 1.4kb of rotaring intertranslating start site 5 ' end from the middle part of hGH gene N introne 1.With EcoRI and BamHI digestion pUC12, handle producing blunt end with KLenow, and under the diluent condition recirculation, lost the plasmid in EcoRI and BamHI site.This plasmid is called as pUC12XEB.The HindIII joint is connected on the hGH fragment of amplification and, is connected on the pUC12XEB of HindIII digestion with HindIII digestion gained fragment.With EcoRI and BamHI digestion gained plasmid pUC12XEB-5 ' hGH, to remove the 0.5kb fragment that is positioned at the upstream that is right after the hGH transcriptional start site.The DNA of digestion is connected on the 1.8kb EcoRI-BglI fragment from the mMT-I gene [do not contain the mMT coded sequence; Hamer, D.H.and Walling, M., J.Mol.Appl.Gen.1:273-288 (1982); Also can use the mMT sequence that derives from Genbank according to analysis is the PCR primer that MUSMTI, MUSMTIP, MUSMTIPRM design, and presses known method and separate this fragment from mouse gene group DNA].This plasmid p5 ' hGH-mMT has the mMT promoter that is connected near on the hGH sequence both sides, upstream.

Above-mentioned clone's strategy can make the sequence upstream of hGH be modified external, so as continue after decide elementary, the secondary or permanence human fibroblasts of target transfection.This strategy has been described the simple insertion of mMT promoter.Also can give and see some other strategy, for example will have the upstream that the specific enhancer of extensive host cell is inserted into the mMT sequence of having inserted.

J. elementary, the secondary and permanence human fibroblasts that activates people hGH gene and hit with the screening technique separation

In order to hit target, use the restricted enzyme cutting plasmid of the insertion section of from the plasmid main chain, dissociating.When cutting p5 ' hGH-mMT, HindIII digestion discharges the target fragment of 2.9kb, this fragment by by the DNA side joint of regulatory region that makes this construct hit the hGH gene 5 ' and 3 ' side on 1.8kb mMT promoter form.Hit the target fragment with extract with phenol and this DNA of ethanol precipitation purification or independent 2.9kb, and under the condition described in the embodiment 11 transfection in elementary or secondary human fibroblasts.Transfected cell shop is applied in containing the 150mm plate of human fibroblasts Nutrient medium.After 48 hours, with cell with 10,000 cells/cm ²Density shop be applied to (about 20,000 cells in every hole in the 24 hole wares; If hitting the ratio of target generation is per 10 ⁶Individual swelling has 1 (embodiment 1c) in the cell, then need detect about 50 holes for separating single expression colony).Wherein the transfection DNA cell that hit the homology region upstream of hGH will be expressed hGH under mMT promoter control.After 10 days, the immune detection medicine box (Nichols) that use can be buied from market detects the supernatant in whole hole to determine the hGH expression.Use the existing synthetic clone of hGH of known method separating table from the hole, normally be assigned to the each several part of the heterogeneous population of cell in single hole or the flat board by detection, detect the each several part in these positive holes, and repeat above-mentioned steps where necessary, finally separate the colony that hits with 96 hole titer plate of 1 cell inoculation in every hole by screening.Also can use the mMT Auele Specific Primer and be used in combination the primer in the downstream that is positioned at HUMGHCSA nucleotide position 5,432, derive from the DNA of whole dull and stereotyped lysate by the PCR method analysis of amplification of DNA fragments.This primer is to the big or small dna fragmentation that should be able to increase based on the accurately predicting of this DNA sequence.Positive dull and stereotyped and with the dilution factor that reduces successively bed board again with trypsinization, repetitive DNA preparation in case of necessity and PCR step are with target cell in separating.

For producing the purpose of the hGH that conventional medicine transmits, as herein described hit the target scheme also can be used for activating hGH at the permanence cell (as HT 1080 cells (ATCC CCL 121), the strain of deriving (the ATCC CCL 2 of HeLa cell and HeLa cell, 2.1 and 2.2), MCF-7 breast carcinoma (ATCC HBT 22), κ-562 leukaemia (ATCC CCL 232), κ B cancerous cell (ATCC CCL 17), 2780 AD ovarian cancer cells (Van dar Blick, A.M.et al., Cancer Res., 48:5927-5932 (1988)), Raji cell (ATCC CCL 86), Jurkat cell (ATCC TIB 152), Namalwa cell (ATCC CRL 1432), HL-60 cell (ATCC CCL 240), Daudi cell (ATCC CCL 213), RPMI 8226 cells (ATCC CCL 155), U-937 cell (ATCC CRL 1593), Bowes melanoma cells (ATCC CRL 9607), WI-38VA13 subbreed 2R4 cell (ATCC CLL 75.1), MOLT-4 cell (ATCC CRL 1582) and various different hybridoma) in expression.

K. activate people hGH gene and use positive or bonded male/female selective system to separate elementary, the secondary and permanence human fibroblasts of hitting

The strategy that makes up p5 ' hGH-mMT can carry out the neo gene is inserted this additional step at adjacent mMT promoter place thereafter.In addition, can in the pUC12 polylinker, insert a negative selection marker such as gpt (deriving from pMSG (pharmacia) or other appropriate sources) in adjacent HUMGHCSA sequence place.In the previous case, separate with DNA that the Sout-hern hybridization analysis makes from the colony gleanings by pcr amplification or Restriction Enzyme and screen G418 ^rColony is with the evaluation colony that hits.Under latter event, with G418 ^rColony is placed on and contains the integration (Besmard, C.et al., Mol.Cell.Biol., 7:4139-4141 (1987)) of selecting the gpr gene in the xanthic culture medium of sulfydryl with contrast.In addition, the HSV-TK gene can be placed on and insert the phase counter-example face of section, select neo and stop gpt and TK by cultured cell in the human fibroblasts Nutrient medium that contains 400 μ g/ml G418,100 μ m 6-sulfydryl xanthine and 25 μ g/ml gancyclovir with permission as gpt.Dual negative selection will provide the real consequence that hits almost and select utterly.The Southern hybridization analysis then is a confirmation property.

For production is suitable for the hGH that conventional medicine transmits, also can use the target scheme of hitting as herein described to activate permanence people cell (as HT 1080 cells (ATCC CCL 121), the strain of deriving (the ATCC CCL 2 of HeLa cell and HeLa cell, 2.1 and 2.2), MCF-7 breast carcinoma (ATCCHBT 22), κ-562 leukaemia (ATCC CCL 232), KB cancerous cell (ATCC CCL17), 2780 AD ovarian cancer cells (Van dar Blick, A.M.et al., CancerRes., 48:5927-5932 (1988)), Raji cell (ATCC CCL 86), Jurkat cell (ATCC TIB 152), Namalwa cell (ATCC CRL 1432), HL-60 cell (ATCC CCL 240), Daudi cell (ATCC CCL 213), RPMI 8226 cells (ATCC CCL 155), U-937 cell (ATCC CRL 1593), Bowes melanoma cells (ATCC CRL 9607), WI-38VA13 subbreed 2R4 cell (ATCC CLL 75.1), MOLT-4 cell (ATCC CRL 1582) and various different hybridoma) in hGH express.

Can modify described in embodiment 1f and the 1i and embodiment 1g, 1h, 1j and 1k in use hit the target construct, but but to make it to comprise the amplification property selection marker (as ada, dhfr or CAD) that is used to select the cell that the endogenous gene that wherein is activated and amplification property selection marker all be amplified.Can use these cells of expressing the endogenous gene that maybe can express the coding therapeutic products to be used for the protein (as hGH and hEPO) of conventional medicine transmission or gene therapy with production.

1. use foreign DNA and alternative marker gene transfection primary and secondary fibroblast with electroporation

With trypsinization and with Nutrient medium exponential growth or fibroblast of early stage resting stage under the drip washing from the frosting.Take out the cell suspending liquid of a five equilibrium and count, carry out centrifugal remaining cell.The sucking-off supernatant also is suspended in 5ml electroporation buffer (20mM HEPES pH7.3,137mM NaCL, 5mM KCl, 0.7mM Na again with cell mass ₂HPO ₄, the 6mM dextrose) in.The recentrifuge cell, the sucking-off supernatant is suspended in cell in the electroporation buffer that contains the 1mg/ml acetylated bovine serum albumin again.Last cell suspension contains has an appointment 3 * 10 ⁶Cell/ml.Again should carry out electroporation immediately after suspending.

In the aseptic Xiao Chi (Bio-Rad) that has the 0.4cm electrode spacing, add super spirial plasmid DNA.The DNA final concentration is generally at least 120 μ g/ml.In Xiao Chi, add 0.5ml cell suspension then and (contain 1.5 * 10 approximately ⁶Individual cell), and gently mixed cell suspension and dna solution.(Bio-Rad) carries out electroporation with the Gene-Pulser device.Electric capacity and voltage fix on 960 μ F and 250～300V respectively.Along with voltage increases, cell survivaling number reduces, but the percentage ratio that has the DNA of importing stably to mix the survivaling cell in its genome then significantly increases.Under these given parameters, should observe the burst length of about 14～20mSec.

The cell that is subjected to electroporation was at room temperature kept 5 minutes, use the aseptic transfer pipette content of sucking-off Xiao Chi lightly then.Cell directly is added in the Nutrient medium (the same, but be added with 15% calf serum) of the 10ml preheating in the 10cm plate and carries out incubation as mentioned above.Second day former culture medium of sucking-off, and change the 10ml fresh culture into and continued incubation 16～24 hours.Second day again clone cell to determine cloning efficiency and to select G418 resistance colony.Use trypsin digestion and cell, counting and bed board; Be generally and determine that cloning efficiency is with 10 ³Fibroblast is applied in cell/10cm plate shop; Select then with 1～2 * 10 for carrying out G418 ⁴Fibroblast is applied in cell/10cm plate shop.

(Geneticin renders a service about 50% dithionate containing 300～400 μ g/ml G418; Gibco) select G418 resistance human fibroblasts in the fibroblast Nutrient medium (containing 15% calf serum).Do not having to determine cloning efficiency under the condition of G418.With bed board cell incubation 12～14 days, use the formalin colony between at this moment, with violet staining and counting (determining the cloning efficiency of bed board) or use clone's cylinder to separate (G418 flat board).Electroporation to rabbit fibroblast is identical with human fibroblasts basically with selection, only is to use different alternative conditions, selects the rabbit fibroblast to the G418 resistance in the culture medium that contains 1gm/ml G418.

From people's foreskin of new cutting-out, be separated into fibrocyte.Density inoculated and cultured thing in the DMEM+10% calf serum with 50,000 cells/cm.When culture converges, also use the electroporation transfection through trypsin treatment results fibroblast.Through estimating electroporation conditions through transfection with plasmid pcDNEO (Fig. 5).Use is near optimum condition (60 μ g plasmid pcDNEO, 250 volts of electroporation voltages, electric capacity fixes on 960 μ F) carry out the experiment of representational electroporation, per 588 the processed cells of result produce 1 G418 colony (all processed cells 0.17%), but or per 71 clone cells produce 1 G418 colony (1.4%).

When under optimum condition (60 μ g plasmid pcDNEO, 300 volts of electroporation voltages, electric capacity fix on 960 μ F) almost, advancing nine independent electroporations experiments, average per 1, observe 1 G418 colony (0.05%) in 899 processed cells, scope is 1/882 to 1/7,500 processed cell.But this is equivalent to per 38 clone cells 1 G418 colony (2.6%) is arranged on average.

Change the hGH express cell through making to pass at the low into for the primary human fibroblast with plasmid pcDNEO and pXGH5 cotransfection.Generally be to carry out transfection with molar mixtures such as 60 μ g, two plasmids down at nearly optimum condition (electroporation voltage is 300 volts, and electric capacity fixes on 960 μ F).Experimental result is that per 14,705 processed cells produce 1 G418 colony.

The hGH expression data of isolating these and other cell is summarized as follows under identical transfection conditions.At last, all G418 ^r98% of colony can be expanded to produce a large amount of cultures.The G418 that analyzes ^rClone's number 154G418 ^rThe number 65 average hGH expression 2.3 μ g hGH/10 of/hGH expression cloning ⁶The maximum hGH expression of cell/24hr 23.0 μ g hGH/10 ⁶Cell/24hr

Elementary or secondary human fibroblasts also can produce stable transfection body by electroporation transfection to use wherein neo and hGH gene to be present in DNA construct pXGH301 on the same plasmid molecule.Make up pXGH301 with two step methods.From pBR322, separate SalI-ClaI fragment (position 23～651 among the pBR 322) and be inserted among the pcDNEO of SalI-ClaI digestion the upstream, BamHI site in the SV40 early promoter zone of importing pcDNEO.Digest this plasmid pBNEO with BamHI, separation contains the 2.1kb fragment that is in the neo gene under the control of SV40 early promoter and inserts among the pXGH5 of BamHI digestion.Separate and have the plasmid that single 2.1kb BamHI fragment is inserted, wherein neo and hGH transcribe with mutually the same direction.This plasmid is called as pXGH301.For example with 60 μ g pXGH301 electroporation 1.5 * 10 under 300 volts and 960 μ F conditions ⁶Individual cell.With per 1.5 * 10 ⁶The frequency of 652 G418 resistances of individual processing cell colony (handling 1 colony of cell for per 2299) is separated G418 resistance colony from transfected secondary fibroblast.Have 59% to express hGH in these colonies approximately.

Embodiment 2 make up produce chimeric transcription units hit the target plasmid, merging in the chimeric transcription unit has human growth hormone and erythropoietin sequence

Following embodiment is used to illustrate two other embodiment of the present invention, wherein the normal regulating sequence upstream of people EPO gene is changed, but to allow under its former not transfected state, not expressing hEPO in the elementary or secondary fibroblast cell strain with detection limit expression hEPO.In these embodiment schemes, the product that hits target is a chimeric transcription unit, and wherein first exon of human growth hormone gene is positioned at the upstream of hEPO exon 2～5.The product of transcribing, splicing and translate is the protein that amino acid/11～4 of wherein hEPO signal peptide are replaced by the amino acid residue 1～3 of hGH.With regard to the relative position of the external adjusting sequence that is inserted into for producing the required specificity connecting method of final, processed transcript, these two embodiments are different.

Design plasmid pXEPO-10 hits the exons 1 that target is used the exons 1 displacement hEPO of hGH to carry out gene by the endogenous hEPO gene to human chromosome 7.Make up plasmid pXEPO-10 as follows.At first, the 6kb HindIII-BamHI fragment (referring to embodiment 1f) that will be positioned at the hEPO upstream of coding region insert the pBluescri-ptIISK+ of HindIII-BamHI digestion (Stratagene, LaJolla, CA) in and make up intermediate plasmid PT163.Digest the product of this coupled reaction and be connected to from pMClneoPolyA[Thomas K.R.and Capecchi, M.R.Cell 51:503-512 (1987) with XhoI and HindIII, can derive from Stategene, LaJolla, CA] 1.1kb HindIII-XhoI fragment on, to produce pT163.Utilize oligonucleotide 13.1～13.4 to merge fragment to produce one in polymerase chain reaction, wherein mouse metal sulfur hydrochloride I (mMT-I) promoter-hGH exons 1 sequence is fused on the hEPO introne 1 sequence extraly.At first, with oligonucleotide 13.1 and 13.3 with the mMT-I promoter-hGH exons 1 fragment of about 0.73kb that increase from pXGH5 (Fig. 5).Then, about 0.57kb fragment of mainly forming with oligonucleotide 13.2 and 13.4 amplifications by hEPO introne 1 among the human gene group DNA.At last, mixing two fragments that increased also further increases to produce last fusion fragment (merging fragment 3) with oligonucleotide 13.1 and 13.4, this merges the 5 ' side SalI site side joint of fragment in the mMT-I part, and at 3 ' side XhoI site of hEPO introne 1 sequence side joint.Merge fragment 3 and be connected to the pT163 that XhoI digests with XhoI and SalI digestion.This is connected mixture is transformed in the escherichia coli, and identify that containing merge fragment 3 single inserts the clone of section and name and be pXEPO-10, in described fusion fragment 3 in 3 of hEPO introne 1 sequence ' stress newly to have produced XhOI site.13.1 5′TTTTGTCGAC?GGTACCTTGG?TTTTTAAAAC?C

SalI KpnI

(SEQ?ID?NO?5)13.2 5′CCTAGCGGCA?ATGGCTACAG?GTGAGTACTC?GCGGGCTGGG?CG

(SEQ?ID?NO?6)13.3 5′CGCCCAGCCC?GCGAGTACTC?ACCTGTAGCC?ATTGCCGCTA?GG

(SEQ?ID?NO?7)13.4 5′TTTTCTCGAG?CTAGAACAGA?TAGCCAGGCT?G

XhoI

(SEQ?ID?NO?8)

The territory, non-black-body block of oligomer 13.1 is identical with the mMT-I promoter, has the natural KpnI site as its 5 ' border.The boldface font representative is to be the SalI site afterbody in SalI site with 5 ' boundary transition.Oligomer 13.2 and 13.3 boldface type Regional Representative hGH sequence, but not the boldface type zone is the introne 1 sequence from the hEPO gene.The territory, non-black-body block of oligomer 13.4 is identical with last 25 bases of hEPO introne 1.The boldface type zone comprises that 3 ' boundary transition with amplified fragments is the XhoI site afterbody in XhoI site.

Design plasmid pXEPO-10 places endogenous hEPO seat on the human chromosome 7 to hit target by gene with the mMT-I promoter of the hGH upstream of hEPO structural gene and promoter region and exons 1.Make up plasmid pXEPO-11 as follows.Utilize oligonucleotide 13.1 and 13.5～13.7 to merge fragment to produce one in polymerase chain reaction, mouse metal sulfur hydrochloride I (mMT-I) promoter-hGH exons 1 sequence is fused on the hEPO sequence with respect to hEPO coding region from-1 to-630 extraly in this fragment.At first, increase from about 0.75kb mMT-I promoter-hGH exons 1 fragment of pXGH5 (Fig. 5) with oligonucleotide 13.1 and 13.6.Then, with oligonucleotide 13.5 and 13.7 amplifications from the human gene group DNA, with respect to about 0.65kb fragment of mainly forming of hEPO coding region by from-1 to-620 hEPO sequence.Oligonucleotide 13.5 and 13.6 all contains the 10bp joint sequence that is positioned at hGH introne 1-hEPO promoter region, and it is equivalent to natural hEPO introne 1 splice donor site.At last, mix two fragments that increased and further use oligonucleotide 13.1 and 13.7 amplifications, to produce last fusion fragment (merging fragment 6), 5 ' side SalI site of this fragment side joint mMT-I part, and 3 ' side XhoI site of side joint hEPO promoter region.Merge fragment 6 and be connected on the PT163 of XhOI digestion with XhoI and SalI digestion.To connect mixture and be transformed in the escherichia coli, and identify and contain the single clone who inserts section of merging fragment 6, and name and be pXEPO-11, in the said fusion fragment 6, on 3 ' side of hEPO promoter sequence, produce the XhoI site again.13.5 5′GACAGCTCAC?CTAGCGGCAA?TGGCTACAGG?TGAGTACTC

AAGCTTCTGG?GCTTCCAGAC?CCAG?(SEQ?ID?NO?9)

HindIII13.6 5′CTGGGTCTGG?AAGCCCAGAA?GCTTGAGTAC?TCACCTGTAG

HindIII

CCATTGCCGC?TAGGTGAGCT?GTC(SEQ?ID?NO?10)13.7 5′TTTTCTCGAG?CTCCGCGCCT?GGCCGGGGTC?CCTC

XhoI

(SEQ?ID?NO?11)

The hGH sequence is represented in oligomer 13.5 and 13.6 black matrix block.The zone of italics is equivalent to preceding 10 base pairs of hEPO intron.The oligomer remainder is equivalent to the hEPO sequence of from-620 to-597 (being equivalent to the hEPO coding region).The territory, non-black-body block of oligomer 13.7 with respect to the base-1 of hEPO coding region to-24 identical.The boldface type zone comprises that the segmental 3 ' boundary transition that will increase is the XhoI site afterbody in XhoI site.

Available BamHI and XhoI digested plasmid pXEPO-10 hit target to discharge the 7.3kb fragment (wherein said fusant is in its both sides side joint hEPO sequence) that contains the mMT-I/hGH fusant and this plasmid is used for gene.This fragment (hitting target fragment 1) does not contain the hEPO coded sequence, only is positioned at-620 peace treaty-6620 sequences of the upstream of hEPO coding region and hEPO introne 1 sequence, to instruct people EPO seat is hit target.Use the condition of similarity described in the embodiment 1c, will hit 1 transfection of target fragment in the primary and secondary human skin fibroblast.G418 resistance colony is inoculated in each holes of 96 hole flat boards and with ELISA method (R ﹠amp; D system, Minnea-polis, MN) screening is to express EPO.Wherein the transfection DNA random integration can not produce EPO to the cell in the people's gene group.Wherein transfection DNA contains a mosaic gene with the cell of endogenous hEPO introne 1 and hEPO upstream sequence generation homologous recombination, and mMT-I promoter and the sequence of not transcribed and hGH 5 ' do not translate sequence and the hGH exons 1 has replaced normal hEPO promoter and hEPO exons 1 (see figure 1) in this gene.Hit non-hEPO sequence in the target fragment 1 and be connected to the hEPO sequence in hEPO introne 1 downstream.To activate EPO gene in the fibroblast of not expressing hEPO under the normal condition with the normal hEPO regulatory region of mMT-1 promoter replacement.Replace the hEPO exons 1 with the hGH exons 1 and then produce the protein that preceding 4 aminoacid of hEPO signal peptide are wherein replaced by the amino acid/11 of hGH～3, form a functional chimeric signal peptide, this signal peptide is removed and makes it to secrete from express cell when translating post-treatment from mature protein.

Hit target by making plasmid pXEPO-11 be used for gene, to discharge the 7.4kb fragment that contains the mMT-I/hGH fusant of side joint hEPO sequence on its both sides with BamHI and XhoI digestion.This fragment (hitting target fragment 2) does not contain the hEPO coded sequence, and only has the sequence of between upstream-1 peace treaty-6620 that is positioned at the hEPO coding region, to instruct people EPO seat is hit target.Use and to hit 2 transfections of target fragment in the first utmost point or secondary human skin fibroblast to condition similar described in the embodiment 19.G418 resistance colony is collected in the single hole of 96 hole flat boards, and with ELISA detection method (R ﹠amp; D system, Minneapolis, MN) screening has the colony that EPO expresses.Wherein the transfection DNA random integration can not produce EPO to the cell in the people's gene group.Wherein transfection DNA contains a mosaic gene with the cell of endogenous hEPO promoter and upstream sequence generation homologous recombination, in this gene the mMT-1 promoter and not transcription sequence, hGH5 ' do not translate sequence and hGH exons 1, and be inserted in the HindIII site (referring to Fig. 2) that is positioned at respect to the position-620 of hEPO coding region by 10 base pair joints of preceding 10 base compositions of hEPO introne 1.The mMT-I promoter located upstream of normal static hEPO promoter will in elementary or secondary skin flbroblast, instruct signal read sign indicating number (5 ' to 3 ') do not translate metallothioneins and hGH sequence, hGH exons 1, with the hEPO introne 1 before 10 10 DNA bases that base pair is identical, and the synthesizing of normal hEPO promoter and hEPO exons 1 (be equivalent to hEPO coded sequence-620 to+13).As splice donor site the hGH exons 1 is fused to from 10 base pair joint sequences of hEPO introne 1 and is positioned at the acceptor splicing site site, next downstream that is right after hEPO exon 2 upstream.Therefore, the processing of gained transcript is fallen hEPO promoter, exons 1 and introne 1 sequence with splicing.To produce the protein that a kind of preceding 4 aminoacid of wherein hEPO signal peptide replace with hGH amino acid/11～3 with hGH exons 1 displacement hEPO exons 1, one of this replacement formation be removed from mature protein by translating post-treatment and from express cell by excretory functional chimeric signal peptide.

Utilize known method can make up a series of constructs relevant with pXEPO-10 and pXEPO-11.In these constructs, the relative position of mMT-1 promoter and hGH sequence, and the position of mMT-1/hGH sequence insertion hEPO upstream sequence changes, thereby produce selectable, be convenient to the mosaic type transcript unit that gene hits target, cause merging the more effective expression of transcript, perhaps other required characteristic of tool.This class construct will produce similar result, so the hGH-hEPO fusion gene is placed in by gene and hits under the regulation and control of the exogenous promoter that target to normal hEPO gene location produced.For example, the 6kb HindIII-BanHI fragment (referring to embodiment 1f) of hEPO upstream region of gene has and manyly can merge the Restriction Enzyme recognition sequence in segmental site as inserting neo gene and mMT-1 promoter/hGH.The BglII site that is positioned at the HindIII site about 1.3kb in upstream is a said site, it is unique in this zone, and can be used for inserting one or more selected markers and will be used to activate the regulatory region of the gene that hEPO expresses from another kind in elementary, secondary or permanence people cell.

At first, insert the pBluescriptIISK+ that digested by HindIII-BamHI (St-ratagene, LaJolla, interstitial granules pT164 CA) and in making up by the 6kb HindIII-BamHI fragment (embodiment 1f) that will be positioned at the hEPO upstream of coding region.With BamHI and XhoI digested plasmid pMClneoPloyA[Thomas, K.R.and Capecchi, M.R.Call 51:503-512 (1987); Can derive from Stratagene, LaJolla, CA], handle to make it to become blunt end with the KLenow fragment of e. coli dna polymerase, and the 1.1kb fragment of purification gained.PT164 digests with BglI, and becomes blunt end through the processing of the Klenow of E.coli archaeal dna polymerase fragment.Connect above-mentioned two blunt end fragments, and be transformed among the competent E.coli.Separate and have the segmental single clone who inserts section of 1.1kb neo, and analyze with the Restriction Enzyme analytic process, are the clones that are arranged in the unique HindIII site 1.3kb that exists apart from plasmid pT164 to determine that those wherein merge the BglI sites that rebuild by tack Xhol and BgIII site.So far can be at the plasmid pT165 of the unique BglII site cracking gained that is positioned at neo transcript unit 5 ' flank.

Oligonucleotide 13.8 and 13.9 be used in the polymerase chain reaction with produce one wherein have mouse metal sulfur hydrochloride I (mMT-I) promoter-hGH exons 1 sequence in addition also with the fragment of the 10bp fragment fusion that contains splicing-donor site.Although have a large amount of splicing-donor sites or total splicing-donor site to be used, selected splicing-donor site is equivalent to natural hEPO introne 1 splicing-donor site.Oligonucleotide (13.8 and 13.9) the about 0.73kb mMT-1 promoter-hGH exons 1 fragment (Fig. 5) that is used to increase from pXGH5.Digest the fragment (fragment 7) that is amplified with BglII, and be connected with the pT165 that digests through BglII.Connecting mixture is transformed among the E.coli, evaluation contains the single clone who inserts section of fragment 7, wherein, KpnI site in the mMT-1 promoter is adjacent to 5 of neo gene ' end, and the mMT-1 promoter is wanted so that transcribe direction location towards unique HindIII site, and this clone is named as pXEPO-12.13.8 5′AAAAAGATCT?GGTACCTTGG?TTTTTAAAAC?CAGCCTGGAG

BglII KpnI

(SEQ?ID?NO?12)

The non-black-body district of oligomer 13.8 is equal to the mMT-1 promoter, is its 5 ' border with natural KpnI site.The black matrix type represents with 5 ' boundary transition to be the BglII site tail in BglII site.13.9 5′TTTTAGATCT?GAGTACTCAC?CTGTAGCCAT?TGCCGCTAGG

BglII

(SEQ?ID?NO?13)

The black matrix district of oligomer 13.9 represents the hGH sequence.The italic block is equivalent to preceding 10 base pairs of hEPO introne 1.The BglII site that adds line is to make up the usefulness of plasmid.

Plasmid pXEPO-12 is used to gene, and to hit target be by with BamHI and HindIII digestion, contains by the 7.9kb fragment of hEPO sequence side joint in the neo of both sides gene and mMT-1/hGH fusant to discharge.This fragment (hitting target fragment 3) does not contain the hEPO coded sequence, and the sequence that only contains between hEPO upstream of coding region about-620 to about-6620 is hit target to instruct to people EPO gene locus upstream.Use is similar to the condition described in embodiment 1b and the 1c will hit 3 transfections of target fragment in the human skin fibroblast of elementary, secondary or permanence, collect G418 resistance colony in each hole of 96 hole flat boards, and with ELISA algoscopy (R ﹠amp; DSystems, Min-neapolis MN) screening EPO expresses.Have the transfection DNA random integration and can not produce hEPO to the cell of people's gene group, the DNA of transfection and endogenous hEPO promoter and upstream sequence carry out the cell of homology group, contain a mosaic type gene, in this mosaic type gene, mMT-1 promoter and non-transcribed sequence, hGH 5 ' do not translate sequence, hGH exons 1 and are inserted in the BglII site that is positioned at about-1920 positions relevant with the hEPO coding region with 10bp joint by preceding 10 base compositions of hEPO introne 1.Synthetic following message content will be instructed in elementary, secondary or permanence human fibroblasts (or other people's cell) in the location of the mMT-1 promoter of normal immobilized hEPO promoter upstream: the metallothioneins that does not translate (5 ' → 3 ') and hGH sequence, hGH exons 1, DNA 10 bases identical with preceding 10 base pairs of hEPO introne 1 and hEPO upstream and hEPO exons 1 (with the EPO coded sequence relevant about-1920～+ 13).10bp joint sequence from the hEPO introne 1 plays splicing-donor site effect, so that the hGH exons 1 merges with the downstream splicing-acceptor site that is in close proximity to hEPO exon 2 upstream.Therefore, the processing of gained transcript is fallen hEPO upstream sequence, promoter region, exons 1 and introne 1 sequence with splicing.When use pXEPO-10 ,-11 and-12 the time, the improvement of transcribing the post-treatment process of information, can be undertaken by utilizing the in vitro mutagenesis method, to remove the acceptor splicing site site in the hEPO upstream sequence between mMT-I promoter and hEPO exons 1, this can reduce the degree that produces the necessary productivity splicing of information needed phenomenon.Substitute the hEPO exons 1 with the hGH exons 1 and produce protein, wherein the amino acid/11 of hGH～3 have replaced preceding 4 aminoacid of hEPO signal peptide, the mosaic type signal peptide of systematic function, and this signal peptide is removed from sophisticated protein owing to the course of processing after translating, and by secreting in the express cell.

The amplification of the hit modification and the target gene of embodiment 3 upstream sequences

Contain because of the gene amplification phenomenon and can give its marker gene if hit the target plasmid, then just can induce wherein people's cell by the activated hEPO gene of preceding method with amplification neo/mMT-1/EPO transcript unit to high-level cytotoxic factor resistance.The marker gene that can screen such as dihydrofolate reductase (dhfr, selective agent are methotrexates), multi-functional CAD gene [encoding carbamoyl phosphate synthetase, aspartate transcarbamylase base enzyme and dihydro milk surum enzyme (orotase); Selective agent is N-(phosphono-acetyl group)-L-aspartic acid (PALA)], glutamine synthetase [selective agent is first sulfonyl ammonia sulphoximine (MSX)] and adenosine deaminase (ada; Selective agent is a ribosidoadenine) existing document record (Wright, J.A.et al, the Proc Natl.Acad.Sci.USA 87:1791-1795 (1990) in other gene that in the human cell line of permanence, can increase; Cockett, M.I.et al., Bio/Technology 8:662-667 (1990)).In these researchs, record gene amplification betides among many permanence human cell lines.Under suitable screening conditions, HT 1080, the Hela in other cell, MCF-7 breast cancer cell, K-562 leukaemia, KB cancerous cell or 2780 AD ovarian cancer cells show amplified reaction.

Plasmid pXEPO-10 and pXEPO-11 can be modified by the dhfr gene that inserts a normal or sudden change in unique HindIII site of these plasmids.With suitable DNA transfection HI 1080 cells, screen its G418 resistance (giving) and identify that hEPO gene is wherein carried out that gene hits target and behind the activated cell by neo, dhfr and mMT-1 sequence to the tram of hEPO upstream region of gene by the neo gene, these cells can be placed in the methotrexate (MTX) and screen step by step with the amplification of screening dhfr and the common amplification (Kaufman, R.J.Technique 2:221-236 (1990)) of connected neo, mMT-1 and hEPO sequence.In the substep screening scheme that is adopted, cell at first contacts with low concentration MTX (0.01～0.08 μ M), and is cumulative until 250 μ M or higher MTX Continuous Contact with concentration subsequently.Though it also is effectively that the low relatively increment of MTX concentration changes, the linear incremental step of 0.04～0.08 μ M MTX and MTX concentration is duple continuously, and to be increased in the transfectional cell series of screening amplification will be favourable.Amplified reaction is monitored in increase by the dhfr gene copy number, and expresses by the outer hEPO of detection bodies and to confirm.By means of above-mentioned strategy, by obtaining hEPO expression in fact over one's competence to the modification that hits that is positioned at the sequence outside the hEPO coding region fully.

In order to hit the cell that target non-coding sequence and amplified reaction subsequently obtain overexpression hGH gene by gene, be similar to (embodiment 1f, 1h, 1i, 1k, 2 and 7) as herein described and also can be made it to comprise the dhfr gene in people's cell by further the modification with the construct that activation hGH expresses.

Embodiment 4 hits target and activates people EPO gene locus in the permanence human fibroblast cell line

The hypothesis that target construct pXEPO-13 can be activated with test endogenous hEPO gene is hit in preparation in human fibroblasts.At first, make up plasmid pT22.1, it contains the 63bp genome hEPO sequence of first codon upstream of the hEPO gene that merges with mouse metal sulfur hydrochloride-1 promoter (mMT-I).Oligonucleotide 22.1 to 22.4 is used among the PCR to merge mMT-I and hEPO sequence.The characteristic of these primers is as follows: 22.1 is oligonucleotide of one 21 base, the 28bp fragment homology that begins with the mMT-I promoter of upstream, mMT-IKpnI site; 22.2 and 22.3 are complementary primers of 58 nucleotide, they determine the fusant of hEPO and mMT-I sequence, make the 28bp of 35 bases that hEPO sequence that this fusant contains first codon upstream of hEPO gene begins, with the mMT-I sequence of the base 29 that starts from oligonucleotide 22.2, it comprises the natural B glII site of mMT-I and extends to 30 bases of mMT-I sequence; 22.4 be long 21 nucleotide, and the 725bp homology that begins with the hEPO sequence in the downstream of first codon of hEPO gene.These primers are used to increase and contain the 1.4kb dna fragmentation of above-mentioned mMT-I and hEPO sequence fusant.With the fragment (this PCR fragment contains two KpnI sites: the single natural KpnI site of mMT-T promoter region and the single natural KpnI site in the hEPO sequence) of KpnI digestion gained, and carry out purification.Plasmid pXEPOI also with KpnI digestion, discharges a 1.4kb fragment and a 6.4kb fragment.Purification 6.4kb fragment, and merge fragment with 1.4kb KpnI PCR and be connected.The construct of gained is called pT22.1.The structure of second middle interstitial granules pT22.2 is pBSIISK+ (Stratagene, LaJolla, CA) connection by about 6kb HindIII-BamHI fragment (referring to embodiment 1f) that will be positioned at hEPO structural gene upstream and BamHI and HindIII digestion.Make up the 3rd middle interstitial granules pT22.3 and be at first from the pMCINEpolyA that contains neomycin phosphotransferase gene (Stratagene, LaJolla, CA) in the XhoI/BamHI fragment of a 1.1kb of excision.Using the Klenow fragment (New England Biolabs) of dna polymerase i that above-mentioned fragment is made tack does not then hold.Again this fragment is connected to the HincII site (also making tack with dna polymerase i similarly) of pBSIISK+ and obtains pT22.3.The preparation of the 4th middle interstitial granules pT22.4 is by the 1.1kb XhoI/HindIII fragment that contain neo gene of purification from pT22.3, and this fragment is linked to each other with pT22.2 through XhoI and HindIII digestion.Therefore pT22.4 contains the neo gene adjacent with the HindIII side of hEPO fragment upstream BamHI-HindIII.At last, obtain pXEPO-13 by at first from pT22.1, excising 2.0kb EcoRI/AccI fragment.5 ' border of mMT-I promoter has been determined in this segmental EcoRI site, and this segmental AccI site then is arranged in hEPO exon 5.Therefore, this AccI/EcoRI fragment contains almost complete hEPO ceneme except the part and natural polyadenylation site that only lack exon 5.The above-mentioned 2.0kb EcoRT/AccI of purification fragment is handled with the Klennow fragment of dna polymerase i and to be made blunt end, is connected with pT22.4 through XhoI digestion and blunt endization then.

With pXEPO-13 transfection HT 1080 cells through PvuI-BamHI digestion.The pXEPO-13 of digestion produces three fragments in this way: the 1kb carrier segments that comprises the amp Gene Partial; The 1.7kb fragment of the carrier sequence that stays and the about 9kb fragment that contains hEPO, neo and mMT-I sequence.Described about 9kb BamHI/PvuI fragment is begun to contain following sequence successively by the BamHI site: about 5.2kb of hEPO genome sequence upstream, 1.1kb noe transcript unit, 0.7kb mMT-I promoter and contain the 2.0kb fragment of the hEPO coded sequence of truncate in exon 5.45 μ g are used to 1.2 * 10 through the pXEPO-13 of said method digestion ⁷In the electroporation of cell (condition of electroporation is described among the embodiment 1b).This electroporation process repeats 8 times altogether, forms altogether 9.6 * 10 ⁷The electroporation of cell.Cell mixes to produce 1 * 10 with culture medium ⁶The cell density of cell/ml, the sample aliquot of getting 1ml are dispensed to altogether in 96 150mm tissue culturing plates (Falcon), and each contains the MIN DMEM/15% Ox blood serum of 35ml.Second day,, and change old culture medium with the fresh culture that contains 0.8mg/ml G418 (Gibco) with the culture medium sucking-off.Cultivate after 10 days, with elisa assay (R ﹠amp; D Systems) hEPO in the culture medium of each culture plate of sample analysis.There are 6 to contain 10mU/ml hEPO at least in 96 flat boards.Select in these culture plates, promptly No. 18 plate expressed colony with purification hEPO.Each 150mm culture plate of 96 plates contains 600 the G418 resistance colonies of having an appointment (on 96 all flat boards, estimating always to have 57,600 G418 resistance colonies).About 600 colony trypsin treatment on No. 18 culture plates, and with the density of 50 cell/ml again bed board go in 364 orifice plates (Steril-in).After cultivating a week, in each macropore of 364 orifice plates, there are 10 colonies can individually see (these culture plates by form by 16 apertures in each macropore of 24 macropores) approximately.The expression that screen hEPO in each hole this moment.Include the culture medium that has 20mU/ml hEPO at least in two macropores.In the A2 hole, find to contain 15 colonies that are distributed in 16 apertures.Content in each these aperture is all used trypsin treatment, and transfer in 16 independent holes of 96 culture plates.After cultivating 7 days, the hEPO elisa assay is carried out in sampling from these every hole culture medium.Have only a hole (No. 10 holes) to contain HEPO.This cell strain is named as HT165-18A2-10, makes it breed in cultivation that quantitative hEPO analyzes to carry out, RNA separates and separates with DNA.The detection by quantitative result of hEPO productive rate is 2,500,000,000 units/10 ⁶Cell/24 hour.

Be used to survey isolated RNA from the HT165-18A2-10 cell by the AccI site to 3 in the hEPO exon 5 ' non-0.2kb dna probe of translating the BglII site in district.Do not contained these ACCI/BglII sequences in the AccI of exon 5 site by the target construct pXEPO-13 that hits of truncate, therefore, this construct has judgement for the target that hits at the hEPO gene locus.Only the cell strain of recombinating with homology mode and natural hEPO sequence can produce the hEPO mRNA that contains with the sequence of AccI/BglII sequence homology.Found HTl65-18A2-10 be expressed in the Northern trace with ³²The mRNA of the pre-sizing of the AccI/BglII hEPO probe hybridization of P labelling.Restriction Enzyme and Southern engram analysis confirm that neo gene and mMT-I promoter are hit on the seat of one of target to two hEPO allele in the HT165-18A2-10 cell.

The above results shows, can a regulatory region be hit on target to a gene that remains static in human fibroblasts usually with homologous recombination, thereby cause the functional activation of this gene.22.1 5′CACCTAAAAT?GATCTCTCTG?G(SEQ?ID?NO?14)22.2 5′CGCGCCGGGT?GACCACACCG?GGGGCCCTAG?ATCTGGTGAA

GCTGGAGCTA?CGGAGTAA (SEQ?ID?NO?15)22.3 5′TTACTCCGTA?GCTCCAGCTT?CACCAGATCT?AGGGCCCCCG

GTGTGGTCAC?CCGGCGCG?(SEQ?ID?NO?16)22.4 5′GTCTCACCGT?GATATTCTCG?G?(SEQ?ID?NO?17)

The gene of embodiment 5 preparation intronlesses

Gene hits target and also can be used to prepare the gene that does not contain intron after processing, carries out gene expression and external protein production in yeast or the antibacterial to transfer to.For example, utilize following method to produce hGH by yeast.

Prepare two isolating target constructs that hit.Hit target construct 1 (TC1) and comprise the one section retroviral LTR sequence LTR of Moloney Murine leucovirus (MoMLV) (for example from), one is used for the marker gene (as the neo gene from Tn5) of screening at people's cell, one is used for the marker gene (as yeast URA3 gene) of screening at yeast, energy in yeast, instruct gene expression regulatory region (as the GAL4 promoter) and can be randomly one section sequence (targeting sequencing) that when with the hGH gene fusion, can make yeast cells secretion hGH.This carrier can comprise that also permission carries out the DNA sequence of retrovirus packing in people's cell.Set up above-mentioned construct make above-mentioned sequence by hGH genome sequence side joint in both sides, when carrying out homologous recombination with genome hGH gene N sequence, this hGH genome sequence will be integrated exogenous array in hGH gene N codon 1 (corresponding to sophisticated, processed proteinic 1 amino acids) is right after the TCI of upstream.The order of the DNA sequence in the integration is: the downstream sequence of hGH upstream and adjusting sequence, neo gene, LTR, URA3 gene, GAL4 promoter, yeast targeting sequencing, the hGH sequence that comprises maturation protein 1 amino acids and mature protein 1 amino acids.Hit target construct 2 (TC2) comprises to be enough to sequence (for example 2-micron circle (2-micron circle) or ARS sequence) yeast transcription terminator, the viral LTR that plasmid is duplicated and to be used for screening at people's cell in yeast marker gene (for example, antibacterial gpt gene).Set up this construct and make the both sides of above-mentioned sequence by hGH genome sequence side joint, when carrying out homologous recombination with genomic hGH gene N sequence, this hGH genome sequence will be integrated exogenous array in the TC2 that is right after the downstream of hGH gene N termination codon.The order of the DNA sequence during integration is: the non-sequence of translating of hGH exon 5 sequences, yeast transcription terminator, yeast plasmid replication sequence, LTR, gpt gene and hGH3 '.

Linear fragment from TC1 and TC2 is hit the separately position of target to its hGH gene flank in succession.After a little cells being carried out superinfection, instruct the LTR that transcribes to produce a RNA who has the LTR sequence at two ends by this district with complementary retrovirus.Splicing this RNA is removed normal hGH intron in the molecule that produces.The reverse transcription of processed transcript will cause the accumulation of the double-stranded DNA copy of processed hGH fusion gene.From by DNA isolation the dual cell that hits target, retroviral infection, and the enzyme that is used in disposable cracking transcript unit among the LTR digests.The material that is digested connects under the condition that can promote cyclisation, and is imported in the yeast cells, and the cell of gained screens the URA3 gene subsequently.Have only those cells of having taken in URA3 gene (being connected on the hGH gene of the sequence that imports by TC1 and TC2 and processing) to grow.These cells contain will express the proteic plasmid of hGH when galactose is induced, and be listed as from cell secretion hGH albumen by means of Fused yeast leader peptide, in case said leader peptide sequences is sophisticated in the secretion generation, have bioactive hGH to divide the period of the day from 11 p.m. to 1 a.m then cleavedly fall.

The simple replacement of expression in bacterial cell by in TC1 and TC2, carrying out, as use from the ampicillin resistance gene of pBR322 replace yeast URA3 gene, with tac promoter (deboer et al, Proc.Natl.Acad.Sci.80:21-25 (1983)) replace yeast GAL4 promoter, with bacterial leader sequences replace the yeast targeting sequencing, with the replication origin of pBR322 replace 2-micron circle or ARS sequence and with the antibacterial tanscription termination (as the trpA transcription terminator; Christic, G.E.et al., Proc.Natl.Acad.Sci.78:4180-4184 (1981)) sequence replaces the yeast transcription terminator to finish.Similarly, hit target sequence with hEPO and replace hGH to hit target sequence simply also expressing hEPO in yeast and antibacterial, like this, yeast or bacterial leader sequences are positioned to be right after the upstream of hEPO codon 1 (1 amino acids in sophisticated preserved egg white matter mutually).

The embodiment 6 EPO gene that in the permanence human cell line, activates and increase

Unique HindIII site (referring to embodiment 4) that the dhfr ceneme is incorporated into pXEPO-13 will produce one can double selection and select the new hit target carrier of the cell that dhfr gene wherein is amplified.Single HindIII site among the pXEPO-13 defines being connected between the genome sequence of neo gene and the natural place upstream of people EPO gene.The dhfr gene is placed in provides one to have the neo that held by the DNA sequence from natural hEPO gene location and the construct of dhfr gene on this site.The same with pXEPO-13, the derivant of inserting the dhfr gene is used to hit target hEPO gene locus through homologous recombination.This construct that is named as pREPO4 is shown among Fig. 6.This plasmid comprises people EPO gene extron 1～4 and part exon 5 and the HindIII-BamHI fragment that is positioned at the hEPO upstream of coding region.PSVe, pTK and pmMT-I be equivalent to from SV40 distinguish in early days, the promoter of simple skin ulcer exanthema virus (HSV) thymidine kinase (TK) gene and mouse metal sulfur hydrochloride-I gene.Its production process is as follows: the pXEPO-13 of purification HindIII digestion makes it to become tack with the Klenow fragment of dna polymerase i.For obtaining the dhfr ceneme, with EcoRI and SalI digested plasmid construct pF8CIS9080 (Eaton et al., Biochemistry 25:8343-8347 (1986)).Contain the 2kb fragment of dhfr ceneme by purification in the Digestive system, and handle with the Klenow fragment of dna polymerase i and to make it to become tack.Fragment with the above-mentioned dhfr of containing is connected with the tack HindIII site of pXEPO-13 then.The five equilibrium of getting this connection mixture partly is transformed into E.coli, and is plated on the ampicillin selection flat board.After 37 ℃ of overnight incubation, observe, choose and cultivate single antibacterial colony.Obtain the miniplasmids prepared product by these cultures, digest the DNA of gained then with BglI+HundIII and SfiI Restriction Enzyme, with the segmental direction of the dhfr that determines to be inserted into.The plasmid DNA that discovery derives from one of above-mentioned prepared product contains such dhfr fragment 2kb insertion section.And the transcriptional orientation of finding dhfr ceneme in this plasmid is relative with the direction of the neo gene of adjacency.This is the construct that is named as pREPO4.

After activating endogenous hEPO gene through homologous recombination, plasmid pREPO4 is used to amplification hEPO gene locus in cell.The gene activation that produces with this construct makes and can select the DHFR of increase to express by utilizing medicine methotrexate (MTX).Generally speaking, the raising of DHFR expression realizes by DNA cloning increase copy number.Final result is that the hEPO gene that is activated is with dhfr sequence coamplification.The raising that the coamplification of activated EPO gene locus will cause EPO to express.

In the HT1080 cell, hit the target experiment with pREPO4.Separating the hEPO expression is HTREPO-52.EPO with Southern and the above-mentioned cell line generation of Northern trace quantitative analysis.Find that this bacterial strain will be hit target by the dhfr/neo/mMT-I sequence of a single copy.The expression that obtains under 0.8mg/ml G418 alternative condition is about 1300mU/1 * 10 ⁶Cell/sky.Because target EPO gene locus contains a dhfr ceneme, might select the raising of DHFR expression with antifolic thing MTX.Therefore, this bacterial strain carries out the substep selection in 0.02,0.05,0.1,0.2 and 0.4 μ M MTX.Its initial selection result is listed in table 4 and Fig. 7.

Table 4 cell line MTX (μ M) mU/1 * 10 ⁶Cell/24 hour 52C20-5-0 0 136852C20-5-0.01 0.01 174452C20-5-0.02 0.02 1164352C20-5-0.05 0.05 2444952-3-5-0.10 0.1 3701952-3-5-0.20 0.2 6786752-3-5-0.4B 0.4 99919

With the expression that the selection of the MTX concentration that increases has successfully improved hEPO among the cell line HTREPO-52, observe for anti-0.4 μ M MTX that EPO output has increased by 70 times in this cell line.Analyze in the MTX resistant cell line with the Southern trace and to confirm the amplification of hEPO gene locus, it reflects that activated hEPO gene locus has approximately increased by 10 times with respect to its parent (not hit target) its copy number of hEPO allele.

Embodiment 7 produces the hEPO fusion gene by the CMV promoter of inserting genome hEPO upstream of coding region 1.8kb

Hit the structure of target plasmid pREPO15

Making up pREPO15 at first is by pcr amplification CMV promoter and hGH exons 1 to be merged.Amplification is from the 1.6kb fragment of hGH expression construct pXGH308, the CMV promoter region that it has starts from the nucleotide 546 of gene bank (Genbank) sequence HS5MIEP, finally nucleotide 2105, utilize oligonucleotide 20 and 35 with said gene bank sequence HS5MIEP and nucleotide 5225 that starts from gene bank sequence HUGHCSA and the hGH sequence fusion of nucleotide 7322 finally.Oligonucleotide 20 (35bp, SEQ ID NO:18) is hybridized in-614 places and CMV promoter with respect to cap site (among the gene bank sequence HEHCMVP1), and comprises a SalI site at its 5 ' end.Oligonucleotide 35 (42bp, SEQ ID NO:19) is annealed with the CMV promoter at+966 places with in abutting connection with the hGH exons 1, and comprises preceding 10 base pairs (containing splicing-donor site part) and a HindIII site of hEPO introne 1 at its 5 ' end.With the PCR fragment of HindIII and SalI digestion gained, and use gel-purified.With XhoI and HindIII digested plasmid pT163 (embodiment 2), contain about 1.1kb fragment of neo ceneme with gel-purified.1.6kb CMV promoter/hGH exons 1/splicing-donor site fragment and 1.2kb neo fragment are coupled together, and be inserted into pBSIISK+ (Str-agene, HindIII site Inc).The middle interstitial granules of gained (called after pBNCHS) contain one on transcriptional orientation with CMV promoter/relative neo ceneme of hGH exons 1/segmental direction of splicing-donor site.Make up second middle interstitial granules pREPO5. △ HindIII, at first digest pREPO5 with HindIII.This process discharges 1.9kb and two fragments of 8.7kb, and contains the 8.7kb fragment that EPO hits target sequence with gel-purified, connects and cyclisation by self.The plasmid pREPO5 △ HindIII of gained only contains the non-encoding gene group DNA sequence that is present in the hEPO upstream region of gene usually.Its included sequence is from respect to-5785～-1 of EPO exons 1.From pBNCHS, excise the 2.8kb fragment that contains neo, CMV promoter, hGH exons 1 and splicing-donor site with HindIII, and use gel-purified.This fragment through the Klenow of dna polymerase i fragment (New ε ngland Biolabs Inc.) handles and becomes tack, and be connected through BglII digestion and by the pREPO5 △ HindIII of tack.Cut-1779 bp positions of hEPO exons 1 upstream in pREPO5 △ HindIII with BglII.The construct pREPO15 (Fig. 8) of gained contains with respect to the sequence of EPO upstream sequence, neo ceneme, CMV promoter, hGH exons 1, splicing-donor site and the hEPO upstream of coding region of hEPO coding region from-5786～-1779 from-1778～-1, each element with listed order according to 5 ' → 3 ' direction assembling with respect to hEPO upstream nucleotide sequence.For transfection people cell, hit the target fragment to discharge 8.6kb with NotI and PvuI digestion pREPO15.This hits the target fragment and contains that first and second hits target sequence with the 4.0kb respectively of hEPO upstream region of gene dna homology and 1.8kb.

Cultivation and transfectional cell also identify that the quilt of expressing EPO hits the target clone

All cells maintain 37 ℃, 5%CO ₂, 98% humidity and containing under the condition of DMEM (DMEM/10, HyClone Laboratories) of 10% Ox blood serum.With 100 μ g DNA electroporation under the condition of 250V and 960 μ F in PBS (GIBCO) 12 * 10 ⁶Cell and finish transfection to secondary human foreskin fibroblast.With the cell handled with every 150mm plate 1 * 10 ⁶The density inoculation of cell second day, is replaced by culture medium the DMEM/10 that contains 0.8mg/mlG418 (GIBCO).Selection course was carried out 14 days, and this moment, resampling was analyzed the EPO output in the culture medium.With determining to manifest significant hEPO content (＞5mU/ml) all colonies, and transferring in each hole of 96 well culture plates through EPO ELISA (Genzyme Inc.) on aseptic glass clone post (Bellco) the separation and Culture plate.Cultivate after 1～2 day the sampling output of elisa assay hEPO in these holes.Production hEPO cell strain through cultivating the breeding gained is in order to frozen, separate nucleic acid and the quantitative usefulness of EPO output.

The transfection of HT 1080 cells (ATCC CCL 121) is by handling 12 * 10 among the PBS (GIBCO) with 45 μ g DNA under the condition of 450V and 250 μ F ⁶Cell carries out.Clone's growth is handled secondary human foreskin fibroblast as above-mentioned with identifying.Separate the cloned cell line that produces hEPO with limiting dilution assay.At first the colony that will collect from the initial option flat board is laid on each hole of 24 orifice plates with the density in 10～15 colonies/hole.That will produce hEPO then compiles thing to produce cell density bed board in 96 orifice plates in＜1 colony/hole.Breed each clone to carry out the above-mentioned further analysis the same to human foreskin fibroblast.

Express EPO clone's feature

PRE015 does not contain any hEPO coded sequence.At hEPO exons 1 upstream neo/CMV promoter/segmental target that hits of hGH exons 1/splicing-donor, express by begin to produce hEPO from the CMV promoter transcription, produce the 1.8kb that comprises CMV sequence, hGH exons 1 and splicing-donor site, hEPO sequence upstream and normal hEPO exon, intron and 3 ' non-primary transcript of translating sequence.Splice above-mentioned transcript to next ortho position in the downstream of hEPO exon 2 splicing-acceptor site from the splicing-donor site of adjacency hGH exons 1.This will produce a new intron of being made up of hEPO upstream region of gene genome sequence, normal hEPO promoter, hEPO exons 1 and hEPO introne 1 effectively.In sophisticated transcript, the hGH exons 1 will substitute the hEPO exons 1.Only encode preceding 4 1/3 aminoacid of 26 amino acid signal peptides of hEPO exons 1, it before being gone out by emiocytosis in the past on the body protein cracking fall.Preceding 3 1/3 aminoacid of hGH exons 1 coding hGH signal peptide, it went out before being gone out by emiocytosis falls cracking in the past body protein.Replace in the information translation process of hEPO exons 1 at the hGH exons 1, will therefore produce the chimeric protein that a kind of signal peptide wherein is hGH and hEPO sequence.Remove signal peptide by normal post-translation cleavage process and will produce a sophisticated hEPO molecule, its elementary sequence is difficult to separate with normal product.

PRPO015 is transfected into human fibroblasts causes these cellular expressions EPO.Table 5 has been listed with pREPO15 and hit the target result of experiment in human fibroblasts and HT 1080 cell.The hit target frequency of discovery in the normal person fibroblast is 1/264 G418 ^rColony, and be 1/450 G418 with the target frequency of hitting of HT 1080 cells ^rColony.Quantitative analysis derives from the hEPO output of each above-mentioned cell strain.The secretory volume that produces gained in the strain at a hEPO who is obtained by transfection people fibrocyte is 7,679 mU/10 ⁶Cell/sky (table 5).Output from the activation hEPO cell line of HT 1080 cells is 12,582 mU/10 ⁶Cell/sky (table 5).These results show, are effectively to the activation of hEPO gene locus, and cause hEPO constantly to produce with high relatively level.Confirm to hit the target process with Restriction Enzyme and Southern hybridization analysis method and betided the EPO gene locus.

Human fibroblasts and HT 1080 clones that hit target with pREPO15 are carried out the Southern engram analysis.Fig. 9 A represents parent and is hit the restricted figure of the hEPO gene locus of target, and Fig. 9 B represents the human fibroblasts clone who is hit target is carried out the result of Restriction Enzyme and Southern hybridization analysis.As the result who hits target at the hEPO gene locus, the digest of BglII/EcoRI and BamHI discharges the fragment (T1 swimming lane) of 5.8kb and 6.6kb respectively.These two fragments derive from the insertion of the 2.7kb DNA that contains neo gene and CMV promoter sequence.Because have only a quilt to hit target in two hEPO allele, so in these bacterial strains and mother body D NA, observe the 4.3kb fragment (BglII/EcoRI) or the 10.6kb fragment (BamHI) (swimming lane HF) of the unaltered hEPO gene locus of reflection.These result's proofs cause instructing the new transcript unit that produces human forcing erythrogenin to produce at the homologous recombination that the hEPO gene locus takes place.Oligonucleotide sequence 20 5 ' TTTTCTCGAG TCGACGACAT TGATTATTGA CTAGT

(SEQ?ID?NO：18) 35 5′TTTTAAGCTT?GAGTACTCAC?CTGTAGCCAT?GGTGGATCCC?GT

(SEQ?ID?NO：19)

The activation that the transfection of table 5 pREPO15 in people's cell and hEPO express

Transfected is processed ^aG418 ^{r b}Contain the EPO table

The cell colony of cell type reaches the dull and stereotyped human fibroblasts 3.3 * 10 of son ⁷264 1 HT, 1080 cells 3.1 * 10 ⁷2,700 6 hEPO express subnumber hEPO and express subnumber ^cThe expression of hEPO/processed cell/processed cell (mU/10 ⁶Cell/24 hour)

1/264 1/3.3×10 ⁷ 7679

1/450 1/5.2×10 ⁶ 12,582

A is by calculating 2 colony number, average its results and be extrapolated to total number of plates and estimate on the flat board.

B is from containing G418 ^rThe EPO elisa assay is carried out in sampling in the culture medium of colony flat board, and those demonstrate quilt that the hEPO level is higher than 5mU/ml and can be regarded as EPO and activate phenomenon.

The c quantitative assay is from the hEPO output of human fibroblasts strain, HF 342-15 or HT 1080 cell line HTPREPO15-1-6-6.

Embodiment 8 is by the upstream 1.8kb CMV promoter of the inserting genome hEPO coding region hEPO fusion gene that produces and increase

Structure hits target plasmid pREPO18:

By inserting the dhfr ceneme and make up pREPO18 (Figure 10) being positioned at the neo gene 5 of pREPO15 ' end ClaI site.In order to obtain the dhfr ceneme, with EcoRI and SalI digested plasmid construct pF8CIS9080[Eaton et al., Biochemistry25:8343-8347 (1986)].Purification contains the 2kb fragment of dhfr ceneme from this digest, and makes it tackization by handling with the Klenow fragment of dna polymerase i.(New England Biolabs Inc.) is connected on the dhfr fragment of tackization with the ClaI joint then.Reuse ClaI digests the product of above-mentioned connection, and is connected with the pREPO15 of ClaI digestion.The five equilibrium of this junctional complex is transformed into E.coli, and selects bed board on the flat board at ampicillin.Analyze the dhfr segmental direction of bacterium colony by the Digestion of Restriction Enzyme to determine to insert.There is its transcriptional orientation plasmid relative of dhfr to be named as pREPO18 (-) with neo gene transcription direction.The second kind of plasmid that has dhfr and neo gene to have identical transcriptional orientation is named as pREPO18 (+).

Cell culture, transfection also identifies that the quilt of expressing EPO hits the target clone

All cells are maintained at 37 ℃, 5%CO ₂, 98% humidity and containing under the condition of DMEM (DMEM/10, HyClone Laboratories) of 10% Ox blood serum.Handling in PBS (GIBCO) processing 12 * 10 through electroporation with 45 μ g DNA under 450V and the 250 μ F conditions ⁶Cell and carry out transfection to HT 1080 cells (ATCC CCL 121).With 1 * 10 ⁶The density inoculation of cell/150mm flat board is through the cell of above-mentioned processing.Second day, culture medium is replaced by the DMEM/10 that contains 0.8mg/ml G418 (GIBCO).Selection course was carried out 14 days, the output of hEPO in this sample analysis culture medium in period.Analyze through hEPOELISA (Genzyme Inc.) with trypsin treatment and to be defined as having obvious hEPO output (＞5mU/ml) flat board, and cell carried out again bed board with separating clone.With limiting dilution assay separation of produced hEPO cloned cell line, at first be that the density with 10～15 colonies/hole is laid on the clone in the hole of 24 orifice plates, then with the cell density in＜1 colony/hole in the future the self-produced hEPO cell that compiles thing be plated in 96 orifice plates.Cultivate the usefulness of each clone of breeding in order to frozen, separate nucleic acid and the quantitative analysis of hEPO output.

Select to separate the cell that contains amplification dhfr sequence by methotrexate

The quilt that will produce hEPO after with the pREPO18 transfection hits target G418 ^rCell line is with various cell density bed boards, to select in methotrexate (MTX).When after selecting, new clone occurring, then it is measured hEPO output with certain MTX concentration, and in higher MTX concentration (being generally the twice of original content) with various cell densities bed board again.Repeat said process till reaching required hEPO output.In the MTX in each step resistance was selected, DNA isolation and RNA carried out Southern and Northern engram analysis respectively.

Express the clone's of EPO feature:

With pREPO18 transfection HT 1080 cells with two kinds of different dhfr directions.Before the transfection, digest pREPO18 (+) and pREPO18 (-) with XbaI, discharge a 7.9kb and hit the target fragment, it contains the 2.1kb district (with respect to hEPO ATG start codon from-3891～-1779) of hEPO exons 1 upstream gene group DNA successively, the 2kb district of containing the dhfr gene, the 1.1kb district that contains the neo gene, the 1.5kb district of containing the CMV promoter that merges with the hGH exons 1, the 1.1kb district of the hEPO introne 1 (containing splicing-donor site) of 10bp and hEPO exons 1 upstream gene group DNA (with respect to EPO ATG start codon from-1778～-678).Derive from two in the experiment transfection and hit the target frequency and be shown in Table 6.By being separated to 5 elementary G418 in these experiments ^rThe clone.They are bred to be used for the quantitative analysis (table 7) that hEPO expresses through culture medium.Because pREPO18 contains the dhfr gene, so might be as select to contain the cell of the amplification copy that hits the target construct as described in the embodiment 6 with MTX.Be driven into the G418 of target with what Restriction Enzyme and Southern hybridization analysis confirmed at the hEPO gene locus ^rThe clone selects by the described substep that carries out in MTX.

Table 6 pREPO18 hits target in HT 1080 cells

The cell G418 that the construct dna digestion is subject to processing ^rColony pREPO18 XbaI 3.6 * 10 ⁶16,980

(-) pREPO18 XbaI 3.6×10 ⁶ 19,290

(+)

There is hEPO expression hEPO expressor analyzed

Flat board/the G418 of son ^rColony is time cloning just

39 1/435 1

41 1/470 4

The hEPO that table 7 hits with pREPO18 in HT 1080 cell lines of target produces

Cell line construct hEPO mU/10 ⁶Cell/sky 18B3-147 pREPO18 (+) 24759 18B3-181 pREPO18 (+) 20831 18B3-145 pREPO18 (+) 17586 18B3-168 pREPO18 (+) 5293 18B3-119 pREPO18 (-) 2881

Embodiment 9 in permanence people cell, activate and increase endogenous alpha-interferon, GM-CSF, G-CSF and FSH β gene

Utilize method of the present invention and DNA construct, the endogenous cytogene of many kinds can activate and increase.The general strategy of activation and amplification human's (LeIF), GM-CSF (granulocyte/M-CSF), G-CSF (granulocyte colony-stimulating factor) and FSH β (follicle-stimulating hormone β subunit) gene is described below.

Alpha-interferon

Human's gene (gene bank sequence HUMIFNAA) coding contains 188 amino acid precursor albumen of 23 amino acid signal peptides.This gene does not contain intron.Figure 11 illustrates a kind of strategy that activates alpha-interferon genes.The designed target construct that hits comprises hitting target sequence, the marker gene that can increase, selectable marker gene, regulatory region, CAP site, splicing-donor site, intron, a splicing-acceptor site with this gene upstream sequence homologous first and being equivalent to first and hits second of target sequence downstream sequence and hit target sequence.For fear of unwanted ATG start codon, second hits target sequence will should not extend to than with respect to-107 of normal start codon upstreams more.

In described strategy, first and second hit target sequence is hitting in the target gene next-door neighbour mutually normally, but this is not to be essential (vide infra).But this paper has described the marker gene that can increase and has been applicable to the selected marker gene of selection.The marker gene that can increase can be identical gene with selectable marker gene, and its position can be put upside down, and one of them or both can place the intron that hits the target construct.Selectable marker gene is optional, and that the marker gene that can increase only is only when needs carry out amplified reaction is essential.Mixing also of specific C AP site chosen wantonly.Randomly, in hitting the target construct, can comprise that from the exon sequence of another gene 3 ' end to splicing-acceptor site and 5 ' end hits target sequence to second.Regulatory region, CAP site, splicing-donor site, intron and acceptor splicing site site can be used as complete unit and extend the factor-1 α (EF-1 α from the people; Gene bank sequence HUMEF1A) gene or cytomegalovirus (CMV; Gene bank sequence HEHCMVP1) nestle up early stage differentiation from coming out, perhaps mentioned component is by assembling from the isolating suitable component of different genes.

The genomic DNA that utilizes recombinant DNA method well known by persons skilled in the art will be equivalent to the alpha-interferon genes upstream can be used as and hits target sequence and hit the assembling of target construct and carry out.As described herein, many selectable and marker gene that can increase can be used for hitting the target construct, and activation and amplified reaction can carry out in many cell types effectively.Utilize embodiment 4 described methods, utilize the ELISA method to measure human's method (BiosourceInternational, Camarillo, CA) can finish to the transfection of elementary, secondary or permanence people cell and to expressing the somatic separation of homologous recombination of alpha-interferon, in addition, can identify the homologous recombination somatic cell by embodiment 1g and the described PCR screening method of 1j.The cell that contains the amplification copy of the alpha-interferon genes position seat that can increase marker gene and be activated as separation as described in the embodiment 6.

Produced the mRNA precursor in the homologous recombination somatic cell, it comprises that external source exon, splicing-donor site, intron, splicing-acceptor site, second hit target sequence and human coding region and 3 ' non-sequence (Figure 11) of translating.Above-mentioned information is spliced, can be translated to produce human's functional mRNA with producing.

The position that the size of intron reaches with respect to the regulatory region of gene coding region is variable, so that regulatory region performance optimal function.In hitting the target construct, can there be a plurality of exons.In addition, second hits target sequence must not be in close proximity to first and hit target sequence or in its vicinity in normal gene, like this, can leave out the normal upstream of portion gene when carrying out homologous recombination.

GM-CSF

Human GM-CSF gene (gene bank sequence HUMGMCSFG) coding contains 144 amino acid precursor protein of 17 amino acid signal peptides.This gene contains 4 exons and 3 introns, and 50 aminoacid of the N of precursor end are coded in first exon, and Figure 12 illustrates the strategy that activates the GM-CSF gene.In this strategy, hit the target construct and be designed to comprise that hitting target sequence, marker gene that can increase, selectable marker gene, regulatory region, CAP site, coding with the upstream sequence of GM-CSF gene homologous first is equal to or is equivalent to exon, a splicing-donor site of preceding 50 amino acid whose aminoacid sequences of GM-CSF and hit second of target sequence downstream sequence corresponding to first and hit target sequence on function.Utilize above-mentioned strategy, the mRNA precursor that the homologous recombination somatic cell produces is equivalent to external source exon and splicing-donor site, second and hits any sequence between the start codon that target sequence, second hits target sequence and GM-CSF gene and exon, the intron and the 3 ' non-district (Figure 11) that translates of GM-CSF gene.Above-mentioned information is spliced the exon 2 and the external source exon that cause endogenous GM-CSF gene merge, they produce GM-CSF when being translated.

In above-mentioned strategy, first and second hit target sequence normally hit in the target gene tightly adjacent, but this and nonessential (vide infra).But this paper has described the marker gene that can increase and has been applicable to the selected marker gene of selection.The marker gene that can increase can be identical gene with selectable marker gene, and perhaps its position can be put upside down.Selectable marker gene is optional, and that the marker gene that can increase only is only when needs carry out amplified reaction is essential.Selectable marker gene and/or the marker gene that can increase can be positioned to hit that splicing-donor site and second hits between the target sequence in the target construct.Mixing of specific C AP site is optional.Regulatory region, CAP site and splicing-donor site can be used as complete unit and extend the factor 1 α (EF-1 α from the people; Gene bank sequence HUMEF1A) gene or cytomegalovirus (CMV; Gene bank sequence HEHCMVP1) near separating in the early stage district, perhaps these compositions can be by assembling from the isolating suitable component of different genes (as mMT-1 promoter and CAP site and derive from hGH or the exons 1 of hEPO gene and splice donor site).

Other for example can utilize method, and first and second hit target sequence can be equivalent to sequence in GM-CSF gene first intron.In addition, can utilize and be similar to the described target construct that hits of alpha-interferon, wherein, hitting the target construct is designed to comprise hit target sequence, the marker gene that can increase, selectable marker gene, regulatory region, CAP site, splicing-donor site, intron, a splicing-acceptor site with GM-CSF gene upstream sequence homologous first and be equivalent to first and hits second of target sequence downstream sequence and hit target sequence.

Under any circumstance second hit target sequence and all needn't be close to first in the normal gene and hit target sequence or in its vicinity, like this, the normal upstream part of gene will be deleted when carrying out homologous recombination.In addition, in hitting the target construct, can there be a plurality of non-codings or coding exon.Utilize recombinant DNA well known by persons skilled in the art, to the upstream that is equivalent to the human GM-CSF gene or the gene DNA that includes the subarea as hitting target sequence and the target construct is hit in assembling.As described herein, many selectable and marker gene that can increase can be used to hit in the target construct, and activation process can be carried out in many cell types effectively.By embodiment 4 described methods, use ELISA to measure human GM-CSF method (R ﹠amp; D Systems.Minneapolis, MN) can implement elementary, secondary or permanence people cell transfecting with separate the homologous recombination somatic cell of expressing GM-CSF.In addition, utilize above-mentioned PCR screening method can identify the homologous recombination somatic cell.The cell that separates the amplification copy that contains can increase marker gene and activated GM-CSF gene position seat can be undertaken by preceding method.

G-CSF

Human G-CSF gene (gene bank sequence HUMGCSFG) coding contains 204～207 amino acid precursor protein of 30 amino acid signal peptides.This gene contains 5 exons and 4 introns.13 aminoacid of first exons coding signal peptide.Figure 13 illustrates the strategy that activates the G-CSF gene.Hitting the target construct is designed to comprise with G-CSF gene upstream sequence homologous first and hits preceding 13 aminoacid sequences exon identical or aminoacid sequence of equal value on function of target sequence, marker gene that can increase, selectable marker gene, regulatory region, CAP site, coding and G-CSF signal peptide, splicing-donor site and hit target sequence with first downstream sequence corresponding second that hits target sequence.By means of above-mentioned strategy, the homologous recombination somatic cell produces a mRNA precursor, it is corresponding to external source exon and splicing-donor site, second hit target sequence, G-CSF gene start codon and second hits any sequence between target sequence, and the exon of G-CSF gene, intron and the 3 ' non-district (Figure 13) that translates.Above-mentioned information is spliced the exon 2 that causes exogenous exon and endogenous G-CSF gene merge, they will produce G-CSF when being translated.Can carry out functional replacement to preceding 13 aminoacid of normal G-CSF signal peptide with the sequence that is present in the exogenous exon, this just makes anyone to modify signal peptide, and therefore proteinic secretion characteristic produces.

In above-mentioned strategy, first and second hit target sequence hits in the target gene normally and is close to, but this and inessential.Second hits target sequence needn't be in close proximity to first and hit target sequence or in its vicinity in normal gene, like this, leave out the normal upstream part of gene when carrying out homologous recombination.The marker gene that can increase can be identical gene with selectable marker gene, and perhaps its position can be reversed.Selectable marker gene is optional, and the marker gene that can increase is only just essential when needs carry out amplified reaction.Selectable marker gene and/or the marker gene that can increase can be positioned at the splicing-donor site and second that hits the target construct and hit between the target sequence.Mixing of specific C AP site is can be elective.Regulatory region, CAP site and splicing-donor site can be used as complete unit and extend the factor-1 α (EF-1 α from the people; Gene bank sequence HUMEF1A) gene or cytomegalovirus (CMV; Gene bank sequence HEHCMVP1) near separating in the early stage district, perhaps these compositions can be by assembling from the isolating suitable component of different genes (as mMT-I promoter and CAP site, deriving from the exons 1 and the splicing-donor site of hGH or EPO gene).In hitting the target construct, can use a plurality of codings or noncoding external source exon, as long as when splicing, be present in an ATG start codon in the sign indicating number that mature protein is arranged and be included in one of them exon and get final product.

Other available method, for example first and second sequences of hitting in first intron that target sequence can be equivalent to the G-CSF gene.In addition, can use be similar to described alpha-interferon hit the target construct, wherein, hitting the target construct is designed to comprise: hit target sequence, one with G-CSF gene upstream sequence homologous first and can expand marker gene, selectable marker gene, regulatory region, CAP site, splicing-donor site, intron, a splicing-acceptor site of grave and hit second of target sequence downstream sequence corresponding to first and hit target sequence.

Use recombinant DNA method well known by persons skilled in the art, can with corresponding to the upstream of human G-CSF gene or the genomic DNA that includes the subarea as hitting target sequence and can implementing to the assembling of hitting the target construct.As described herein, in hitting the target construct, can use many marker gene of selecting and can increasing, and activation process goes out and can carry out effectively in many cell types.Utilize embodiment 4 described methods, use ELISA to measure human G-CSF method (R ﹠amp; DSystems, Minneapolis MN) can carry out the transfection of elementary, secondary or permanence people cell and somatic separation of homologous recombination of expression G-CSF, in addition, also can identify the homologous recombination somatic cell by means of aforesaid PCR screening.The cell that separates the amplification copy that contains the alpha-interferon genes position seat that can increase marker gene and be activated with preceding method.

FSHβ

People FSH β gene (gene bank sequence HUMFSH1) coding contains 129 amino acid precursor protein of 16 amino acid signal peptides.This gene contains three and each and every one shows son and two introns, and wherein first exon is the exon of non-coding.Can reach activation with multiple strategy to FSH β.Figure 14 illustrates a kind of activation strategy.In this strategy, hit the target construct and be designed to comprise and suitable hit target sequence, the marker gene that can increase, selectable marker gene, regulatory region, CAP site, exon, a splicing-donor site with FSH β gene upstream sequence homologous first and hit second of target sequence downstream sequence corresponding to first and hit target sequence.By means of above-mentioned strategy, the homologous recombination somatic cell produces a mRNA precursor, it is equivalent to external source exon and splicing-donor site, second and hits any sequence between target sequence, second target sequence and the FSH β gene start codon, and the exon of FSH β gene, intron and the 3 ' non-district (Figure 14) that translates.Above-mentioned information is spliced the exon 2 that will cause external source exon and endogenous FSH β gene merge, they can produce FSH β when being translated.In above-mentioned strategy, first and second hit target sequence is close to normally hitting in the target gene, but this and nonessential (vide infra).

Other available method, for example first and second hit target sequence can be corresponding to the sequence in FSH β gene first intron.In addition, can use and be similar to the described target construct that hits of alpha-interferon.In this strategy, hit the target construct and be designed to comprise and hit target sequence, the marker gene that can increase, selectable marker gene, regulatory region, CAP site, splicing-donor site, intron, an acceptor splicing site site with FSH β gene upstream sequence homologous first and hit second of target sequence downstream sequence corresponding to first and hit target sequence.Second hits target sequence should not extend to than with respect to-40 of normal FSH β transcriptional start site upstreams more, to avoid unwanted ATG start codon.In the homologous recombination somatic cell, the mRNA precursor that is produced comprises that external source exon, splicing-donor site, intron, splicing-acceptor site, second hit target sequence and people FSH β coding exon, intron and 3 ' do not translate sequence, these information are spliced will produce the functional mRNA that can be translated to production people FSH β.The size of intron and the regulatory region that therefore produced are variable with respect to the position of gene coding region, so that regulatory region performance optimal function.

In any one activation strategy, second hits target sequence needn't be arranged in first of next-door neighbour's normal gene and hit target sequence or in its vicinity, like this, when carrying out homologous recombination, normal upstream part that will the deletion gene.And one is hit the upstream that target sequence can be a gene, and one is hit in the exon or intron that target sequence may reside in FSH β gene.

The marker gene that can increase can be identical gene with selectable marker gene, and its position can be put upside down, and one of them or both can be present in the intron that hits the target construct.This paper has described marker gene that can increase and the selectable marker gene that is suitable for selecting.Selectable marker gene is optional, and that the marker gene that can increase only is only when needs carry out amplified reaction is essential.Mixing of specific C AP site is can be elective.Randomly, can be included in from the exon sequence of another gene and hit target construct 3 ' to splicing-acceptor site and 5 ' hit target sequence to second.Regulatory region, CAP site, exon, splicing-donor site, intron and splicing-acceptor site can be used as complete unit and extend the factor-1 α (EF-1 α from the people; Gene bank sequence HUMEF1A) gene or cytomegalovirus (CMV; Gene bank sequence HEHCMVP1) near separating in the early stage district, perhaps these compositions are assembled by isolating suitable component from different genes.Under any circumstance, the external source exon can be identical or different with first exon of normal FSH β gene, and can have a plurality of exons in hitting the target construct.

Utilize recombinant technique well known by persons skilled in the art, the genomic DNA corresponding to FSH β upstream region of gene district can be able to be assembled as hitting target sequence and hitting the target construct.As described herein, many selectable and marker gene that can increase can be used to hit in the target construct, and activation process can be carried out in many cell types effectively.If necessary, can produce the FSH β gene outcome that is activated in the cell type of expressing human glycoprotein alpha subunit, the product of glycoprotein alpha subunit and FSH β gene outcome form heterodimer.This can be a naturally occurring cell strain or cell line.In addition, human glucoprotein alpha subunit gene (gene bank sequence HUMGLYCA1) can with FSH β gene outcome co expression.And above-mentioned co expression is finished by human glucoprotein alpha subunit gene or cDNA under suitable promoter regulation, or is finished by the activation of human glucoprotein alpha subunit by methods described herein.Utilize preceding method use ELISA measure people FSH β (Accurate Chemicaland Scientific, Westbury, NY) can carry out to the transfection of elementary, secondary or permanence people cell with to expressing somatic separation of homologous recombination of FSH β.In addition, utilize aforementioned PCR screening method also can identify the homologous recombination somatic cell.The cell that separates the amplification copy that contains marker gene that can increase and the alpha-interferon genes position seat that is activated as previously mentioned.

Person of skill in the art will appreciate that, maybe can utilize not transnormal experiment and can determine many equivalents of the specific embodiments of invention described herein.This class equivalent will be included by claims.

Claims (165)

1, in inserting cell chromosome DNA, can change the DNA construct of expression of target gene, comprise:

A) hit target sequence;

B) regulate sequence;

C) exon; And

D) unpaired splicing-donor site.

2, DNA construct as claimed in claim 1, wherein exon comprises a CAP site.

3, DNA construct as claimed in claim 2, wherein exon also contains nucleotide sequence ATG.

4, DNA construct as claimed in claim 3, wherein exon also contains the coding DNA of reading band target gene in the sign indicating number.

5, DNA construct as claimed in claim 4, wherein the coding DNA of exon is identical with the coding DNA of first exon of target gene.

6, DNA construct as claimed in claim 4, wherein the coding DNA of exon is different with the coding DNA of first exon of target gene.

7, DNA construct as claimed in claim 4 is wherein hit sequence homology in target sequence and the target gene.

8, DNA construct as claimed in claim 4 is wherein hit the sequence homology of the coding region upstream of target sequence and target gene.

9, DNA construct as claimed in claim 4 is wherein hit the sequence homology of the endogenous adjusting sequence upstream of target sequence and target gene.

10, DNA construct as claimed in claim 4, wherein this construct also contain with target gene in sequence homology second hit target sequence.

11, DNA construct as claimed in claim 4, wherein this construct also contains with second of the sequence homology of target gene upstream of coding region and hits target sequence.

12, DNA construct as claimed in claim 4, wherein the upstream sequence homologous second that also contains with the endogenous adjusting sequence of target gene of this construct hits target sequence.

13, DNA construct as claimed in claim 4, wherein target gene a kind of therapeutic protein of encoding.

14, DNA construct as claimed in claim 4, wherein target gene coding hormone, cytoplastin (cytokine), antigen, antibody, enzyme, thrombin, transport protein matter, receptor, adjusting protein, structural protein or transcription factor.

15, DNA construct as claimed in claim 4, wherein the target gene coding is selected from following protein: erythropoietin, calcitonin, growth hormone, insulin, pancreotropic hormone, insulin like growth factor, parathyroid hormone, interferon-, IFN-, nerve growth factor, FSH β, TGF-β, tumor necrosis factor, glucagon, skeletal growth factor-2, skeletal growth factor-7, TSH-β, interleukin 1, interleukin II, interleukin, interleukin-6, interleukin-11, interleukin 12, granulocyte CSF, macrophage CSF, granulocyte/macrophage CSF, immunoglobulin, catalytic antibody, Protein kinase C, the glucose cerebrosidase, superoxide dismutase, tissue plasminogen activator, urokinase, Antithrombin III, DNAse, alpha-galactosidase, tyrosine hydroxylase, labile factor, proconvertin, blood coagulation factor VIII, plasma thromboplastin component, Stuart factor, Hageman factor I, degreasing protein E or degreasing protein A-I, globin, low density lipoprotein receptor, the IL-2 receptor, the IL-2 antagonist, α-1 antitrypsin, immune response modifier and solubility CD4.

16, as the DNA construct of claim 15, wherein target gene coding growth hormone, FSH β, G-CSF or GM-CSF.

17, as the DNA construct of claim 15, target gene coding erythropoietin wherein.

18, as the DNA construct of claim 17, wherein the coding DNA of exon is identical with the coding DNA of first exon of erythropoietin.

19, as the DNA construct of claim 17, wherein the coding DNA of exon is different with the coding DNA of first exon of erythropoietin.

20, DNA construct as claimed in claim 1, wherein regulating sequence is promoter, enhancer, skeleton bonding pad or transcription factor binding site point.

21, as the DNA construct of claim 20, wherein regulating sequence is promoter.

22,, also contain an additional adjusting sequence as the DNA construct of claim 21.

23, as the DNA construct of claim 21, wherein this construct also contains enhancer.

24,, also contain one or more alternative signs as the DNA construct of claim 23.

25, as the DNA construct of claim 24, also contain the marker gene that can increase.

26,, wherein regulate sequence and be the solid adjusting sequence of adjusting sequence, the adjusting sequence of SV-20 gene, the adjusting sequence of the huge viral gene of cell, the adjusting sequence of collagen gene, the adjusting sequence of actin, the adjusting sequence of immunoglobulin gene, the HMG-CoA reductase base of mouse metal sulfur hydrochloride-I gene or the adjusting sequence of EF-1 α gene as the DNA construct of claim 20.

27, prepare the wherein somatic method of the reformed homologous recombination of expression of target gene, comprise the steps:

A. use the DNA construct transfectional cell, this DNA construct comprises:

(i) hit target sequence;

(ii) regulate sequence;

(iii) exon; With

(iv) unpaired splicing-donor site produces transfected cell thus; And

B. be suitable for keeping this transfected cell under the condition of homologous recombination.

28, as the method for claim 27, wherein exon contains the CAP site.

29, as the method for claim 28, wherein exon contains nucleotide sequence ATG.

30, as the method for claim 29, wherein exon also contains the coding DNA in the sign indicating number that has target gene.

31, as the method for claim 30, wherein the coding DNA of exon is identical with the coding DNA of first exon of erythropoietin.

32, as the method for claim 30, wherein the coding DNA of exon is different with the coding DNA of first exon of erythropoietin.

33, as the method for claim 30, wherein hit the sequence homology in target sequence and the target gene.

34,, wherein hit the sequence homology of target sequence and target gene coding upstream as the method for claim 30.

35,, wherein hit the endogenous adjusting upstream sequence homology of target sequence and target gene as the method for claim 30.

36, as the method for claim 30, wherein construct also contain with target gene in sequence homology second hit target sequence.

37, as the method for claim 30, wherein construct also contains with the upstream sequence of target gene coding region homologous second and hits target sequence.

38, as the method for claim 30, wherein the upstream sequence homologous second that also contains with the endogenous adjusting sequence of target gene of construct hits target sequence.

39, as the method for claim 30, wherein cell is people's cell.

40, as the method for claim 27, target gene coding erythropoietin wherein.

41, as the method for claim 30, wherein coding DNA is identical with the coding DNA of first exon of erythropoietin.

42, as the method for claim 30, wherein coding DNA is different with the coding DNA of first exon of erythropoietin.

43, as the method for claim 30, wherein DNA construct contains a marker gene that can increase.

44, the homologous recombination somatic cell of producing with the method for claim 27.

45, the homologous recombination somatic cell of producing with the method for claim 28.

46, the homologous recombination somatic cell of producing with the method for claim 29.

47, the homologous recombination somatic cell of producing with the method for claim 30.

48, the homologous recombination somatic cell of producing with the method for claim 31.

49, the homologous recombination somatic cell of producing with the method for claim 32.

50, the homologous recombination somatic cell of producing with the method for claim 39.

51, the homologous recombination somatic cell of producing with the method for claim 40.

52, the homologous recombination somatic cell of producing with the method for claim 41.

53, the homologous recombination somatic cell of producing with the method for claim 43.

54, homology is heavily given somatic cell, it comprises that external source regulates sequence, exogenous exon, splicing-donor site, is operably connected on second exon of endogenous gene.

55, as the homologous recombination somatic cell of claim 54, wherein exogenous exon comprises the CAP site.

56, as the homologous recombination somatic cell of claim 55, wherein exogenous exon also comprises nucleotide sequence ATG.

57, as the homologous recombination somatic cell of claim 56, wherein the external source exon also comprises yard interior coding DNA of reading that has the target endogenous gene.

58, as the homologous recombination somatic cell of claim 57, wherein coding DNA is identical with the coding DNA of first exon of target gene.

59, as the homologous recombination somatic cell of claim 58, wherein coding DNA is different with the coding DNA of first exon of target gene.

60, as the homologous recombination somatic cell of claim 58, wherein external source adjusting sequence, external source exon and splicing-donor site are the upstreams of target gene coding region.

61, as the homologous recombination somatic cell of claim 60, wherein external source adjusting sequence, external source exon and splicing-donor site are the upstreams of the endogenous adjusting sequence of target gene.

62, as the homologous recombination somatic cell of claim 54, wherein endogenous adjusting sequence is deleted.

63, as the homologous recombination somatic cell of claim 62, wherein the first endogenous exon is deleted.

64, as the homologous recombination somatic cell of claim 57, wherein target gene coding hormone, cytoplastin, antigen, antibody, enzyme, thrombin, transport protein matter, receptor, adjusting protein, structural protein or transcription factor.

65, as the homologous recombination somatic cell of claim 57, wherein the target gene coding is selected from following proteins: erythropoietin, calcitonin, growth hormone, insulin, pancreotropic hormone, insulin like growth factor, parathyroid hormone, beta-interferon, gamma interferon, the neural factor that generates, FSH β, TGF β, tumor necrosis factor, glucagon, skeletal growth factor-2, the osteogenesis factor-7, TSH-β, interleukin 1, interleukin II, interleukin, interleukin-6, interleukin-11, interleukin 12, granulocyte CSF, macrophage CSF, granulocyte/macrophage CSF, immunoglobulin, catalytic antibody, Protein kinase C, the glucose cerebrosidase, superoxide dismutase, tissue plasminogen activator, urokinase, Antithrombin III, DNAse, alpha-galactosidase, tyrosine hydroxylase, labile factor, proconvertin, blood coagulation factor VIII, plasma thromboplastin component, Stuart factor, Hageman factor I, degreasing protein E or degreasing protein A-I, globin, low density lipoprotein receptor, the IL-2 receptor, the IL-2 antagonist, α-1 antitrypsin, immune response modifier and solubility CD4.

66, as the homologous recombination somatic cell of claim 54, wherein cell is an eukaryotic cell.

67, as the homologous recombination somatic cell of claim 66, wherein cell is fungus, plant or animal origin.

68, as the homologous recombination somatic cell of claim 67, wherein cell is the vertebrates source.

69, as the homologous recombination somatic cell of claim 68, wherein cell is elementary or secondary mammalian cell.

70, as the homologous recombination somatic cell of claim 68, wherein cell is elementary or secondary people's cell.

71, as the homologous recombination somatic cell of claim 68, wherein cell is the permanence mammalian cell.

72, as the homologous recombination somatic cell of claim 68, wherein cell is a permanence people cell.

73, as the homologous recombination somatic cell of claim 68, wherein cell is selected from the strain of deriving, MCF-7 breast cancer cell, K-562 leukaemia, KB cancerous cell, the 2780 AD ovarian cancer cells of following cell: HT 1080 cells, HeLa cell and HeLa cell, the Raji cell, Jurkat cell, Namalwa cell, the HL-60 cell, Daudi cell, RPMI 8226 cells, V-937 cell, Bowes melanoma cells, WI-38VA13 subbreed 2R4 cell and MOLT-4 cell.

74, as the homologous recombination somatic cell of claim 73, target gene coding erythropoietin wherein.

75, as the homologous recombination somatic cell of the energy expressing promoting erythropoietin of claim 74.

76, as the homologous recombination somatic cell of claim 75, wherein coding DNA is identical with the coding DNA of first exon of erythropoietin.

77, as the homologous recombination somatic cell of claim 74, wherein coding DNA is different with the coding DNA of first exon of erythropoietin.

78, as the homologous recombination somatic cell of claim 77, it also contains an exogenous marker gene that increases.

79, as claim 54 can expressed fusion protein the homologous recombination somatic cell of matter, wherein fused protein comprises by the aminoacid of exogenous exons coding with by the endogenous gene amino acids coding.

80, as the homologous recombination somatic cell of claim 59, wherein regulating sequence is promoter, enhancer, skeleton bonding pad or transcription factor binding site point.

81, as the homologous recombination somatic cell of claim 80, wherein external source adjusting sequence is a promoter.

82, as the homologous recombination somatic cell of claim 80, wherein to regulate sequence be the solid adjusting sequence of adjusting sequence, the adjusting sequence of SV-40 gene, the adjusting sequence of the huge viral gene of cell, the adjusting sequence of collagen gene, the adjusting sequence of actin, the adjusting sequence of immunoglobulin gene, the HMG-CoA reductase base of mouse metal sulfur hydrochloride-I gene or the adjusting sequence of EF-1 α gene to external source.

83, in cell, activate the method for expression and amplification gene, comprise the steps:

(a) use the DNA construct transfectional cell, this DNA construct comprises:

(i) hit target sequence;

(ii) scalable marker gene

(iii) regulate sequence;

(iv) exon; With

(v) unpaired splicing-donor site produces transfected cell thus;

(b) being suitable for keeping this transfected cell under the condition of homologous recombination, produce the homologous recombination somatic cell thus; With

(c) be suitable for keeping this homologous recombination somatic cell under activation expression and the amplification gene condition.

84, as the method for claim 83, wherein exon comprises nucleotide sequence ATG.

85, as the method for claim 83, wherein exon also contains the CAP site.

86, as the method for claim 85, wherein exon also contains the coding DNA of reading sign indicating number that has target gene.

87, as the method for claim 86, wherein coding DNA is identical with the coding DNA of first exon of target gene.

88, as the method for claim 87, wherein target gene is an erythropoietin gene.

89, as the method for claim 87, wherein coding DNA is different with the coding DNA of first exon of target gene.

90, as the method for claim 89, wherein target gene is an erythropoietin gene.

91,, wherein hit the sequence homology in target sequence and the target gene as the method for claim 89.

92,, wherein hit the upstream sequence homology of the coding region of target sequence and target gene as the method for claim 89.

93,, wherein hit the upstream sequence homology of the endogenous adjusting sequence of target sequence and target gene as the method for claim 89.

94, as the method for claim 89, wherein construct also contain with target gene in sequence homology second hit target sequence.

95, as the method for claim 89, wherein the upstream sequence homologous second that also contains with the coding region of target gene of construct hits target sequence.

96, as the method for claim 89, wherein the upstream sequence homologous second that also includes with the endogenous adjusting of target gene of construct hits target sequence.

97, make method of protein by in cell, changing expression of gene, comprise the steps:

(a) use the DNA construct transfectional cell, this DNA construct comprises:

(i) hit target sequence;

(ii) regulate sequence;

(iii) exon; With

(iv) unpaired splicing-donor site produces transfected cell thus;

(b) being suitable for keeping this transfected cell under the condition of homologous recombination, produce the homologous recombination somatic cell thus; With

(c) be suitable for keeping this homologous recombination somatic cell under the condition of protein production.

98, as the method for claim 97, wherein exon contains the CAP site.

99, as the method for claim 98, wherein exon contains nucleotide sequence ATG.

100, as the method for claim 99, wherein exon also contains yard interior coding DNA of reading that has the target endogenous gene.

101, as the method for claim 100, wherein coding DNA is identical with the coding DNA of first exon of target gene.

102, as the method for claim 101, wherein coding DNA is different with the coding DNA of first exon of target gene.

103,, wherein hit the sequence homology in target sequence and the target gene as the method for claim 102.

104,, wherein hit the upstream sequence homology of the coding region of target sequence and target gene as the method for claim 102.

105,, wherein hit the upstream sequence homology of the endogenous adjusting sequence of target sequence and target gene as the method for claim 102.

106, as the method for claim 102, construct wherein also contain with target gene in sequence homology second hit target sequence.

107, as the method for claim 102, the upstream sequence homologous second that construct wherein also contains with the coding of gene hits target sequence.

108, as the method for claim 102, wherein the upstream sequence homologous second that also contains with the endogenous adjusting sequence of target gene of construct hits target sequence.

109, as the method for claim 102, wherein construct also contains the selection marker that can increase.

110, the erythropoietin of producing as the method for claim 97.

111, as the erythropoietin of claim 110, wherein cell is that the people originates.

112, the protein of producing as the method for claim 97.

113, the protein as claim 112 is fused protein.

114, as the fused protein of claim 113, wherein endogenous gene is an erythropoietin gene.

115, DNA plasmid pREPO18.

116, can change the DNA construct of expression of target gene in the time of in being inserted into cell chromosome DNA, it comprises:

(a) hit target sequence;

(b) regulate sequence;

(c) exon;

(d) splice donor site;

(e) intron; With

(f) splicing-acceptor site.

117, the DNA construct of claim 116 is wherein hit the sequence homology in target sequence and the target gene.

118, the DNA construct of claim 116, the upstream sequence homology of wherein hitting the coding region of target sequence and target gene.

119, the DNA construct of claim 116 is wherein hit the upstream sequence homology of the endogenous adjusting sequence of target sequence and target gene.

120, the DNA construct of claim 116, wherein this construct also contain with target gene in sequence homology second hit target sequence.

121, the DNA construct of claim 116, wherein the upstream sequence homologous second that also contains with the coding region of target gene of this construct hits target sequence.

122, the DNA construct of claim 116, wherein the upstream sequence homologous second that also contains with the endogenous adjusting sequence of target gene of this construct hits target sequence.

123, homologous recombination somatic cell, it comprises adjusting sequence, exon, splicing-donor site, interior apparent son and the splicing-acceptor site that the volume that is imported into target gene through homologous recombination is compiled the upstream in district.

124, the homologous recombination somatic cell of claim 123, wherein target gene is an alpha-interferon genes.

125, the homologous recombination somatic cell of claim 124, wherein target gene is an erythropoietin gene.

126, homologous recombination somatic cell, it comprises dhfr gene, neo gene, CMV promoter, hGH exons 1 and a unpaired splicing-donor site, and this site is due to the upstream position of endogenous erythropoietin regulatory region.

127, the homologous recombination somatic cell of claim 126, it is to produce by the integration from the DNA of pREPO18.

128, make the somatic method of homologous recombination, wherein target gene expression is changed, and this method comprises the steps:

(a) use the DNA construct transfectional cell, this construct comprises:

(i) hit target sequence;

(ii) regulate sequence;

(iii) exon;

(iv) splicing-donor site;

(v) intron; With

(vi) splicing-acceptor site;

Wherein hit the integration of target sequence tutorial element (b)～(f) upstream, so that they are operably connected on first exon of target gene; With

(b) be suitable for keeping this transfected cell under the condition of homologous recombination.

129, the homologous recombination somatic cell of producing with the method for claim 128.

130, change the method that gene is expressed in cell, this method comprises the steps:

(a) use the DNA construct transfectional cell, this construct comprises:

(i) hit target sequence;

(ii) regulate sequence;

(iii) exon;

(iv) splicing-donor site;

(v) intron; With

(vi) splicing-acceptor site;

Wherein hit the integration of target sequence tutorial element (b)～(f) upstream, so that they are operably connected on first exon of target gene.

(b) be suitable for keeping this transfected cell under the condition of homologous recombination; With

(c) be suitable for keeping this homologous recombination somatic cell under the condition of gene expression.

131, express in cell and make method of protein by changing gene, it comprises the steps:

(a) use the DNA construct transfectional cell, this construct comprises:

(i) hit target sequence;

(i) regulate sequence;

(iii) exon;

(iv) splicing-donor site;

(v) intron; With

(vi) splicing-acceptor site;

Wherein hit the integration of target sequence tutorial element (b)～(f) upstream, so that they are operably connected on first exon of target gene;

(b) be suitable for keeping this transfected cell under the condition of homologous recombination; With

(c) be suitable for keeping this homologous recombination somatic cell under the condition of protein expression.

132, the method for claim 131, wherein target gene is α-dried excellent plain gene or erythropoietin gene.

133, activate the expression of endogenous gene in the vertebrate cells genomic DNA and the method for this gene that increases, this gene is not expressed in cell when obtaining, and does not perhaps express in cell with significant level when obtaining, and this method comprises the steps:

(a) use the DNA sequence transfectional cell, this sequence contains:

1) be selected from foreign DNA as next group:

The DNA sequence of the sequence that exists in a) repairing, change, the deletion formula displacement cell;

Or

B) for when obtaining, normally functionally in cell, not being connected to the endogenous base

DNA sequence because of last adjusting sequence;

2) with the homologous DNA sequence of genomic dna sequence of in cell, giving on the selection site.

3) but the DNA amplification of the alternative sign of coding produces the cell that contains this DNA sequence thus;

(b) be suitable for and genomic dna sequence homologous DNA sequence and genomic dna sequence between take place to keep the cell that is produced in (a) under the condition of homologous recombination, produce from the vertebrates source thus, have (a) (1), (a) (2) and (a) (3) be incorporated in the genomic DNA DNA sequence and (a) (1) functionally be connected on the endogenous gene outside the homologous recombination somatic cell of source DNA; With

(c) but under the condition of the amplification of the DNA amplification of selecting the alternative sign of coding, cultivate the homologous recombination somatic cell that is produced in (b), endogenous gene on the foreign DNA of the DNA amplification of the alternative sign of coding and functional being connected to (a) (1) is by coamplification thus, produce thus on the DNA sequence of the DNA amplification contain the alternative sign of coding and functional being connected to (a) (1) by the homologous recombination somatic cell of coamplification endogenous gene, the gene of coamplification is expressed therein.

134, DNA sequence location is driven into method in the genomic DNA of vertebrates source cell, this method comprises the steps:

(a) provide the DNA construct that comprises following ingredients:

1) coding will be in the vertebrates source cell foreign DNA of expressed products;

2) with the vertebrates source cell in the homologous DNA sequence of genomic dna sequence;

3) but the coding a kind of sign the DNA amplification sequence, can finish this sign in view of the above

Amplification copy select;

(b) DNA construct that provides in (a) is imported in the cell in vertebrates source, thereby produce the cell that the DNA construct that provides in (a) is provided;

(c) be suitable for and homologous DNA sequence of genomic dna sequence and genomic dna sequence between take place to keep the cell that is produced in (b) under the condition of homologous recombination,

Produce the homologous recombination somatic cell in vertebrates source thus with the DNA construct that is incorporated into (a) in the cell genomic dna; With

(d) but under the condition of the amplification effect of the DNA amplification of the alternative sign that is suitable for selecting encoding, cultivate the homologous recombination somatic cell that produces in (b), but thus the foreign DNA of the DNA amplification of the alternative sign of coding and (a) (1) by coamplification,

Thereby produce the homologous recombination somatic cell of the exogenous gene that contains alternative DNA amplification that indicates of coding and coamplification, wherein this cell can be expressed the exogenous gene of coamplification.

135, claim 133 and 134 method, wherein vertebrate cells is elementary or secondary cell.

136, the method for claim 135, wherein elementary or secondary cell is a mammalian cell.

137, the method for claim 136, wherein elementary or secondary cell is people's cell.

138, the method for claim 133 or claim 134, wherein vertebrate cells is the permanence cell.

139, the method for claim 138, wherein the permanence cell is a mammal.

140, the method for claim 138, wherein the permanence cell is the people source.

The method of any one in 141 claim 133～140, but wherein the DNA amplification coding of the alternative sign of coding is selected from following group alternative sign: dihydrofolate reductase, ADA Adenosine deaminase and CAD.

142, the method for any one in the claim 133～134, wherein DNA construct also comprises (a) additional positive selection marker, (b) negative selection marker, or (c) additional positive selection marker and negative selection marker.

143, the method for claim 142, wherein additional positive selection marker is neo.

144, the method for claim 142, wherein positive selection marker is neo, and negative selection marker is gpt or HSV-TK gene.

145, the method for any one in the claim 133～144, wherein the gene code that will be expressed is selected from the product in following group: hormone, cytoplastin, antigen, antibody, enzyme, thrombin, transport protein matter, receptor, adjusting protein, structural protein, transcription factor, antisense RNA and ribozyme (ribozgme), and natural non-existent protein and nucleic acid.

146, the method for any one in the claim 133～144, wherein the endogenous gene coding is selected from following treatment product: human growth hormone, insulin human, people's pancreotropic hormone and human forcing erythrogenin.

147, the homologous recombination somatic cell of producing with the method for aforementioned any one claim.

148, the method for any one in the claim 133～140, the wherein endogenous gene of desire expression or exogenous gene coding therapeutic product.

149, the method for claim 148, wherein DNA construct also contains (a) additional positive selection marker, (b) negative selection marker, or (c) additional positive selection marker and negative selection marker.

150, the method for claim 149, wherein additional positive selection marker is neo.

151, the method for claim 140, wherein positive selection marker is neo, and negative selection marker is gpt or HSV-TK gene.

152, the method for any one in the claim 148～151, wherein the gene code that will express is selected from following product: hormone, cytoplastin, antigen, antibody, enzyme, thrombin, transport protein matter, receptor, adjusting protein, structural protein, transcription factor, antisense RNA and ribozyme (ribozyme), and natural non-existent protein and nucleic acid.

153, the method for claim 152, wherein endogenous gene or exogenous gene coding is selected from following therapeutic product: human growth hormone, insulin human, people's pancreotropic hormone and human forcing erythrogenin.

154, the homologous recombination somatic cell of producing with the method for any one in the claim 148～153.

155, primary cell of producing with the method for any one in the claim 133～137 and 141～146 and secondary cell with and in treatment, for example application in mammal or people's treatment.

156, the cell of being produced by the method for any one in claim 133～137 and 141～146 is used for the application of gene therapy medicine in manufacturing.

157, be suitable for being introduced in the mammal, and seal barrier device up for safekeeping by the cell of the method institute new production of claim 148, wherein this barrier device is made by such material, in the time of promptly in this device is introduced food in one's mouth animal body, can make that the therapeutic product is penetrating to be entered in mammiferous circulating system or the tissue, and group end vertebrate cells in the growth of barrier device outside and mammiferous immune system to this cellular rejection effect.

158, the method for the treatment product of effective dose is provided to mammal, comprise in mammalian body the cell that the method for introducing claim 148 is produced, wherein introducing the intravital cell of mammal seals up for safekeeping among barrier device, wherein barrier device is made by such material, the therapeutic product is penetrated in mammiferous circulation and the tissue, and stop vertebrate cells, and stop of the repulsive interaction of mammiferous immune system to this cell in the growth of barrier device outside.

159, the method for the therapeutic product of effective dose is provided to mammal, comprises and in mammalian body, introduce the cell of producing by the method for claim 148.

160, the method for the therapeutic product of effective dose is provided to the people, comprises and in human body, introduce the cell of producing by the method for claim 148.

161, the method for produced in vitro therapeutic protein is included in the homologous recombination somatic cell that is suitable for cultivating under the condition that therapeutic protein expresses claim 141, thereby by this therapeutic protein of cellular expression of claim 141.

162, use the microbial cell of the intronless copy of the people's gene that contains the therapeutic protein of encoding, in the method for produced in vitro therapeutic protein, this method comprises the steps:

(a) DNA construct is introduced in people's cell, this construct comprises:

1) retrovirus retrovirus LTR;

2) be coded in the gene of selecting in the microbial cell with sign;

3) can promote the adjusting sequence that therapeutic protein is expressed in microbial cell;

4) coding can promote the DNA of therapeutic protein excretory leader peptide from microbial cell;

5) be enough to instruct the sequence of DNA construct and human gene group DNA's sequence homology reorganization, the first amino acid whose DNA is adjacent and at its upstream in said human gene group DNA and the coding therapeutic protein,

Produce the cell that contains DNA construct thus,

(b) be suitable for and homologous DNA sequence of genomic dna sequence and genomic dna sequence between take place to keep the cell that is produced in (a) under the condition of homologous recombination, produce the homologous recombination somatic cell with the DNA construct that is incorporated into (a) in the genomic DNA thus, said genomic DNA is adjacent to also being connected at its upstream and functionally on the gene of this therapeutic protein of coding;

(c) import the DNA construct that comprises following ingredients in the homologous recombination somatic cell that will in (b), produce,

1) can instruct the DNA sequence of the transcription pausing in the microbial cell;

2) can instruct the DNA sequence of dna replication dna in the microbial cell;

3) retrovirus LTR;

4) be enough to instruct this DNA construct and therapeutic protein to stop people's base of codon

Sequence because of group DNA sequence downstream homologous recombination; Produce to have thus and be incorporated into

The DNA construct of (a) in the genomic DNA also contains the homologous recombination somatic cell of the DNA construct of (c),

(d) be suitable for and homologous DNA sequence of genomic dna sequence and genomic dna sequence between the cell of generation (c) in takes place to keep under the condition of homologous recombination, produce the existing genomic DNA upstream that has been incorporated into the gene of coding therapeutic protein thus, and functionally be connected in (a) DNA construct on this gene, contain the gene downstream that has been incorporated into the coding therapeutic protein again, and functionally be connected in the homologous recombination somatic cell of the DNA construct of (c) on this gene;

(e) instruct at (a) and the transcribing of RNA product of the DNA sequence between the introducing LTRs (c) being suitable for retrovirus LTR, cultivate the cell that produces in (d) under the condition of processing and reverse transcription, produce the DNA sequence of the intronless DNA copy that contains coding human cytokines plasmagene thus, the gene of said coding therapeutic protein is operably connected on the DNA sequence that comprises the DNA construct described in (a), but and be connected on the DNA sequence that contains the DNA construct described in (c) with mode of operation, this sequence is referred to as the intronless DNA sequence in this article;

(f) from cell, separate the intronless DNA sequence that produces in (e);

(g) isolated DNA in (f) is imported in the microbial cell, produce the microbial cell that contains the DNA that produces in (e) thus;

(h) in the presence of the selective preparation that can select the alternative sign that exists in the DNA construct described in (a), cultivate the microbial cell that is produced in (g);

(i) be suitable for that therapeutic protein is expressed in microbial cell and excretory condition under, cultivate the cell that produces in (h), thereby in microbial cell, produce therapeutic protein, and therefrom secrete this protein;

(j) from microbial cell, separate the therapeutic protein that produces in (i).

163, the method for claim 162, wherein microbial cell is saccharomyces cerevisiae or Bacillus coli cells.

164, start the method for the gene expression of desire expression, this gene is present in the cell, but do not express in its archeocyte when obtaining, in the archeocyte when obtaining, do not express in other words with significant level, this method is included under the condition that is suitable for homologous recombination, the DNA construct that will contain regulatory region imports in this cell, thereby being inserted into, desires in the expressing gene regulatory region this regulatory region, this desires the regulatory region of expressing gene perhaps all or part of displacement, and functionally be connected on the gene of desire expression, thereby produced the homologous recombination somatic cell of expressing this gene.

165, the method for claim 164, the archeocyte when wherein obtaining are the permanence cells.

Images