CN111926101A - Molecular marker of rice bacterial leaf blight resistant gene Xa27 and application thereof - Google Patents
Molecular marker of rice bacterial leaf blight resistant gene Xa27 and application thereof Download PDFInfo
- Publication number
- CN111926101A CN111926101A CN202010863459.XA CN202010863459A CN111926101A CN 111926101 A CN111926101 A CN 111926101A CN 202010863459 A CN202010863459 A CN 202010863459A CN 111926101 A CN111926101 A CN 111926101A
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- molecular marker
- leaf blight
- bacterial
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of plant biology, in particular to a molecular marker of a rice bacterial leaf blight resistant gene Xa27 and application thereof. The invention provides a molecular marker of a rice bacterial blight resistant gene Xa27 obtained by amplification of primers shown in SEQ ID NO.1-3 and an Xa27 gene specific primer combination comprising the primers shown in SEQ ID NO. 1-3. The marker realizes that the gene typing of the Xa27 can be completed only by simple PCR and PAGE gel electrophoresis detection of a simply extracted DNA sample, the resistance to the rice bacterial leaf blight can be predicted, the marker has the advantages of accurate gene typing, lower cost, higher detection flux and detection efficiency and the like, and an efficient method is provided for screening new rice bacterial leaf blight resistant germplasm and applying the Xa27 gene to germplasm resource resistance improvement.
Description
Technical Field
The invention relates to the technical field of plant biology, in particular to a molecular marker of a rice bacterial leaf blight resistant gene Xa27 and application thereof.
Background
Bacterial blight of rice is a serious bacterial disease caused by the gram-negative bacterium Xanthomonas oryzae pv. oryzae, Xoo, which normally invades rice from water pores or wounds and produces gray-white patches along the vascular bundle of the veins (Dian literature, et al. St. Oryza alba resistance gene research and molecular breeding. bioengineering progress 1999,19 (6): 9-15.). After the rice suffers from the bacterial blight, the yield is generally reduced by 20-30%, and in severe cases, the yield reaches 50%, even the yield of the rice is not recovered.
Bacterial leaf blight usually occurs relatively easily in humid and low-lying areas, with indica rice being heavier than japonica rice, double cropping late rice being heavier than double cropping early rice, single cropping middle rice being heavier than single cropping late rice, glutinous rice being heavier than glutinous rice (Gnaamanicokam, et al. an overview of bacterial bright disease of rice and varieties for management. curr Sci India,1999,77(11): 1435-.
In view of the great harmfulness of bacterial blight of rice, a great number of researchers have conducted extensive research on the disease for a long time. At present, it is generally considered that discovering disease-resistant genes and breeding new disease-resistant varieties are the most economic and effective way for controlling bacterial blight of rice. Up to now, tens of bacterial blight resistance genes have been identified from different rice varieties, and 9 have been cloned, namely Xa1, Xa3/Xa26, Xa4, Xa27, Xa10, Xa13, Xa21, Xa23, and Xa27 (national Rice data center, http:// www.ricedata.cn/index. htm).
Xa27 was derived from tetraploid oryza minuta (Oryza minuta), a dominant broad-spectrum gene resistant to bacterial blight, and was cloned by Gu et al in 2005 (Gu, et al. R gene expression induced by a type-III effect resistors in Nature,2005,435: 1122-1125). In the donor material IRBB27, the Xa27 cDNA was 2361bp in full length, containing only 1 exon, encoding a protein product consisting of 113 amino acids containing an alpha-helical domain. The coding sequence of Xa27 was identical in the susceptible variety IR24 and the resistant variety IRBB27, except that the base sequence of the promoter region was two different, compared with IRBB27, the Xa27 promoter in IR24 had a10 bp sequence about 1.4kb upstream of ATG and a 25bp sequence before the TA frame. The researchers further performed sequence analysis on different alleles of Xa27 in multiple rice varieties and found that functional base sequences existed in UPTAvrXa27 box, that anti-disease IRBB27 had a fully functional UPTAvrXa27 box, and that susceptible varieties lacked AGA three bases and a C → A base substitution in UPTAvrXa27 box, thereby affecting the recognition of the pathogen AvrXa27 (Romer, et al. A single plant promoter encoded recognition multiple genes. Proc Natl Acad Sci,2009,106: 20526. sup. 20531; Bimolata, et al. analysis of nucleic acid diversity analogs of the pathogen jbacterial genes coding strains, 3627. 9. varying nucleotide sequences of genes Xa and 27. 9. vary from wild varieties of genes and genes).
The markers reported at present for Xa27 genotype screening include Gu et al (Gu, et al. R gene expression induced by a type-III effector diagnostics in rice, Nature,2005,435: 1122) -1125.) and Bao Yong Mei et al (Bao Yong Mei, et al. molecular marker primers for rice bacterial blight resistance gene Xa27 and their use; CN106957916A) intragenic molecular markers designed based on a 25bp InDel of the resistant material promoter region. Since the above two molecular markers are not functional markers, there is a certain risk in application. There is no report of designing a functional molecular marker for anti-influenza Xa27 AGA three-base deletion in UPTAvrXa27 box.
Disclosure of Invention
The invention aims to provide a molecular marker of a rice bacterial leaf blight resistant gene Xa27 and application thereof, and the invention also aims to provide a specific primer combination for detecting the rice bacterial leaf blight resistant gene Xa27 and application thereof.
In order to achieve the purpose, the invention obtains the three-primer molecular marker of the rice bacterial leaf blight resistant gene Xa27 and the specific primer combination thereof through a large amount of design, exploration, screening and verification based on the functional base AGA insertion deletion on the UPTAvrXa27 box of the rice bacterial leaf blight resistant gene Xa27/Xa27 promoter region.
Specifically, the invention provides the following technical scheme:
the invention provides a molecular marker of a rice bacterial leaf blight resistant gene Xa27, which is obtained by amplifying primers shown in SEQ ID NO. 1-3.
For the disease-resistant variety IRBB27 and the susceptible variety IR24, the molecular marker is a DNA fragment with a sequence shown as SEQ ID NO.4 or SEQ ID NO. 5.
The invention further provides a specific primer combination for detecting the rice bacterial blight resistant gene Xa27, which comprises the primers shown in SEQ ID NO. 1-3.
Specifically, the primer combination comprises a forward primer Xa27-F1: GACTACGACTACTAGTGCTATAAATAGACGAAGAG, SEQ ID NO.2 shown in SEQ ID NO.1 and a forward primer Xa 27-F2: CGACTACGAGTGCTATAAATAGACGAGA and a reverse primer Xa27-R CATTGGAGGCAGCTTCTTGGGT shown in SEQ ID NO. 3.
In the above primer combination, the primer binding positions of Xa27-F1 and Xa27-F2 are the same, but the 3' terminal bases are AGAG and GAGA, and only the base pairing can be carried out with Xa27 of disease-resistant and disease-sensitive varieties. In addition, the 5 ' end of Xa27-F1 is added with a specific sequence GACTA to introduce amplified fragment length polymorphism, the 7 th base of the 3 ' end of Xa27-F1 is introduced with A → C mutation, and the 5 th base of the 3 ' end of Xa27-F2 is introduced with A → C mutation to enlarge the difference of Xa27-F1 and Xa27-F2 in the recognition capability of target sequences. Xa27-R pairs with Xa27-F1 and Xa27-F2, respectively, to amplify PCR products of 114bp and 106 bp.
The invention provides a kit containing the primer combination. The kit can be used for detecting the bacterial blight resistant gene Xa27 of rice.
The invention provides application of the molecular marker or the primer combination or the kit in detection of the genotype of a rice bacterial blight resistant gene Xa 27.
The invention also provides application of the molecular marker or the primer combination or the kit in rice bacterial leaf blight resistance prediction.
The prediction of the bacterial blight resistance of the rice can be specifically to judge whether the rice contains the genotype of the rice bacterial blight resistance gene Xa27 and/or the rice bacterial blight resistance gene Xa27, and if the rice contains the bacterial blight resistance gene Xa27, the rice is predicted to have the bacterial blight resistance.
The invention provides application of the molecular marker or the primer combination or the kit in breeding of rice resistant to bacterial blight or improving resistance of rice germplasm resources to bacterial blight.
Further, the invention provides a method for detecting the genotype of the rice bacterial leaf blight resistant gene Xa27, which comprises the steps of carrying out PCR amplification by using rice genome DNA as a template and primers shown in SEQ ID NO.1-3, and judging the genotype of the rice bacterial leaf blight resistant gene Xa27 according to the size of an amplification product.
In the above method, the reaction procedure of PCR amplification is: 4-5 min at 94 ℃; 30-40 cycles of 94 ℃, 20-40 seconds, 56-60 ℃, 20-40 seconds, 72 ℃, 20-30 seconds; and 5-10 min at 72 ℃.
The 10. mu.L reaction system for PCR amplification was: 2 XPCR reaction Mix 5 uL, 10 uM 2 forward and 1 reverse primers each 0.5 uL, 10% DMSO 0.5 uL, template DNA 1.5 uL, sterile ddH2O to 10. mu.L.
In a preferred embodiment of the present invention, the 2 × PCR reaction mix may be 2 × Bench Top of BiomigaTM Taq master mix。
The template DNA in the PCR reaction system can be extracted by a conventional method. Particularly, compared with the detection method in the prior art, the detection primer and the detection method provided by the invention can realize high-efficiency amplification and detection by taking DNA extracted by a simple method as a template.
Preferably, the rice genome DNA template is obtained by simple extraction.
The method for extracting the rice genome DNA by the simple method can adopt the following method:
(1) taking about 1cm of rice leaves and putting the rice leaves into a porous PCR plate;
(2) 70 μ L of buffer A (20% Tween20:800 μ L, 5mol/L NaOH: 160 μ L, ddH) was added2O7.04 mL, sealing with a silica gel cover, immediately placing the PCR plate into a PCR instrument, and keeping the temperature at 95 ℃ for 10 min;
(3) the PCR plate was removed and an equal volume of buffer B (1mol/L Tris-HCl (pH 8.0): 1mL, 0.5 mol/L) was added rapidlyEDTA(pH 8.0)：40μL，ddH2O8.96 mL) was used as the template DNA.
In the above method, the size of the PCR amplification product can be detected by PAGE gel electrophoresis, and the PAGE gel electrophoresis conditions can be: 6% PAGE gel, U2000V, I200 mA, P85W, electrophoresis for 50 min.
In the above-mentioned method, the specific method for judging whether the rice contains the bacterial blight resistant gene Xa27 according to the size of the amplified product is as follows: if the amplified product only has a 114bp band, the Xa27 gene of the sample to be detected is homozygous dominant genotype (UPTAvrXa 27 box with complete function); if only 106bp bands appear, the Xa27 gene of the sample to be detected is a homozygous recessive genotype (three bases of AGA are deleted in UPTAvrXa27 box); if the bands of 114bp and 106bp appear simultaneously, the Xa27 gene of the sample to be detected is heterozygote.
The reference sequence of the 114bp band is shown as SEQ ID NO.4, and the reference sequence of the 106bp band is shown as SEQ ID NO. 5. It will be understood by those skilled in the art that due to differences in rice varieties, the sequence of the PCR product predicted when designing primers can only be used as a reference sequence, and the sequence of the product amplified from different varieties may be identical to the reference sequence or may have partial base differences from the reference sequence, but such differences will not generally affect the use of the marker.
The invention also provides a method for predicting the bacterial leaf blight resistance of rice, which takes the genomic DNA of the rice as a template, utilizes the primers shown in SEQ ID NO.1-3 to carry out PCR amplification, and judges whether the rice has the bacterial leaf blight resistance or not according to the size of an amplification product.
In the above method, the reaction procedure of PCR amplification is: 4-5 min at 94 ℃; 30-40 cycles of 94 ℃, 20-40 seconds, 56-60 ℃, 20-40 seconds, 72 ℃, 20-30 seconds; and 5-10 min at 72 ℃.
The 10. mu.L reaction system for PCR amplification was: 2 XPCR reaction Mix 5 uL, 10 uM 2 forward and 1 reverse primers each 0.5 uL, 10% DMSO 0.5 uL, template DNA 1.5 uL, sterile ddH2O to 10. mu.L.
In the method, if the amplification product only has a 114bp strip, the Xa27 gene of the sample to be detected is homozygous dominant genotype, and the sample to be detected resists diseases; if only a 106bp strip appears, the Xa27 gene of the sample to be detected is a homozygous recessive genotype, and the sample to be detected is infected with diseases; if the bands of 114bp and 106bp appear simultaneously, the Xa27 gene of the sample to be detected is heterozygote, and the sample to be detected resists diseases.
Compared with the prior art, the invention has the following beneficial effects: the invention designs and develops a three-primer molecular marker with short amplification fragment and strong specificity based on functional base AGA insertion deletion on a promoter region of a rice bacterial blight-resistant gene Xa 27. By using the marker, the genotyping of Xa27 can be completed only by simple PCR and PAGE gel electrophoresis detection of a DNA sample which is simply extracted, the rice bacterial leaf blight resistance can be predicted, the advantages of accurate genotyping, lower cost, higher detection flux and detection efficiency and the like are achieved, the detection accuracy is ensured while the detection efficiency is improved, the requirement on the quality of template DNA is very low, the marker is more suitable for being applied to large-scale molecular marker-assisted selection, and an efficient method is provided for screening new rice bacterial leaf blight-resistant germplasm and applying the Xa27 gene to germplasm resource resistance improvement.
Drawings
FIG. 1 is a schematic diagram of primer design in example 1 of the present invention, wherein A is a sequence comparison of an anti-susceptible variety in UPTAvrXa27 box (Bimolata, et al, analysis of nucleotide diversity atoms of the major background noise gene Xa27 in focuses of edges (Oryza sativa) and its wild returns. plant 2013,238: 293) published by Bimolata et al; b is a schematic design diagram of a molecular marker primer, which comprises two forward primers Xa27-F1 and Xa27-F2 and a public reverse primer Xa27-R, wherein the primer binding positions of Xa27-F1 and Xa27-F2 are the same, but the 3 'end bases are AGAG and GAGA and can only be subjected to base pairing with Xa27 of a disease-resistant variety and a disease-sensitive variety respectively, in addition, a specific sequence GACTA is added to the 5' end of Xa27-F1 to introduce amplified fragment length polymorphism, the 7 th base of the 3 'end of Xa27-F1 introduces A → C mutation, and the 5 th base of the 3' end of Xa27-F2 introduces A → C mutation to enlarge the difference of the recognition abilities of Xa27-F1 and Xa27-F2 to target sequences; the sites of base deletions are indicated by black boxes and the introduced base mutations are underlined.
FIG. 2 is a PAGE gel electrophoresis chart of 12 rice varieties/lines detected by the molecular markers of the invention in example 2 of the present invention; wherein, lanes 1-10 are 78-15 (containing Xa27), Wufeng B, Huazhan, Zhongxianghuangzhan, R51084, Qingfeng No. 1B, south H197, Fufenghui 1658, Yuanfeng 9918S, 9311, Yue 4B, H28B, respectively; the PCR product size is marked on the right side of the gel plot.
FIG. 3 is a PAGE gel electrophoresis chart of 20 BC1F2 generation individual plant DNAs extracted from R51084/78-15 (containing Xa27) by the molecular marker detection simple method in example 3 of the present invention; wherein lanes 21 are 78-15, and the remaining lanes are different BC1F2 individuals; the PCR product size is marked on the right side of the gel plot.
FIG. 4 shows the alignment of homozygous Xa27 genotype and homozygous Xa27 genotype individuals, 78-15, Huazhan sequencing sequence in the F2 generation of R51084/78-15 (containing Xa27) in example 3 of the present invention with IRBB27 reference sequence; the arrow indicates the site of the functional base mutation.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
Example 1 primer design and amplified fragment analysis of molecular marker of rice Xa27 Gene
1. Primer design
According to the UPT leading to the anti-sense materialAvrXa27The functional InDel of 'AGA' of the promoter regions of the rice disease-resistant Xa27 and susceptible Xa27 alleles, in which box generates difference in recognition of the pathogenic bacterium AvrXa27, designs an upstream and downstream primer combination (figure 1) capable of amplifying the base difference:
Xa27-F1:GACTACGACTACTAGTGCTATAAATAGACGAAG AG(SEQ ID NO.1)，
Xa27-F2:CGACTACGAGTGCTATAAATAGACGAGA(SEQ ID NO.2)，
and Xa27-R: CATTGGAGGCAGCTTCTTGGGT (SEQ ID NO. 3).
2. Analysis of amplified fragments
When the primer combination is used for amplifying the rice bacterial leaf blight resistant gene Xa27, only one 114bp strip can be amplified from a disease resistant material, and only one 106bp strip can be amplified from a disease sensitive material. The nucleotide sequences of the 114bp and 106bp bands are respectively shown as SEQ ID NO.4 and SEQ ID NO. 5.
Example 2 identification of Xa27 genotypes of Rice varieties/lines Using the molecular markers of the invention
1. Extraction of genomic DNA of Rice
12 rice varieties/strains such as 78-15, Wufeng B, Huazhan, Zhongxianghuangzhan, R51084, Qingfeng No. 1B, south H197, Fufenghui 1658, Yuanfeng 9918S, 9311, Yue 4B, H28B and the like are used as materials, and genome DNA of leaves is extracted in a seedling stage. The DNA extraction is slightly improved on the basis of the establishment method of Zhao national treasure and the like (Zhao national treasure, Jia Youling, strict Zongbo and the like. an efficient and convenient rice DNA extraction method and application thereof. Chinese rice science, 2012,26 (4): 495 and 499), and the specific method is as follows:
chemical reagents used for DNA extraction:
buffer a (now ready for use): 20% Tween20: 800. mu.L, 5mol/L NaOH: 160 μ L, ddH2O 7.04mL。
And (3) buffer solution B: 1mol/L Tris-HCl (pH 8.0): 1mL, 0.5mol/L EDTA (pH 8.0): 40 μ L, ddH2O 8.96mL。
DNA extraction step:
(1) taking about 1cm of fresh rice leaves or old leaves, and putting the fresh rice leaves or old leaves into a 200 mu L96-hole PCR plate;
(2) adding 70 μ L buffer solution A into each well, sealing with 96-well silica gel cap, immediately placing the plate into a PCR instrument, and keeping at 95 deg.C for 10 min;
(3) taking out the flat plate, quickly adding an equal volume of buffer solution B to obtain an extracting solution, and directly using the extracting solution as a template DNA for PCR detection;
(4) if the extract is stored for a period of time for PCR detection, the remaining extract can be sealed and stored at-20 ℃ for later use, but repeated freeze thawing is not suitable.
2. PCR amplification
The DNA of 12 rice varieties/strains extracted in the step 1 is subjected to PCR amplification by using the specific primer combinations (Xa27-F1, Xa27-F2 and Xa27-R) obtained by screening in the example 1, wherein the reaction system of the PCR is as follows: 2 of BiomigaBench TopTM Taq master mix 5. mu.L, 10. mu.M of 2 forward and 1 reverse primers each 0.5. mu.L, 10% DMSO 0.5. mu.L, template DNA about 1.5. mu.L, sterile ddH2O to 10 μ L;
the PCR reaction conditions are as follows: 94 ℃ for 4 min; 35 cycles of 94 ℃, 30s, 60 ℃, 30s, 72 ℃,20 s; 72 ℃, 5min, 16 ℃,1 min.
3. PCR product detection
Detecting the amplification product by electrophoresis of 6% PAGE gel, wherein the electrophoresis conditions are as follows: u is 2000V, I is 200mA, P is 85W, electrophoresis is carried out for 50 min. After electrophoresis, 0.1% AgNO was used3Dyeing and observing and taking a picture on a film viewing lamp.
4. Results and analysis
The molecular marker primer combination of the invention example 1 is used for amplifying the 12 rice varieties/lines, and only one 114bp band is found to be amplified by 78-15, which is homozygous Xa27 disease-resistant genotype, while all other varieties/lines only amplify one 106bp band, which is homozygous Xa27 disease-sensitive genotype (see figure 2). The results show that the disease-resistant Xa27 is rarely distributed in the existing rice cultivars and rarely applied to breeding research, so that the rice cultivars have great utilization potential. Meanwhile, the accuracy and reliability of the molecular marker in the Xa27 genotype identification are verified by detecting the corresponding relation between the 114bp and 106bp band types and the bacterial leaf blight resistance through electrophoresis.
Example 3 identification of the Xa27 genotype of progeny of a Rice Cross by the molecular markers of the invention
1. Rice material
R51084/78-15 (containing Xa27) 20 BC1F2And (4) generation of single plants.
2. Extraction of genomic DNA of Rice
Leaf genome DNA was extracted at the seedling stage in the same manner as in example 2.
3. See example 2 for PCR amplification and product judgment criteria.
4. Results and analysis
The molecular markers (obtained by PCR amplification of specific primer combinations Xa27-F1, Xa27-F2 and Xa27-R) in the invention example 1 are used for detecting R51084/78-15 (containing Xa27) in the seedling stage20 BC1F2The generation of single plants shows that 5 single plants only amplify 114bp bands, 5 single plants only amplify 106bp bands, and 10 single plants simultaneously amplify 114bp and 106bp bands (see figure 3). F of R51084/78-15 (containing Xa27)2The homozygous Xa27 genotype and homozygous Xa27 genotype individuals in the population were sequenced and the sequence of the homozygous Xa27 genotype individual was found to be identical to the reference IRBB27 and 78-15 sequences, and the sequence of the homozygous Xa27 genotype individual was found to be identical to the huazhan sequence (see fig. 4). The results show that the molecular marker can effectively distinguish different genotypes in the filial generation of the anti-susceptible material, the result is real and accurate, and the molecular marker can be used for accurately performing auxiliary selection on the rice bacterial leaf blight resistant gene Xa27 in large-scale breeding practice.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Hainan Borax Rice Gene science and technology Co., Ltd
<120> molecular marker of rice bacterial leaf blight resistant gene Xa27 and application thereof
<130> KHP201114961.5
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gactacgact actagtgcta taaatagacg aagag 35
<210> 2
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cgactacgag tgctataaat agacgaga 28
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cattggaggc agcttcttgg gt 22
<210> 4
<211> 114
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gactacgact actagtgcta taaatagacg aagagaccca tagagagcat cagagcaaag 60
tactcctaaa agacagccac acacactgag acacccaaga agctgcctcc aatg 114
<210> 5
<211> 106
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgactacgag tgctataaat agacgagacc aatagagagc atcagagcaa agtactccta 60
aaagacagcc acacacactg agacacccaa gaagctgcct ccaatg 106
Claims (10)
1. A molecular marker of a rice bacterial leaf blight resistant gene Xa27 is characterized by being obtained by amplification of primers shown as SEQ ID NO. 1-3.
2. The specific primer combination for detecting the rice bacterial blight resistant gene Xa27 is characterized by comprising primers shown as SEQ ID NO. 1-3.
3. A kit comprising the primer combination of claim 2.
4. The use of the molecular marker of claim 1, the primer combination of claim 2 or the kit of claim 3 for detecting the genotype of the rice bacterial blight resistant gene Xa 27.
5. Use of the molecular marker of claim 1, the primer combination of claim 2 or the kit of claim 3 for predicting bacterial blight resistance in rice.
6. Use of the molecular marker of claim 1, the primer combination of claim 2 or the kit of claim 3 for breeding of rice resistant to bacterial blight or for improving resistance of rice germplasm resources to bacterial blight.
7. A method for detecting the genotype of a rice bacterial leaf blight resistant gene Xa27 is characterized in that rice genome DNA is used as a template, primers shown as SEQ ID NO.1-3 are used for PCR amplification, and the genotype of the rice bacterial leaf blight resistant gene Xa27 is judged according to the size of an amplification product.
8. A method for predicting bacterial leaf blight resistance of rice is characterized in that rice genome DNA is used as a template, a primer shown as SEQ ID NO.1-3 is used for PCR amplification, and whether the rice has the bacterial leaf blight resistance or not is predicted according to the size of an amplification product.
9. The method according to claim 7 or 8, wherein the reaction procedure of the PCR amplification is: 4-5 min at 94 ℃; 30-40 cycles of 94 ℃, 20-40 seconds, 56-60 ℃, 20-40 seconds, 72 ℃, 20-30 seconds; and 5-10 min at 72 ℃.
10. The method according to any one of claims 7 to 9, wherein if the amplification product only has a 114bp band, the Xa27 gene of the sample to be tested is homozygous dominant genotype; if only 106bp bands appear, the Xa27 gene of the sample to be detected is a homozygous recessive genotype; if the bands of 114bp and 106bp appear simultaneously, the Xa27 gene of the sample to be detected is heterozygote.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010863459.XA CN111926101B (en) | 2020-08-25 | 2020-08-25 | Molecular marker of rice bacterial leaf blight resistance gene Xa27 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010863459.XA CN111926101B (en) | 2020-08-25 | 2020-08-25 | Molecular marker of rice bacterial leaf blight resistance gene Xa27 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111926101A true CN111926101A (en) | 2020-11-13 |
| CN111926101B CN111926101B (en) | 2023-10-20 |
Family
ID=73305169
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010863459.XA Active CN111926101B (en) | 2020-08-25 | 2020-08-25 | Molecular marker of rice bacterial leaf blight resistance gene Xa27 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111926101B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101621921A (en) * | 2007-01-29 | 2010-01-06 | 淡马锡生命科学研究院有限公司 | Induction of Xa27 by the avrXa27 gene in rice confers broad-spectrum resistance to xanthomonas oryzae pv. oryzae and enhanced resistance to xanthomonas oryzae pv. Oryzicola |
| CN103266109A (en) * | 2013-05-24 | 2013-08-28 | 中国农业科学院作物科学研究所 | Molecular marker of rice resistance gene Xa23 and application of molecular marker |
| CN106957916A (en) * | 2017-04-25 | 2017-07-18 | 南京农业大学 | Paddy rice bacterial leaf spot resistant gene Xa27 molecular labeling primer and its application |
| CN111235223A (en) * | 2020-02-18 | 2020-06-05 | 华中农业大学 | Primer and test strip detection method for small fragment deletion typing detection |
-
2020
- 2020-08-25 CN CN202010863459.XA patent/CN111926101B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101621921A (en) * | 2007-01-29 | 2010-01-06 | 淡马锡生命科学研究院有限公司 | Induction of Xa27 by the avrXa27 gene in rice confers broad-spectrum resistance to xanthomonas oryzae pv. oryzae and enhanced resistance to xanthomonas oryzae pv. Oryzicola |
| CN103266109A (en) * | 2013-05-24 | 2013-08-28 | 中国农业科学院作物科学研究所 | Molecular marker of rice resistance gene Xa23 and application of molecular marker |
| CN106957916A (en) * | 2017-04-25 | 2017-07-18 | 南京农业大学 | Paddy rice bacterial leaf spot resistant gene Xa27 molecular labeling primer and its application |
| CN111235223A (en) * | 2020-02-18 | 2020-06-05 | 华中农业大学 | Primer and test strip detection method for small fragment deletion typing detection |
Non-Patent Citations (4)
| Title |
|---|
| ANIRUDH KUMAR ET AL: "Deployment of Genetic and Genomic Tools Toward Gaining a Better Understanding of Rice-Xanthomonas oryzae pv. oryzae Interactions for Development of Durable Bacterial Blight Resistant Rice", FRONTIERS IN PLANT SCIENCE * |
| PATRICK RO¨ MER ET AL: "A single plant resistance gene promoter engineered to recognize multiple TAL effectors from disparate pathogens", PNAS * |
| 周国强;严成其;杨勇;余初浪;王栩鸣;陈剑平;: "分子标记技术的发展及其在水稻抗白叶枯病研究中的应用", 浙江农业学报 * |
| 张帆;周永力;: "白叶枯病菌(Xanthomonas oryzae pv. oryzae)与水稻抗病基因识别的分子机理", 中国水稻科学 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111926101B (en) | 2023-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Mapping of powdery mildew resistance genes in melon (Cucumis melo L.) by bulked segregant analysis | |
| Gupta et al. | Molecular markers from the transcribed/expressed region of the genome in higher plants | |
| Arens et al. | Development and evaluation of robust molecular markers linked to disease resistance in tomato for distinctness, uniformity and stability testing | |
| Wu et al. | SNP-based pool genotyping and haplotype analysis accelerate fine-mapping of the wheat genomic region containing stripe rust resistance gene Yr26 | |
| Xie et al. | Suppressed recombination rate in 6VS/6AL translocation region carrying the Pm21 locus introgressed from Haynaldia villosa into hexaploid wheat | |
| CN111926100B (en) | Molecular marker of rice bacterial leaf blight resistance gene xa5 and application thereof | |
| Sun et al. | A novel er1 allele and the development and validation of its functional marker for breeding pea (Pisum sativum L.) resistance to powdery mildew | |
| CN110241252B (en) | SNP molecular marker combination for constructing peach DNA fingerprint spectrum, application and method | |
| Ma et al. | High-throughput genotyping-by-sequencing facilitates molecular tagging of a novel rust resistance gene, R 15, in sunflower (Helianthus annuus L.) | |
| Kadirvel et al. | Genetic markers, trait mapping and marker-assisted selection in plant breeding | |
| Boopathi et al. | Genotyping of mapping population | |
| Mishra et al. | Analysis of SSR and SNP Markers | |
| Sharma et al. | Assessment of genetic diversity among sugarcane cultivars using novel microsatellite markers | |
| CN108103237B (en) | InDel molecular marker co-separated from rice bacterial leaf blight disease-resistant gene xa34(t), and detection primer and application thereof | |
| CN108642201B (en) | SNP (Single nucleotide polymorphism) marker related to millet plant height character as well as detection primer and application thereof | |
| Lee | Development and evolution of molecular markers and genetic maps in capsicum species | |
| Ma et al. | Development of P genome-specific SNPs and their application in tracing Agropyron cristatum introgressions in common wheat | |
| CN108707685B (en) | SNP (Single nucleotide polymorphism) marker related to tillering number character of millet as well as detection primer and application thereof | |
| CN107365873B (en) | Molecular marker linked with foxtail sheath color characteristic of millet and application thereof | |
| Liu et al. | Molecular cloning and functional analysis of the pepper resistance gene Me3 to root-knot nematode | |
| KR101410329B1 (en) | Primer set, method and kit for selecting TSWV-resistant pepper cultivar | |
| CN111926101A (en) | Molecular marker of rice bacterial leaf blight resistant gene Xa27 and application thereof | |
| CN112760319B (en) | Development and application of aegilops tauschii 2Sl chromosome specific molecular marker | |
| Mann et al. | Molecular linkage maps: strategies, resources and achievements | |
| CN111793706B (en) | Cowpea InDel molecular marker detection primer group and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |