CN111944834A - Recombinant vector, recombinant protein and virus-like particle of human papilloma virus 16 type epitope chimeric L1 as well as preparation and application thereof - Google Patents

Abstract

The invention constructs a virus-like particle system containing the human papilloma virus 16 type epitope chimeric DNA fragment, firstly, the virus-like particle system containing the human papilloma virus 16 type E7_49‑57Connection of L1DNA fragment of epitope chimeric major capsid protein on plasmid pET28a to construct recombinant plasmid pET28a-16L1-E7_49‑57Then transferring the recombinant protein into escherichia coli for culture to obtain recombinant protein, and further performing self-assembly to obtain virus-like particles (VLPs)(ii) a The assembled epitope chimeric virus-like particle can simultaneously stimulate humoral and cellular immune responses.

Description

Recombinant vector, recombinant protein and virus-like particle of human papilloma virus 16 type epitope chimeric L1 as well as preparation and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a recombinant vector, a recombinant protein and a virus-like particle containing human papilloma virus 16 type epitope chimeric L1, and preparation and application thereof.

Background

Cervical cancer is one of the most common malignancies in women, with the second highest incidence and the progressive trend toward younger onset. According to the report of the world health organization, 57 thousands of new cervical cancer cases and 31.1 thousands of death people in 2018 all around the world seriously harm the health of women. At present, the research on the preventive vaccine for cervical cancer is successful, the HPV vaccines on the international market are respectively tetravalent vaccine best-modification-4 (Gardasil-4) and nine-valent vaccine best-modification-9 (Gardasil-9) produced by Moshadong company, and bivalent vaccine Shirui adapter (Cervarix) produced by Kurarin Scker company, and all the three vaccines are VLPs self-assembled by HPV L1 capsid protein expressed in vitro as effective antigens, and are mixed with adjuvant to induce organism to generate neutralizing antibody. Such vaccines are effective in preventing high risk HPV viral infections, but are not effective in people already infected with HPV.

Human Papilloma Virus (HPV) infection is a major cause of cervical cancer in women. It is known that there are over 200 subtypes of HPV found, among which HPV16 and 18 belong to the most carcinogenic types among high-risk types, and more than 70% of cervical cancer lesions are caused thereby. HPV vaccine is one of the effective means for controlling cervical cancer. The major capsid protein L1 of HPV can be expressed separately and self-assembled into virus-like particles (VLPs). VLPs have a structure highly similar to that of natural viruses, and can stimulate the production of high-titer neutralizing antibodies after immunization of the VLPs, and HPV prophylactic vaccines developed using the VLPs are currently used clinically. However, such vaccines induce a weak cellular immune response in the body. The E7 protein encoded by the early transcribed region (region E) of the HPV genome is critical for causing malignant transformation of cells. E7_49-57Epitopes induce differentiation of T lymphocytes into Cytotoxic T Lymphocytes (CTL).

Disclosure of Invention

Based on the above technical problems, one of the objects of the present invention is to provide a pharmaceutical composition containing human papillomavirus type 16E 7_49-57Epitope chimeric L1DNA fragment.

Another object of the present invention is to provide a pharmaceutical composition containing human papillomavirus type 16E 7_49-57Recombinant vector of epitope chimeric L1DNA fragment.

It is another object of the present invention to provide a pharmaceutical composition comprising human papillomavirus type 16E 7_49-57A method for constructing a recombinant vector of the epitope chimeric L1DNA fragment.

The fourth purpose of the invention is to provide a medicine containing human papilloma virus 16 type E7_49-57Epitope chimeric L1 recombinant protein.

The invention also provides a human papilloma virus 16E 7-containing food_49-57A method for constructing epitope chimeric L1 recombinant protein.

The invention aims at providing a medicine containing human papilloma virus 16 type E7_49-57Epitope chimeric L1 virus-like particles.

The seventh object of the present invention is to provide a pharmaceutical composition containing human papillomavirus type 16E 7_49-57A method for preparing virus-like particles of epitope chimeric L1.

Another object of the present invention is to provide a pharmaceutical composition containing human papillomavirus type 16E 7_49-57Use of a virus-like particle with epitope chimeric L1 in the preparation of a human papilloma virus vaccine.

The technical scheme provided by the invention is as follows:

containing human papilloma virus 16 type E7_49-57The epitope is chimeric with L1DNA fragment, and the sequence of the DNA fragment is shown as SEQ ID NO. 1.

Containing human papilloma virus 16 type E7_49-57The recombinant vector of epitope chimeric L1DNA fragment comprises a vector and a gene fragment HPV16L1-E7_49-57；

Wherein, the gene segment HPV16L1-E7_49-57A DNA fragment consisting of a base sequence shown in SEQ ID NO. 1.

Preferably, the vector is plasmid pET28 a.

Containing human papilloma virus 16 type E7_49-57The construction method of the recombinant vector of the epitope chimeric L1DNA fragment comprises the following steps:

using pGEM-Teasy-16L1-E7_49-57As a template, a DNA fragment consisting of the base sequence shown in SEQ ID NO.1 was obtained by PCR amplification using the primer sequences shown in SEQ ID NO.2 and SEQ ID NO.3 and constructed on pET-28a plasmid to obtain a recombinant plasmid pET28a-16L1-E7_49-57。

Containing human papilloma virus 16 type E7_49-57The recombinant protein of epitope chimeric L1 comprises a protein consisting of an amino acid sequence shown in SEQ ID NO. 4.

Containing human papilloma virus 16 type E7_49-57Construction method of epitope chimeric L1 recombinant protein, and application of recombinant protein containing human papilloma virus 16 type E7_49-57A recombinant vector of epitope chimeric L1DNA fragment, comprising the following processes:

the recombinant plasmid pET28a-16L1-E7_49-57Transferring the bacillus coli BL21 into the bacillus coli BL21, culturing, collecting thalli and purifying to obtain recombinant protein;

wherein the recombinant protein contains protein consisting of an amino acid sequence shown in SEQ ID NO. 4.

Containing human papilloma virus 16 type E7_49-57The virus-like particle of epitope chimeric L1 comprises protein consisting of an amino acid sequence shown as SEQ ID NO. 4.

Containing human papilloma virus 16 type E7_49-57A method for producing a virus-like particle having epitope-chimeric L1, using said recombinant protein, comprising:

and adding a reducing agent into the recombinant protein for acting, and dialyzing in an assembly liquid to obtain the self-assembled virus-like particles.

The human papilloma virus-containing 16 type E7 is used_49-57Use of a virus-like particle with epitope chimeric L1 in the preparation of a human papilloma virus vaccine.

Compared with the prior art, the invention has the following beneficial effects: dominant CTL epitope E7_49-57The VLPs formed by embedding the VLPs in the site have uniform particle size and morphologyThe structure is full, good in stability and high in similarity with wild type VLPs, and the structure is very important for exciting the immune response of organisms. Construction of HPV16L1-E7_49-57After the gene mutant is expressed by using escherichia coli, the cost is low, the yield of VLPs is high, and after a mouse is immunized by the chimeric VLPs, the humoral immune response of the mouse can be stimulated to generate a neutralizing antibody and generate stronger cellular immune response.

Drawings

FIGS. 1a and 1b are schematic diagrams illustrating the prediction of optimal chimeric sites according to the present invention.

FIG. 2 shows the recombinant plasmid pET28a-16L1-E7 of the present invention_49-57Schematic representation of the PCR identification of (1).

FIG. 3 is HPV16L1-E7 according to the invention_49-57SDS-PAGE analysis of protein expression.

FIG. 4 is HPV16L1-E7 according to the invention_49-57Schematic representation of protein solubility identification.

FIG. 5 is HPV16L1-E7 according to the invention_49-57SDS-PAGE analysis of protein purification.

FIG. 6 is HPV16L1-E7 according to the invention_49-57Schematic diagram of Western blot analysis of protein purification.

FIG. 7 shows E7 according to the present invention_49-57Schematic particle size analysis of chimeric VLPs.

FIG. 8 shows E7 according to the present invention_49-57Schematic representation of the chimeric VLPs by electron microscopy.

FIG. 9 is a schematic representation of the immune serum neutralization assay of the present invention.

FIGS. 10 a-10 c are schematic diagrams of the detection of Th1 type cytokine levels according to the present invention.

FIGS. 10 d-10 f are schematic diagrams of the detection of Th2 type cytokine levels according to the present invention.

Detailed Description

The present invention is further described in detail below with reference to the attached drawings so that those skilled in the art can implement the invention by referring to the description text.

The invention constructs a human papilloma virus 16E 7_49-57Epitope chimeric L1 virus-like particles, firstContaining human papilloma virus 16 type E7_49-57Connection of epitope chimeric L1DNA fragment to plasmid pET28a to construct recombinant plasmid pET28a-16L1-E7_49-57Then transferring the recombinant protein into escherichia coli for culture to obtain recombinant protein, and further performing self-assembly to obtain virus-like particles (VLPs); the assembled virus-like particles can stimulate the mouse to generate a humoral and a cellular immune response at the same time.

The "recombinant vector" in the present invention refers to an expression vector to which a gene has been ligated, and "recombinant plasmid" and "recombinant vector" may be used interchangeably.

Examples

Main experimental materials

1. Plasmids, cells and animals

293FT cells were purchased from Biovector NTCC; the pET28a plasmid was purchased from TaKaRa; plasmid pShell16 was purchased from addrene; pcDNA3.1-Luc⁺Purchased from BioVector NTCC; balb/c mice were purchased from the animal center of Bai Cai medical college, Jilin university.

2. Reagents, enzymes, pharmaceuticals and instruments

BamH I, Xho I endonucleases were purchased from TaKaRa; coli BL21(DE3) and DH5 alpha competent cells were purchased from Biotechnology GmbH of Beijing ancient China; the plasmid miniprep kit and the agarose gel DNA recovery kit are purchased from Tiangen company; PVDF membrane, ECL chemiluminescence kit and HRP-labeled goat anti-mouse IgG were purchased from Biyuntian corporation; murine anti-HPV 16L1 monoclonal antibody was purchased from Abcam, UK; DMEM, 1640 medium was purchased from GIBCO, USA; Bright-Glo^TMLuciferase Assay system available from Promega corporation, usa; e7_49-57Peptides were synthesized by Shanghai Biotech; multi-factor flow analysis kit (LEGENDplex)^TMMouse Th1/Th2) from BioLegend, USA; other reagents are all domestic analytical purifiers. Nanosized particle size potentiometers Zetasizer Nano ZS90(Malvern, uk); transmission electron microscope H-7650(Hitachi, Japan); AKTA protein purification system (GE, usa); pre-loaded nickel column His Trap FF (GE-Healthcare, USA); microplate reader (Bio-Rad, USA); flow cytometer C6(BD, usa).

The experimental process comprises the following steps:

1、pET28a-16L1-E7_49-57construction of recombinant plasmid

(1) Target gene fragment HPV16L1-E7_49-57Design of

High resolution crystal structure of HPV16L1 Protein was obtained as a motif in Protein Data Bank (PDB), and L1-optimized E7 was analyzed by homology modeling using molecular simulation software Discovery Studio (version 2.1) in the BC, DE, EF and HI loop regions, respectively_49-57Epitope chimeric site, E7 is inserted into the predicted optimal chimeric site of HPV16L1 gene sequence (GenBank, sequence number: KU721788.1)_49-57The gene sequence is optimized by using http:// www.jcat.de/sequence to obtain HPV16L1-E7_49-57The gene fragment is synthesized by Shanghai Czeri bioengineering GmbH and is constructed on the plasmid pGEM-Teasy to obtain pGEM-Teasy-16L1-E7_49-57；

As shown in fig. 1, HI loop region 355/356 of HPV16L1 was determined as an optimal epitope-chimerism site by homology simulation with molecular simulation software Discovery Studio (version 2.1);

an upstream end primer:

5'-CGCGGATCCATGCCGTCTGAAGCGACC-3'(SEQ ID NO.2)；

a downstream end primer:

5'-GGCGAGCTCTTAGTGATGGTGATGGTGATGAAATTTCGGTTTAGCTTTCAG-3'(SEQ ID NO.3)；

(2) PCR amplification of target gene fragment HPV16L1-E7_49-57

Using pGEM-Teasy-16L1-E7_49-57Using the primer sequences shown in SEQ ID NO.2 and SEQ ID NO.3 as a template to obtain a DNA fragment of the nucleotide sequence shown in SEQ ID NO.1 through PCR amplification, namely the target gene fragment HPV16L1-E7_49-57；

The PCR reaction conditions are as follows: 94 ℃ for 5 min; 94 ℃,30 sec; 55 ℃ for 30 sec; 72 ℃, 1.5min, 30 cycles; 72 ℃ for 10 min;

ATGCCGTCTGAAGCGACCGTGTATCTGCCGCCGGTGCCGGTGTCTAAAGTGGTGTCTACCGATGAATATGTGGCGCGTACCAACATCTACTACCACGCTGGTACCTCTCGTCTGCTGGCTGTTGGTCACCCGTACTTCCCGATCAAAAAACCGAACAACAACAAAATCCTGGTTCCGAAAGTTTCTGGTCTGCAGTACCGTGTTTTCCGTATCCACCTGCCGGACCCGAACAAATTCGGTTTCCCGGACACCTCTTTCTACAACCCGGACACCCAGCGTCTGGTTTGGGCTTGCGTTGGTGTTGAAGTTGGTCGTGGTCAGCCGCTGGGTGTTGGTATCTCTGGTCACCCGCTGCTGAACAAACTGGACGACACCGAAAACGCTTCTGCTTACGCTGCTAACGCTGGTGTTGACAACCGTGAATGCATCTCTATGGACTACAAACAGACCCAGCTGTGCCTGATCGGTTGCAAACCGCCGATCGGTGAACACTGGGGTAAAGGTTCTCCGTGCACCAACGTTGCTGTTAACCCGGGTGACTGCCCGCCGCTGGAACTGATCAACACCGTTATCCAGGACGGTGACATGGTTGACACCGGTTTCGGTGCTATGGACTTCACCACCCTGCAGGCTAACAAATCTGAAGTTCCGCTGGACATCTGCACCTCTATCTGCAAATACCCGGACTACATCAAAATGGTTTCTGAACCGTACGGTGACTCTCTGTTCTTCTACCTGCGTCGTGAACAGATGTTCGTTCGTCACCTGTTCAACCGTGCTGGTGCTGTTGGTGAAAACGTTCCGGACGACCTGTACATCAAAGGTTCTGGTTCTACCGCTAACCTGGCTTCTTCTAACTACTTCCCGACCCCGTCTGGTTCTATGGTTACCTCTGACGCTCAGATCTTCAACAAACCGTACTGGCTGCAGCGTGCTCAGGGTCACAACAACGGTATCTGCTGGGGTAACCAGCTGTTCGTTACCGTTGTTGACACCACCCGTTCTACCAACATGTCTCTGTGCGCTGCTATCTCTACCTCTGAAACCACCTACAAACGCGCCCATTATAACATCGTGACCTTTAACACCAACTTCAAAGAATACCTGCGTCACGGTGAAGAATACGACCTGCAGTTCATCTTCCAGCTGTGCAAAATCACCCTGACCGCTGACGTTATGACCTACATCCACTCTATGAACTCTACCATCCTCGAGGACTGGAACTTCGGTCTGCAGCCGCCGCCGGGTGGTACCCTGGAAGACACCTACCGTTTCGTTACCTCTCAGGCTATCGCTTGCCAGAAACACACCCCGCCGGCTCCGAAAGAAGACCCGCTGAAAAAATACACCTTCTGGGAAGTTAACCTGAAAGAAAAATTCTCTGCTGACCTGGACCAGTTCCCGCTGGGTCGTAAATTCCTGCTGCAGGCTGGTCTGAAAGCTAAACCGAAATTTCATCACCATCACCATCACTAA(SEQ ID NO.1)；

(3) electrophoresis and recovery of PCR products

The PCR product was electrophoresed with 1% agarose gel, and gel recovery was carried out according to the instructions of the kit, as follows: placing the cut target gel block into an EP tube weighed in advance after electrophoresis, obtaining the weight of the gel block, adding a PN solution with the same volume, carrying out water bath at 56 ℃ for 10min, transferring to an adsorption column after fully dissolving the gel, standing for 10min, centrifuging at 12000rpm for 1min, discarding waste liquid in a collection tube, adding 600 mu L of PW solution into the adsorption tube, centrifuging at 12000rpm for 1min, repeating the step for 2 times, centrifuging the empty tube at 12000rpm for 2min, airing at room temperature for 10min, transferring the adsorption column into a clean EP tube, adding 50 mu L of sterile water, centrifuging at 12000rpm for 1min, storing at-20 ℃ for later use.

(4) Recombinant vector pET28a-16L1-E7_49-57Is connected to

Connecting the PCR amplification product after double enzyme digestion and a pET28a vector at 16 ℃ overnight, adding the connection product into escherichia coli DH5 alpha competent cells, carrying out ice bath for 30min, carrying out heat shock at 42 ℃ for 90s, adding nonresistant LB, carrying out shake culture at 37 ℃ with 180rpm in a shaking table for 1h, carrying out short-time centrifugation, removing most of supernatant, blowing the thalli evenly, spreading the thalli on a plate containing X-gal and IPTG, and carrying out inverted culture overnight. The next day, white spots were picked and incubated overnight at 37 ℃ with shaking at 220rpm on a shaker.

Plasmid extraction was performed according to the kit instructions, as follows: taking 3mL of overnight-cultured bacterial liquid, centrifuging at 12000rpm for 1min to collect thalli, sequentially adding 250 mu L P1 solution to resuspend the thalli, adding 250 mu L P2 solution, reversing and uniformly mixing, adding 350 mu L P3 solution, reversing and uniformly mixing, centrifuging the obtained solution at 12000rpm for 15min, sucking supernatant, placing the supernatant in an adsorption column, standing for 10min, centrifuging at 12000rpm for 1min, removing waste liquid in the collection tube, adding 600 mu L of PW solution into the adsorption tube, centrifuging at 12000rpm for 1min, repeating the steps for 2 times, centrifuging at 12000rpm for 2min, drying at room temperature for 10min, transferring the adsorption column into a clean EP tube, adding 50 mu L of sterile water, centrifuging at 12000rpm for 1min to obtain plasmids, carrying out PCR identification, carrying out amplification conditions are the same, and sending the correctly-identified plasmids to Shanghai biological engineering works, Heiguan Limited company for sequencing.

As shown in FIG. 2, pET28a-16L1-E7_49-57The recombinant plasmid is identified by PCR, the obtained target gene band is 1400bp, which is consistent with the expected result, the plasmid is subjected to nucleic acid sequencing, and the result shows that the sequence is correct.

2、HPV16L1-E7_49-57Induced expression and purification of proteins

The positive cloning plasmid was transferred into E.coli BL21(DE3), inoculated in LB liquid medium (containing 50. mu.g/mL kanamycin), and shake-cultured at 37 ℃ and 180 r/min. 0.2mM IPTG was induced overnight at 16 ℃. Binding buffer (200mM NaCl,50mM imidazole, pH 7.4) was added to the collected pellet at a ratio of 1:10, and sonicated on ice for 15 min. And respectively collecting the supernatant and the precipitate, performing SDS-PAGE electrophoresis, and identifying the expression and the solubility of the target protein. Subjecting the supernatant to HisTrap FF affinity chromatography using an Elution buffer(20mM NaH₂PO₃150mM NaCl,300mM imidazole, pH 7.4) and SDS-PAGE to identify the protein purification.

Recombinant bacteria express HPV16L1-E7 after IPTG induction_49-57Protein, the supernatant and the precipitate of the induced thallus are respectively identified by SDS-PAGE electrophoresis; as shown in FIGS. 3 and 4, a specific band was observed at 55KD after induction, indicating successful induction expression of the protein. Detecting that the supernatant and the precipitate after the ultrasonic cell disruption contain target protein, and the concentration of the target protein in the supernatant is higher, and preliminarily judging that the target protein is soluble protein; as shown in fig. 5, the supernatant after induction expression of the recombinant bacteria is collected, and subjected to nickel column His Trap FF affinity chromatography, elution fractions are collected, and SDS-PAGE electrophoresis results show that higher-purity target protein is obtained after nickel column purification, namely the protein consisting of the amino acid sequence shown in SEQ ID No. 4;

Met Pro Ser Glu Ala Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp Glu Tyr Val Ala Arg Thr Asn Ile Tyr Tyr His Ala Gly Thr Ser Arg Leu Leu Ala Val Gly His Pro Tyr Phe Pro Ile Lys Lys Pro Asn Asn Asn Lys Ile Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val Phe Arg Ile His Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly Val Glu Val Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly His Pro Leu Leu Asn Lys Leu Asp Asp Thr Glu Asn Ala Ser Ala Tyr Ala Ala Asn Ala Gly Val Asp Asn Arg Glu Cys Ile Ser Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Ile Gly Glu His Trp Gly Lys Gly Ser Pro Cys Thr Asn Val Ala Val Asn Pro Gly Asp Cys Pro Pro Leu Glu Leu Ile Asn Thr Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met Asp Phe Thr Thr Leu Gln Ala Asn Lys Ser Glu Val Pro Leu Asp Ile Cys Thr Ser Ile Cys Lys Tyr Pro Asp Tyr Ile Lys Met Val Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Tyr Leu Arg Arg Glu Gln Met Phe Val Arg His Leu Phe Asn Arg Ala Gly Ala Val Gly Glu Asn Val Pro Asp Asp Leu Tyr Ile Lys Gly Ser Gly Ser Thr Ala Asn Leu Ala Ser Ser Asn Tyr Phe Pro Thr Pro Ser Gly Ser Met Val Thr Ser Asp Ala Gln Ile Phe Asn Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Ser Leu Cys Ala Ala Ile Ser Thr Ser Glu Thr Thr Tyr Lys Arg Ala His Tyr Asn Ile Val Thr Phe Asn Thr Asn Phe Lys Glu Tyr Leu Arg His Gly Glu Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala Asp Val Met Thr Tyr Ile His Ser Met Asn Ser Thr Ile Leu Glu Asp Trp Asn Phe Gly Leu Gln Pro Pro Pro Gly Gly Thr Leu Glu Asp Thr Tyr Arg Phe Val Thr Ser Gln Ala Ile Ala Cys Gln Lys His Thr Pro Pro Ala Pro Lys Glu Asp Pro Leu Lys Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln Ala Gly Leu Lys Ala Lys Pro Lys Phe His His His His His His(SEQ ID NO.4)

3. western blot identification of HPV16L1-E7_49-57Recombinant proteins

HPV16L1-E7_49-57After the protein is separated by SDS-PAGE electrophoresis, the protein is transferred to a PVDF membrane by a semi-dry transfer method under the conditions of 20V and 30 min. The PVDF membrane after transfer printing is sealed by 5 percent skim milk powder for 1 hour at room temperature. Respectively using HPV16L1 monoclonal antibody as primary antibody (1:3000) and HRP-labeled goat anti-mouse IgG as secondary antibody (1:10000) to incubate with PVDF membrane at 37 ℃ for 1h, performing ECL luminescence and color development analysis on immunoblotting, and detecting HPV16L1-E7_49-57Whether the protein expression is correct.

As shown in FIG. 6, the protein immunoblot (Western blot) showed that the target band appeared at 55kD, confirming that the target protein was expressed correctly.

4、E7_49-57Assembly and purification of chimeric VLPs

To purified HPV16L1-E7_49-57DTT was added to the protein to a final concentration of 10mM and allowed to react well for 2h at 4 ℃. Dialyzing for 72h in the assembly solution until it is self-assembled to E7_49-57Chimeric VLPs. Slowly adding self-assembled E7 on the 30% (w/w) sucrose/PBS layer_49-57The mixture of chimeric VLPs was centrifuged at 27000 r/min at 4 ℃ for 3 hours, and the pellet (small yellow round spot-like substance) was resuspended in 1mL of PBS. The resuspension solution was slowly added to 10mL of 29% CsCl solution along the tube wall, and the pellet was collected after centrifugation at 35000 r/min at 4 ℃ for 20 h.

After filtration of the chimeric VLPs samples through 0.22 μm filters, the size of the virus-like particles was measured by a Malvern Zetasizer Nano ZS90 nanometer size potential analyzer and the data was analyzed by Zetasizer Software.

And (3) dripping the sample on a copper net sprayed with carbon, standing for 5min, dripping 2% potassium phosphotungstate for dyeing, standing for 5min, and naturally half-drying and fixing. The magnification of a transmission electron microscope is set to be 50000 times, the voltage is set to be 80kV, and the particle morphology of the sample is observed.

E7 after in vitro assembly, as shown in FIGS. 7 and 8_49-57The chimeric VLPs are subjected to dynamic light scattering particle size analysis and transmission electron microscope detection, a large number of spherical particles with morphological structures and diameters (50-55 nm) basically consistent with those of wild VLPs can be observed, and the particle sizes are uniform, which indicates that the HPV16L1-E7_49-57Proteins successfully self-assemble into VLPs in vitro.

5、E7_49-57Detection of immunogenicity of chimeric VLPs

(1) Pseudovirus packaging and titer detection

The structural gene expression plasmid pShell16 and the fluorescent protein report plasmid pcDNA3.1-Luc⁺Co-transfection of 1X 10⁷293FT cells, transfection ratio of 1: 4. After incubation at 37 ℃ for 6h, fresh DMEM complete medium was replaced and incubation continued for 40 h. The cells were collected, added with an equal volume of lysate and incubated for a further 16h at 37 ℃ and NaCl solution was added to a final concentration of 0.85 mM. The mixture is ice-cooled for 20min, centrifuged at 12000 r/min at 4 ℃ and the supernatant is collected, filtered by a 0.45 mu m filter and split-packaged, and stored at-80 ℃ for later use. Pseudovirus was diluted 10-fold in 6 gradients, with 4 wells per dilution, 100 μ L per well in 96-well plates. 293FT cells were plated in 96-well plates at 3X 10 cells per well⁴Mix with pseudovirus diluent at a ratio of 100. mu.L. After 72h incubation, 50. mu.L of medium was taken per well and an equal volume of Bright-Glo was added^TMThe Luciferase Assay reagent acts for 5min, the Luciferase activity value is detected by an enzyme labeling instrument, a 10-time blank control group is used as a cutoff value, and the Reed-Muench method is adopted to calculate the pseudovirus titer (CCID)₅₀) The results showed that the titer of the pseudovirus was 10^5.9/100μL。

(2) Immune serum neutralization assay

24 Balb/c mice were divided equally into 3 groups, in order E7_49-57Group of chimeric VLPs, group of wild-type HPV16 VLPs and group of PBS, in terms of Al (OH)₃Is an adjuvant. Mice were immunized by intraperitoneal injection at weeks 0, 2, and 4. Collecting blood from tail vein at 0, 1, 2, 3, 4, and 6 weeks, collecting serum, and storing at-80 deg.C. 293FT cells were plated in 96-well plates at 3X 10 cells per well⁴One/100. mu.L. The test sera were diluted 4-fold (initial dilution 1: 20). Dilution of serum and pseudovirus (400 CCID)₅₀50 mu L) are mixed, ice bath is carried out for 1h, 100 mu L of the mixture is added into a cell plate, incubation is carried out for 72h, and the titer of the pseudovirus is calculated;

as shown in fig. 9, at 400CCID₅₀Positive seroneutralization titers were measured by 50. mu.L pseudovirus inoculation. E7 after initial immunization_49-57The log10 mean value of the neutralizing antibody titer in serum of mice in the group of chimeric VLPs was 2.63; with 2 and 3 immunizations, neutralizing antibody titers increased significantly, reaching a mean log10 value of 4.23 at week 6. The mean value of the serum neutralizing antibody titer log10 of mice in the wild type HPV16 VLPs group after primary immunization is 3.17, the mean value of log10 at 6 weeks after boosting immunization reaches 4.45, and the mean value of E7_49-57The neutralizing antibody titer of the chimeric VLPs group was slightly lower than that of the wild-type HPV16 VLPs group (χ)²＝7.575，P<0.05)。

(3) Th1 and Th2 type cytokine assay

Spleens from each group of mice were isolated 3 weeks after the second immunization. Placing spleen on 200 mesh sieve, soaking lymphocyte separation liquid, and grinding with syringe piston. The cell suspension was transferred to a 15mL centrifuge tube, 1mL of pre-cooled 1640 medium was added slowly and centrifuged at 2000r/min for 10 min. Taking a light white lymphocyte layer, centrifuging at 2000r/min for 5min to collect lymphocytes, adding 5mL of precooled erythrocyte lysate, uniformly mixing, standing at room temperature for 2min, centrifuging to collect precipitates, adding precooled 1640 culture solution for resuspension, and centrifuging to collect cell precipitates. The cells were washed 2 times with PBS and adjusted to a cell concentration of 5X 10⁵One/100. mu.L. Adding E7 into the cell culture solution_49-57Peptide 5. mu.g/mL, 37 ℃, 5% CO₂Cells were cultured under conditions of stimulation for 24 h. Detecting Th1 and Th2 type cytokines by flow cytometry according to the instructions of flow multifactorial analysis kit, using BioLegend LEGENDplex^TMAnalyzing the flow data by software to obtain the concentration value of the measured cell factor; data were statistically described and analyzed using SPSS 22.0. Comparison of differences between groups was carried out using χ²And (6) checking. With p<0.05 is statistically significant;

as shown in FIGS. 10a to 10c, mouse spleen lymphocytes were transfected with E7_49-57Detection of Th cell cytokine secretion by flow multifactorial assay after in vitro peptide stimulation, E7_49-57Chimeric VLPs stimulate mice to secrete high levels of Th1 type cytokines (INF-gamma, IL-2, TNF-alpha), with a significant statistical difference (chi) compared to wild-type HPV16 VLPs²7.410, 4.333, 8.308, P all<0.05), prompt E7_49-57Chimeric VLPs stimulate the production of a strong cellular immune response in mice; meanwhile, as shown in FIGS. 10d to 10f, E7_49-57The level of Th2 type cytokines secreted by the chimeric VLPs stimulated mice was similar to that of the wild-type HPV16 VLPs group (IL-5, IL-10), whereas the wild-type HPV16 VLPs group stimulated mice to secrete higher levels of IL-4.

While embodiments of the invention have been described above, it is not limited to the applications set forth in the description and the embodiments, which are fully applicable in various fields of endeavor to which the invention pertains, and further modifications may readily be made by those skilled in the art, it being understood that the invention is not limited to the details shown and described herein without departing from the general concept defined by the appended claims and their equivalents.

SEQUENCE LISTING

<110> Jilin medical college

<120> recombinant vector, recombinant protein, virus-like particle of human papilloma virus 16 type epitope chimeric L1 and preparation thereof

And applications

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1476

<212> DNA

<213> Artificial sequence

<400> 1

atgccgtctg aagcgaccgt gtatctgccg ccggtgccgg tgtctaaagt ggtgtctacc 60

gatgaatatg tggcgcgtac caacatctac taccacgctg gtacctctcg tctgctggct 120

gttggtcacc cgtacttccc gatcaaaaaa ccgaacaaca acaaaatcct ggttccgaaa 180

gtttctggtc tgcagtaccg tgttttccgt atccacctgc cggacccgaa caaattcggt 240

ttcccggaca cctctttcta caacccggac acccagcgtc tggtttgggc ttgcgttggt 300

gttgaagttg gtcgtggtca gccgctgggt gttggtatct ctggtcaccc gctgctgaac 360

aaactggacg acaccgaaaa cgcttctgct tacgctgcta acgctggtgt tgacaaccgt 420

gaatgcatct ctatggacta caaacagacc cagctgtgcc tgatcggttg caaaccgccg 480

atcggtgaac actggggtaa aggttctccg tgcaccaacg ttgctgttaa cccgggtgac 540

tgcccgccgc tggaactgat caacaccgtt atccaggacg gtgacatggt tgacaccggt 600

ttcggtgcta tggacttcac caccctgcag gctaacaaat ctgaagttcc gctggacatc 660

tgcacctcta tctgcaaata cccggactac atcaaaatgg tttctgaacc gtacggtgac 720

tctctgttct tctacctgcg tcgtgaacag atgttcgttc gtcacctgtt caaccgtgct 780

ggtgctgttg gtgaaaacgt tccggacgac ctgtacatca aaggttctgg ttctaccgct 840

aacctggctt cttctaacta cttcccgacc ccgtctggtt ctatggttac ctctgacgct 900

cagatcttca acaaaccgta ctggctgcag cgtgctcagg gtcacaacaa cggtatctgc 960

tggggtaacc agctgttcgt taccgttgtt gacaccaccc gttctaccaa catgtctctg 1020

tgcgctgcta tctctacctc tgaaaccacc tacaaacgcg cccattataa catcgtgacc 1080

tttaacacca acttcaaaga atacctgcgt cacggtgaag aatacgacct gcagttcatc 1140

ttccagctgt gcaaaatcac cctgaccgct gacgttatga cctacatcca ctctatgaac 1200

tctaccatcc tcgaggactg gaacttcggt ctgcagccgc cgccgggtgg taccctggaa 1260

gacacctacc gtttcgttac ctctcaggct atcgcttgcc agaaacacac cccgccggct 1320

ccgaaagaag acccgctgaa aaaatacacc ttctgggaag ttaacctgaa agaaaaattc 1380

tctgctgacc tggaccagtt cccgctgggt cgtaaattcc tgctgcaggc tggtctgaaa 1440

gctaaaccga aatttcatca ccatcaccat cactaa 1476

<210> 2

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial Synthesis for use as an upstream primer for Gene fragment HPV16L1-E749-57

<400> 2

cgcggatcca tgccgtctga agcgacc 27

<210> 3

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial Synthesis to be used as a downstream primer for Gene fragment HPV16L1-E749-57

<400> 3

ggcgagctct tagtgatggt gatggtgatg aaatttcggt ttagctttca g 51

<210> 4

<211> 491

<212> PRT

<213> Artificial sequence

<220>

<223> artificially synthesized HPV16L1-E749-57 protein amino acid sequence

<400> 4

Met Pro Ser Glu Ala Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys

1 5 10 15

Val Val Ser Thr Asp Glu Tyr Val Ala Arg Thr Asn Ile Tyr Tyr His

20 25 30

Ala Gly Thr Ser Arg Leu Leu Ala Val Gly His Pro Tyr Phe Pro Ile

35 40 45

Lys Lys Pro Asn Asn Asn Lys Ile Leu Val Pro Lys Val Ser Gly Leu

50 55 60

Gln Tyr Arg Val Phe Arg Ile His Leu Pro Asp Pro Asn Lys Phe Gly

65 70 75 80

Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp

85 90 95

Ala Cys Val Gly Val Glu Val Gly Arg Gly Gln Pro Leu Gly Val Gly

100 105 110

Ile Ser Gly His Pro Leu Leu Asn Lys Leu Asp Asp Thr Glu Asn Ala

115 120 125

Ser Ala Tyr Ala Ala Asn Ala Gly Val Asp Asn Arg Glu Cys Ile Ser

130 135 140

Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro

145 150 155 160

Ile Gly Glu His Trp Gly Lys Gly Ser Pro Cys Thr Asn Val Ala Val

165 170 175

Asn Pro Gly Asp Cys Pro Pro Leu Glu Leu Ile Asn Thr Val Ile Gln

180 185 190

Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met Asp Phe Thr Thr

195 200 205

Leu Gln Ala Asn Lys Ser Glu Val Pro Leu Asp Ile Cys Thr Ser Ile

210 215 220

Cys Lys Tyr Pro Asp Tyr Ile Lys Met Val Ser Glu Pro Tyr Gly Asp

225 230 235 240

Ser Leu Phe Phe Tyr Leu Arg Arg Glu Gln Met Phe Val Arg His Leu

245 250 255

Phe Asn Arg Ala Gly Ala Val Gly Glu Asn Val Pro Asp Asp Leu Tyr

260 265 270

Ile Lys Gly Ser Gly Ser Thr Ala Asn Leu Ala Ser Ser Asn Tyr Phe

275 280 285

Pro Thr Pro Ser Gly Ser Met Val Thr Ser Asp Ala Gln Ile Phe Asn

290 295 300

Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys

305 310 315 320

Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr

325 330 335

Asn Met Ser Leu Cys Ala Ala Ile Ser Thr Ser Glu Thr Thr Tyr Lys

340 345 350

Arg Ala His Tyr Asn Ile Val Thr Phe Asn Thr Asn Phe Lys Glu Tyr

355 360 365

Leu Arg His Gly Glu Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys

370 375 380

Lys Ile Thr Leu Thr Ala Asp Val Met Thr Tyr Ile His Ser Met Asn

385 390 395 400

Ser Thr Ile Leu Glu Asp Trp Asn Phe Gly Leu Gln Pro Pro Pro Gly

405 410 415

Gly Thr Leu Glu Asp Thr Tyr Arg Phe Val Thr Ser Gln Ala Ile Ala

420 425 430

Cys Gln Lys His Thr Pro Pro Ala Pro Lys Glu Asp Pro Leu Lys Lys

435 440 445

Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu

450 455 460

Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln Ala Gly Leu Lys

465 470 475 480

Ala Lys Pro Lys Phe His His His His His His

485 490

Claims (9)

1. Containing human papilloma virus 16 type E7_49-57An epitope chimeric L1DNA fragment, wherein the sequence of the DNA fragment is shown as SEQ ID NO. 1.

2. Containing human papilloma virus 16 type E7_49-57The recombinant vector of the epitope chimeric L1DNA fragment is characterized by comprising a vector and a gene fragment HPV16L1-E7_49-57；

Wherein, the gene segment HPV16L1-E7_49-57A DNA fragment consisting of a base sequence shown in SEQ ID NO. 1.

3. The composition of claim 2 comprising human papillomavirus type 16E 7_49-57The recombinant vector of epitope chimeric L1DNA fragment is characterized in that the vector is plasmid pET28 a.

4. Containing human papilloma virus 16 type E7_49-57A method for constructing a recombinant vector of an epitope chimeric L1DNA fragment, comprising:

using pGEM-Teasy-16L1-E7_49-57As a template, a DNA fragment consisting of the base sequence shown in SEQ ID NO.1 was obtained by PCR amplification using the primer sequences shown in SEQ ID NO.2 and SEQ ID NO.3 and constructed on pET-28a plasmid to obtain a recombinant plasmid pET28a-16L1-E7_49-57。

5. Containing human papilloma virus 16 type E7_49-57The recombinant protein of epitope chimeric L1 is characterized by comprising a protein consisting of an amino acid sequence shown in SEQ ID NO. 4.

6. Containing human papilloma virus 16 type E7_49-57Method for constructing recombinant protein of epitope chimeric L1, characterized in that the recombinant protein of claim 1 or 2 containing human papillomavirus type 16E 7 is used_49-57A recombinant vector of epitope chimeric L1DNA fragment, comprising the following processes:

the recombinant plasmid pET28a-16L1-E7_49-57Transferring the bacillus coli BL21 into the bacillus coli BL21, culturing, collecting thalli and purifying to obtain recombinant protein;

wherein the recombinant protein contains protein consisting of an amino acid sequence shown in SEQ ID NO. 4.

7. Containing human papilloma virusType 16E 7_49-57The virus-like particle of epitope chimeric L1 is characterized by comprising protein consisting of an amino acid sequence shown as SEQ ID NO. 4.

8. Containing human papilloma virus 16 type E7_49-57Method for the preparation of virus-like particles with epitope-chimerized L1, using a recombinant protein according to claim 5, comprising:

and adding a reducing agent into the recombinant protein for acting, and dialyzing in an assembly liquid to obtain the self-assembled virus-like particles.

9. Use of the composition containing human papillomavirus type 16E 7 according to claim 7_49-57Use of a virus-like particle with epitope chimeric L1 in the preparation of a human papilloma virus vaccine.

Images