CN111926091A - Method for identifying relationship of black bear in northeast China by using microsatellite markers - Google Patents

Method for identifying relationship of black bear in northeast China by using microsatellite markers Download PDF

Info

Publication number
CN111926091A
CN111926091A CN202010945822.2A CN202010945822A CN111926091A CN 111926091 A CN111926091 A CN 111926091A CN 202010945822 A CN202010945822 A CN 202010945822A CN 111926091 A CN111926091 A CN 111926091A
Authority
CN
China
Prior art keywords
parent
paternity
microsatellite
allele
black bear
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010945822.2A
Other languages
Chinese (zh)
Inventor
高建伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qiqihar University
Original Assignee
Qiqihar University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qiqihar University filed Critical Qiqihar University
Priority to CN202010945822.2A priority Critical patent/CN111926091A/en
Publication of CN111926091A publication Critical patent/CN111926091A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/40—Population genetics; Linkage disequilibrium
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B40/00—ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Abstract

The invention discloses a method for identifying the genetic relationship of black bear in northeast by utilizing microsatellite markers, which utilizes black bear 15 logged in NCBI to carry out paternity identification research on the polymorphic microsatellite markers so as to establish a set of sensitive and effective microsatellite marker system suitable for the paternity identification of black bear in northeast, thereby providing a certain theoretical basis for the propagation management of captive breeding populations in the future. The PIC value of 15 microsatellite loci is 0.4218-0.7690, the average PIC value is 0.5735, 4 medium polymorphism markers are present, 11 high polymorphism markers are present, and the average allelic factor is 7.40. When the microsatellite loci are used for paternity test, the allelic factors of the microsatellite loci are at least 4, the result of the microsatellite loci is higher than the requirement, and the result is credible. The result of the invention shows that the polymorphism of the microsatellite locus is high, and the applicable region range and population range of the microsatellite locus are increased to a certain extent.

Description

Method for identifying relationship of black bear in northeast China by using microsatellite markers
Technical Field
The invention belongs to the technical field of animal genetic breeding and reproduction, and relates to a method for identifying the genetic relationship of black bear in northeast by using microsatellite markers.
Background
Microsatellite paternity test is an emerging and developed molecular marker paternity test technology. Compared with other sub-identification methods, the microsatellite DNA marker has the advantages of high heterozygosity, good polymorphism and the like, the method is more convenient in the aspects of sample collection and unified detection standard, blood, tissue, hair, formalin preservation samples and the like are good raw materials, and meanwhile, the detection is not influenced by factors such as age, environment and the like. Higher accuracy in paternity testing than other methods, particularly in forensic applications for individual identification and paternity testing, is considered to be the most accurate test method. At present, microsatellite paternity testing is widely applied to forensic science testing, livestock pedigree testing and pedigree testing of endangered animal populations.
In the bear raising field, the filial generation genealogy numbers are disordered due to carelessness of feeders, and the formulation of the black bear breeding plan is influenced.
Disclosure of Invention
In order to accurately master the genetic relationship of black bears, the invention provides a method for identifying the genetic relationship of black bears in northeast China by using microsatellite markers.
The purpose of the invention is realized by the following technical scheme:
a method for identifying the genetic relationship of black bear in northeast by using microsatellite markers comprises the following steps:
step one, taking the northeast black bear as a research object, and adopting 15 microsatellite loci to perform polymorphism analysis on the northeast black bear, wherein: the 15 microsatellite loci are ABB1, ABB3, ABB4, ABB5, ABB6, ABB7, ABB10, ABB11, ABB12, MSUT2, MSUT4, UT3, UT35, UT36 and UT38 respectively; a PCR amplification system for genotyping 15 fluorophore-modified microsatellite marker primers, as shown in Table 1;
step two, extracting black bear hair genome DNA by adopting a QIAamp DNA Investigator kit method, and using the black bear hair genome DNA as a template for later use; the PCR amplification reaction system is 25L: 2.5mM dNTPs 2L, buffer 2L, F-primer 1L, R-primer 1L, Template 2L, rTaq 0.25L, ultrapure water 14.75-15.75L, Mg2+0.5-2L; the PCR amplification reaction program is as follows: pre-denaturation at 95 ℃ for 5 min; 30 cycles of (denaturation at 94 ℃ for 30s, annealing at different temperatures for 30s, and extension at 72 ℃ for 30s), and extension at 72 ℃ for 10 min; storing at 4 deg.C; the PCR product is detected by 1% agarose gel electrophoresis to judge whether the PCR product is a target product according to DL 2000Marker, and if not, the PCR product is judged to be the target productSynthesizing a non-fluorescent primer of each site, optimizing and screening PCR reaction conditions, performing polymorphism analysis on the obtained PCR product by 12% polyacrylamide gel electrophoresis, adding a fluorescent marker to the 5' end of the primer upstream of the microsatellite site with good polymorphism and good PCR product, synthesizing a fluorescent primer, performing a large amount of PCR amplification on a sample by using the synthesized fluorescent primer, sequencing the product by Shanghai institute, and detecting polymorphism of the product by ABI3730 Genetic Analyze; if the target product is the target product, adopting 12% of non-denaturing polyacrylamide gel electrophoresis, using a 20bp Ladder marker as a DNA molecular weight marker, observing the migration condition of the amplified product by silver staining, and judging the genotype distribution of the offspring and the male parent and the female parent;
step three, carrying out fluorescence labeling on the upstream 5' ends of 15 microsatellite primers, typing a PCR product on an ABI PRISM 3730gene analyzer, carrying out allele analysis by adopting a capillary electrophoresis method, converting electrophoresis data into the fragment size of an allele through GeneScan3.7 and GenoTyper3.7, automatically identifying the allele, using GeneScan-500[ ROX ] as an internal reference, directly introducing the length of the allele into an Excel table from GenoTyper3.7 for carrying out hierarchical sequencing of the fragment size, and carrying out interpretation of the allele and the genotype according to a David method;
step four, paternity test:
(1) paternity exclusion
Paternal exclusion includes both parental and uniparental identification, wherein:
the single-parent identification is the paternity identification when the maternal sample is lacked;
the parent identification needs to compare the genotypes of the parents of the filial generation and the parent respectively, and calculate the non-parent exclusion probability;
the non-parent exclusion probability is calculated as follows:
Figure BDA0002675252110000031
in the formula, PiRepresenting the ith allele frequency, P, in the populationjRepresenting the j allele in the populationFrequency, j ═ i + 1;
(2) paternity determination
Calculating an affinity index and an affinity relative chance based on the allele frequency of the individual, wherein:
the paternity index is calculated as follows:
PI＝X/Y；
wherein X is the probability that the hypothetical father provides the biogenic father, and Y is the probability that the random man provides the biogenic father;
the formula for calculating the relative chance of paternity is as follows:
Figure BDA0002675252110000041
compared with the prior art, the invention has the following advantages:
the invention utilizes the black bear 15 logged in NCBI to carry out paternity test research on the microsatellite marker with polymorphism so as to establish a set of sensitive and effective microsatellite marker system suitable for the paternity test of the black bear in northeast China, and provides a certain theoretical basis for the breeding management of captive breeding populations in the future.
Drawings
FIG. 1 is a PAGE pattern at UT35 for suspected related individuals;
FIG. 2 is a PAGE pattern at MSUT4 for suspected related individuals;
FIG. 3 is a PAGE pattern at UT38 for suspected related individuals;
FIG. 4 is a graphical representation of genotyping of ABB1 locus relativity;
FIG. 5 is a graphical representation of genotyping of ABB3 locus relativity;
FIG. 6 is a graphical representation of genotyping of ABB4 locus relativity;
FIG. 7 is a graphical representation of genotyping of ABB5 locus relativity;
FIG. 8 is a graphical representation of genotyping of ABB6 locus relativity;
FIG. 9 is a schematic representation of genotyping of ABB7 locus relativity;
FIG. 10 is a schematic representation of genotyping of ABB10 locus relativity;
FIG. 11 is a schematic representation of genotyping of ABB11 locus relativity;
FIG. 12 is a schematic representation of genotyping of ABB12 locus relativity;
FIG. 13 is a graphical representation of genotyping of the relationships at position MSUT 2;
FIG. 14 is a graphical representation of genotyping of the relationships at position MSUT 4;
FIG. 15 is a graphical representation of genotyping of UT3 locus relativity;
FIG. 16 is a graphical representation of genotyping of UT35 locus relativity;
FIG. 17 is a graphical representation of genotyping of UT36 locus relativity;
FIG. 18 is a graphical representation of genotyping of UT38 locus relativity.
Detailed Description
The technical solution of the present invention is further described below with reference to the accompanying drawings, but not limited thereto, and any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention shall be covered by the protection scope of the present invention.
The polymorphic information content of the genetic marker needs to be considered in the selection of the microsatellite DNA marker, the PIC value of 15 microsatellite loci is 0.4218-0.7690, the average PIC value is 0.5735, 4 medium polymorphic markers are present, 11 high polymorphic markers are present, and the average allelic factor is 7.40. When the microsatellite loci are used for paternity test, the allelic factors of the microsatellite loci are at least 4, the result of the microsatellite loci is higher than the requirement, and the result is credible. The result of the invention shows that the polymorphism of the microsatellite locus is high, and the applicable region range and population range of the microsatellite locus are increased to a certain extent.
Errors in allele and genotype discrimination are most often due to loss of the allele. When individual identification and paternity identification are carried out, the loss of one or more alleles can cause errors of individual authentication and deviation of non-paternity exclusion probability; in the test process, the situation of gene loss is difficult to identify for the heterozygous genotype, and only when individual identification is carried out, 18 sites in 19 sites are supposed to be completely matched, and only one site is detected by two samples, namely homozygote and heterozygote, the reason is that the allele loss is possibly suspected. The solution is to design primers on the flanking sequences again or replace kits of other companies for testing again. However, the probability of mutations in the flanking sequences is still relatively small compared to a large genome. In population genetics studies, when the number of samples is large enough, even if allele loss occurs, the effect of the lost allele on the population is negligible.
The effective parameters for paternity testing are PI and RCP. The magnitude of the PI value represents the likelihood that the parent is assumed to be the parent of the child. Zhengxiufen and other researches show that the relationship of the two can be confirmed under the conditions that the PI value is more than 2000.00 and the RCP value is more than 99.95 percent. In general, 9 sites are used and the exclusion probability is more than 99.73%, so that the relatives can be identified. But hou yi et al propose that the probability of exclusion is greater than or equal to 99.95% to confirm paternity.
In the identification of 7-nest 14-head northeast black bears by using 15 loci, the average accumulated PI is between 3717.928 and 88038.26, the average RCP is between 99.9679 and 99.9981 percent, and the relationship of the young bears can be determined. However, in the two individuals in the 5 th nest, one PI value is 1897.283 and is lower than 2000, the corresponding non-father exclusion probability is 99.9473%, and between 0.988 and 0.990, the parent-child relationship is very likely to exist, 15 sites of the individual conform to Mendelian inheritance law, and the paternity relationship is basically recognizable. The presence of high frequency alleles in 15 loci of the individual may be responsible for the lower probability of paternity exclusion.
In the identification process, if 2 or more than 2 sites are adopted and do not accord with the Mendelian genetic law, the principle of paternity and daughter relationship is eliminated, and the influence of potential mutation is avoided. The law that 3 sites do not conform to Mendelian genetic law is adopted in forensic medicine, the error elimination probability is high and can reach 8 multiplied by 10-9. The study object of the invention is the northeast black bear, and the scale of the northeast black bear is not large, so the number of the black bears is largeThe number is small relative to human, and because of the limitation of growth and reproduction space, each group has more or less different degrees of inbreeding, so that the probability of 2 site mutations occurring simultaneously in a group is very small, and the result obtained by adopting the principle is accurate.
Genetic relationship analysis:
the Exclusion Probability (EP), also called paternity Exclusion probability, refers to the chance that a hypothetical father that is not a living father can be excluded by detecting a certain genetic marker system. The calculation formula is as follows:
Figure BDA0002675252110000071
in the formula, PiRepresenting the ith allele frequency, P, in the populationjRepresents the j allele frequency in the population, j ═ i + 1.
CumuLative non-parent Exclusion probability (CCE): the microsatellite loci have mutation, and when the microsatellite loci are identified in the paternity, a plurality of genetic marker systems are generally used to ensure the accuracy of the microsatellite loci, so that the non-father exclusion probability is required to be accumulated after the exclusion probability of each locus is obtained:
Figure BDA0002675252110000072
in the verification of Paternity test, the Paternity Index (PI) and the Relative Chance of Paternity (RCP) are often used to evaluate the Paternity Chance to determine whether there is a relationship between parent and child.
Paternity index:
PI＝X/Y；
where X is the probability that the hypothetical father will provide the gene with the biological father and Y is the probability that the random man will provide the gene with the biological father.
Relative chance of paternity:
Figure BDA0002675252110000081
in general, in captive animals, the relationship between the female parent and the offspring is known, and therefore, the biological father is mainly determined. In this case, sites that are the same genotype of the paternal gene can be excluded from the analysis, and sites that differ for the remaining genotypes can be directly excluded according to Mendelian's Law of inheritance as follows: by comparing the parent and child genotypes, one can determine the allele that the child is likely to be from the parent, and then observe the genotype of the hypothetical parent, and if not have the parent allele, then the parentage relationship of the hypothetical parent to the child can be excluded. If the parents are assumed to have the genes with the parents, the relationship between the parents and the children cannot be excluded, and then sufficient information for judging the parents can be obtained by analyzing other gene loci. When the parent, the offspring and the parent need to be identified, and the triplet relationship needs to compare the alleles of the offspring with the parent and the parent at each position point respectively to gradually find out the biological parent.
Example (b):
1. microsatellite locus polymorphism analysis
Polymorphism analysis was performed on 28 northeast black bears using 15 microsatellite markers, and the results were included in the sample data information of the microsatellite polymorphism analysis shown in table 1.
TABLE 1 microsatellite primer sequences
Figure BDA0002675252110000082
Figure BDA0002675252110000091
2. PAGE typing
And (3) carrying out PAGE typing on the parent, mother and offspring samples suspected of genetic relationship, and observing the distribution of the offspring alleles in the parent and parent genotypes respectively.
As can be seen from fig. 1, in the UT35 locus, the suspected parent of the child C1 is F2, and the suspected parent is M2; the suspicious parent of the child C2 is F2, and can be parent M1; neither F1 is a suspicious parent for both children.
As can be seen from fig. 2, at MSUT4, the suspected parent of child 5 is 2 and the suspected parent is 3; the suspicious parent generation of the child 7 is 2, and the mother generation can be 4; neither F1 is a suspicious parent for both children.
As can be seen from fig. 3, in the UT38 locus, the suspected parent of the child C4 is F4, and the suspected parent is M5; and the suspect parent and the parent of child C3 are not in the above sample.
3. ABI PRISM 3730Genetic Analyzer assay
And (3) carrying out typing detection on PCR products of suspected related individuals at each site by adopting ABI PRISM 3730, and independently comparing typing results with the related relationships.
As is clear from FIG. 4, the alleles of progeny C10 at ABB1 are (205.14/208.34), respectively; the alleles of the parent F10 were (196.06/208.34), respectively; the alleles of parent M10 were (205.14/217.45), respectively. The progeny allele 208.34 is from the parent F10, the progeny allele 205.14 is from the parent M10, and the relative chance of paternity can reach 99.9879% by calculating the RCP value of 15 sites.
As is clear from FIG. 5, the alleles of progeny C1 at ABB3 are (163.91/184.26), respectively; the alleles of the parent F1 were (163.91/188.83), respectively; the alleles of parent M1 were (163.91/184.26), respectively. The progeny allele 163.91 is from the parent F1, the progeny allele 184.26 is from the parent M1, and the relative chance of paternity can reach 99.9583% by calculating the RCP value of 15 sites.
As is clear from FIG. 6, the alleles of progeny C3 at ABB4 are (134.02/137.22), respectively; the allele of parent F3 was (134.02/137.22); the alleles of parent M3 were (137.22/141.80), respectively. The progeny allele 137.22 is from the parent M3, the progeny allele 134.02 is from the parent F3, and the relative chance of paternity can reach 99.9868% by calculating the RCP value of 15 sites.
As is clear from FIG. 7, the alleles of progeny C7 at ABB5 are (240.33/251.28), respectively; the alleles of the parent F7 were (251.28/270.21), respectively; the alleles of parent M7 were (228.76/240.33), respectively. The progeny allele 251.28 is from the parent F7, the progeny allele 240.33 is from the parent M7, and the relative chance of paternity can reach 99.9969% by calculating the RCP value of 15 sites.
As is clear from FIG. 8, the alleles of progeny C11 at ABB6 are (242.36/252.45), respectively; the alleles of the parent F11 were (252.45/261.25), respectively; the alleles of parent M11 were (242.36/249.24), respectively. The progeny allele 252.45 is from the parent F11, the progeny allele 242.36 is from the parent M11, and the relative chance of paternity can reach 99.9952% by calculating the RCP value of 15 sites.
As is clear from FIG. 9, the alleles of progeny C4 at ABB7 are (107.61/119.41), respectively; the alleles of the parent F4 were (109.81/119.41), respectively; the alleles of parent M4 were (107.61/122.59), respectively. The progeny allele 119.41 is from the parent F4, the progeny allele 107.61 is from the parent M4, and the relative chance of paternity can reach 99.9876% by calculating the RCP value of 15 sites.
As is clear from FIG. 10, the alleles of progeny C10 at ABB10 are (160.46/166.21), respectively; the parent F10 is an individual homozygous for the allele (160.46/160.46); the alleles of parent M10 were (154.54/166.21), respectively. The progeny allele 160.46 is from the parent F10, the progeny allele 166.21 is from the parent M10, and the relative chance of paternity can reach 99.9879% by calculating the RCP value of 15 sites.
As is clear from FIG. 11, the alleles of progeny C5 at ABB11 are (197.43/201.09), respectively; the alleles of the parent F5 were (197.43/213.32), respectively; the alleles of parent M5 were (201.09/217.72), respectively. The progeny allele 197.43 is from the parent F5, the progeny allele 201.09 is from the parent M5, and the relative chance of paternity can reach 99.9973% by calculating the RCP value of 15 sites.
As is clear from FIG. 12, the progeny C4 at ABB12 is a homozygous allele with a genotype of (146.93/146.93); the alleles of the parent F4 were (146.93/166.64), respectively; the alleles of parent M4 were (146.93/166.64), respectively. Wherein, the allele 146.93 of the offspring homozygote comes from the male parent and the female parent respectively, and the relative chance of paternity can reach 99.9876 percent by calculating the RCP value of 15 loci.
As is clear from fig. 13, the alleles of progeny C6 at MSUT2 are (219.93/221.95), respectively; the alleles of the parent F6 were (209.93/219.93), respectively; the alleles of parent M6 were (209.93/221.95), respectively. The progeny allele 219.93 is from the parent F6, the progeny allele 221.95 is from the parent M6, and the relative chance of paternity can reach 99.9908% by calculating the RCP value of 15 sites.
As is clear from FIG. 14, the alleles of progeny C9 at position MSUT4 were (78.57/82.55), respectively; parent F9 is homozygous for the allele (82.55/82.55); the parent M9 is homozygote and the allele is (78.57/78.57). The progeny allele 82.55 is from the parent F9, the progeny allele 78.57 is from the parent M9, and the relative chance of paternity can reach 99.9473% by calculating the RCP value of 15 loci.
As is clear from FIG. 15, the alleles of progeny C8 at UT3 were (200.49/209.40), respectively; the alleles of the parent F8 were (188.03/200.49), respectively; the alleles of parent M8 were (209.40/221.68), respectively. The progeny allele 200.49 is from the parent F8, the progeny allele 209.40 is from the parent M8, and the relative chance of paternity can reach 99.9993% by calculating the RCP value of 15 sites.
As is clear from FIG. 16, the alleles of progeny C14 at UT35 were (153.46/156.66), respectively; the alleles of the parent F14 were (153.46/156.66), respectively; the alleles of parent M14 were (119.58/153.46), respectively. Wherein the allele 153.46 of the offspring C14 is from the mother generation M14, the allele 156.66 of the offspring C14 is from the father generation F14, and the relative chance of the paternity can reach 99.9942% by calculating the RCP value of 15 sites.
As is clear from FIG. 17, the alleles of progeny C2 at UT36 were (255.71/267.59), respectively; the alleles of the parent F2 were (267.59/275.20), respectively; the alleles of parent M2 were (255.71/278.82), respectively. The progeny allele 255.71 is from the parent M2, the progeny allele 267.59 is from the parent F2, and the relative chance of paternity can reach 99.9801% by calculating the RCP value of 15 sites.
As is clear from FIG. 18, the alleles of progeny C13 at UT38 were (182.01/207.28), respectively; the alleles of the parent F13 were (182/01/194.96), respectively; the alleles of parent M13 were (173.78/207.28), respectively. The progeny allele 182.01 is from the parent F13, the progeny allele 207.28 is from the parent M13, and the relative chance of paternity can reach 99.9950% by calculating the RCP value of 15 sites.
4. Paternity testing
4.1 paternity exclusion
The paternal exclusion includes paternity test and uniparental test, the uniparental test is paternity test when the maternal sample is absent, and the paternity test needs to compare the genotypes of the filial generation and the parental generation respectively and calculate the probability of non-paternal exclusion. According to the invention, the non-father exclusion probability is calculated according to the allele frequency of each locus, which is shown in table 2; the cumulative exclusion probability value CCE for 15 microsatellite loci is 0.999985.
TABLE 2 non-paternal exclusion probabilities for the northeast black bear at 15 microsatellite loci
Figure BDA0002675252110000131
Figure BDA0002675252110000141
4.2 paternity determination
The paternity index and the chance of paternity determination were calculated from the allele frequencies of the individuals, see tables 3 and 4. The calculation shows that the range of the affinity index PI value is 2397.721-143169.8, and the range of RCP is 99.9473-99.9993%.
TABLE 3 cumulative PI values for 7-litter progeny of the northeast black bear at 15 microsatellite loci
Figure BDA0002675252110000142
Table 4 RCP values (%) -for 7-litter progeny from northeast black bear at 15 microsatellite loci
Figure BDA0002675252110000143

Claims (6)

1. A method for identifying the genetic relationship of black bear in northeast China by using microsatellite markers is characterized by comprising the following steps:
step one, taking the northeast black bear as a research object, and adopting 15 microsatellite loci to perform polymorphism analysis on the northeast black bear, wherein: the 15 microsatellite loci are ABB1, ABB3, ABB4, ABB5, ABB6, ABB7, ABB10, ABB11, ABB12, MSUT2, MSUT4, UT3, UT35, UT36 and UT38 respectively;
step two, extracting black bear hair genome DNA by adopting a QIAamp DNA Investigator kit method, and using the black bear hair genome DNA as a template for later use; judging whether the PCR product is a target product or not according to DL 2000Marker by adopting 1% agarose gel electrophoresis detection, if so, adopting 12% non-denaturing polyacrylamide gel electrophoresis, using 20bp Ladder Marker as a DNA molecular weight Marker, observing migration condition of the amplified product by adopting silver staining, and judging genotype distribution of offspring and male parent and female parent;
step three, carrying out fluorescence labeling on the upstream 5' ends of 15 microsatellite primers, typing a PCR product on an ABI PRISM 3730gene analyzer, carrying out allele analysis by adopting a capillary electrophoresis method, converting electrophoresis data into the fragment size of an allele through GeneScan3.7 and GenoTyper3.7, automatically identifying the allele, using GeneScan-500[ ROX ] as an internal reference, directly introducing the length of the allele into an Excel table from GenoTyper3.7 for carrying out hierarchical sequencing of the fragment size, and carrying out interpretation of the allele and the genotype according to a David method;
step four, paternity test:
(1) paternity exclusion
Paternal exclusion includes both parental and uniparental identification, wherein: the single-parent identification is the paternity identification when the maternal sample is lacked; the parent identification needs to compare the genotypes of the parents of the filial generation and the parent respectively, and calculate the non-parent exclusion probability;
(2) paternity determination
An paternity index and relative chance of paternity are calculated based on the allele frequencies of the individual.
2. The method for identifying the relationship between black bear in northeast China as claimed in claim 1, wherein the PCR amplification primer sequences of ABB1, ABB3, ABB4, ABB5, ABB6, ABB7, ABB10, ABB11, ABB12, MSUT2, MSUT4, UT3, UT35, UT36 and UT38 are as follows:
ABB1：
F:TGAGAAATGGGCTGAAAACC，
R:GGAGACAGGGCTTGTGATGT；
ABB3：
F:TGTGAAAAAGAAAAGGTCGGA，
R:ACAGATACCAACTCATTGAAAGG
ABB4：
F:GATCTGGAGCCAAACACG，
R:CTGCTCCTGAAGCCATAA；
ABB5：
F:CCGGGCTGTTTTCACTAGAA，
R:CCTGGGGTTCTGAATCTGAC；
ABB6：
F:TGGTGTGTCCTAGCGTGAAG，
R:CGTACCCTCCAAACCGATAA；
ABB7：
F:GAGGAACCTGGCAAAGTGAC，
R:GGAGACAGGGCTTGTGATGT；
ABB10：
F:TCTGTTCCCAGATAAGGTC，
R:GGGTGGGGTATGAAGATG；
ABB11：
F:GGATAAATTACAAGACAGGAAA，
R:GCTCCTCCGCTATGAGTC；
ABB12：
F:ATAGTTTTAGTTCAGGTG，
R:TGATGGTTTTAGAGTAAT；
MSUT2：
F:GAATCCTAAACAGGTTAAACACA，
R:TATTACATTGTCTTCTGGTTTGC；
MSUT4：
F:GTGTCCAACTGTAGATGA，
R:TGAGTAATATTCTTTTCTCT；
UT3：
F:GTGTTTGGGTAAAGGCATAGGA，
R:TCACTCCAGTGGCTTCCTTC；
UT35：
F:CTCCCTAGTAAGTAGAAAGCACA，
R:GTATGTGGACCCAGGTTTGA；
UT36：
F:AGACTCAGGAAGTCTGGAGTGGGA，
R:CTTTCGGCTCAGGGATCGAGC；
UT38：
F:ATTATTGATGAGCAGGGACAG，
R:CTAAAGCAACAACATGTGAATG。
3. the method for identifying the relationship between black bear and black bear using microsatellite markers as claimed in claim 1 wherein said PCR amplification reaction system is 25L: 2.5mM dNTPs 2L, buffer 2L, F-primer 1L, R-primer 1L, Template 2L, rTaq 0.25L, ultrapure water 14.75-15.75L, Mg2+0.5-2L; the PCR amplification reaction program is as follows: pre-denaturation at 95 ℃ for 5 min; 30 cycles of (denaturation at 94 ℃ for 30s, annealing at different temperatures for 30s, and extension at 72 ℃ for 30s), and extension at 72 ℃ for 10 min; storing at 4 ℃.
4. The method for identifying black bear kinship in northeast of China by using microsatellite markers according to claim 1 wherein the non-father exclusion probability is calculated as follows:
Figure FDA0002675252100000041
in the formula, PiRepresenting the ith allele frequency, P, in the populationjRepresents the j allele frequency in the population, j ═ i + 1.
5. The method for identifying the affinity of black bear in northeast of China as claimed in claim 1, wherein the affinity index is calculated as follows:
PI＝X/Y；
where X is the probability that the hypothetical father will provide the gene with the biological father and Y is the probability that the random man will provide the gene with the biological father.
6. The method for identifying the kinship of the black bear in northeast of China using microsatellite markers as set forth in claim 1 wherein the calculation formula of the paternity versus chance is as follows:
Figure FDA0002675252100000051
wherein PI is an paternity index.
CN202010945822.2A 2020-09-10 2020-09-10 Method for identifying relationship of black bear in northeast China by using microsatellite markers Pending CN111926091A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010945822.2A CN111926091A (en) 2020-09-10 2020-09-10 Method for identifying relationship of black bear in northeast China by using microsatellite markers

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010945822.2A CN111926091A (en) 2020-09-10 2020-09-10 Method for identifying relationship of black bear in northeast China by using microsatellite markers

Publications (1)

Publication Number Publication Date
CN111926091A true CN111926091A (en) 2020-11-13

Family

ID=73308907

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010945822.2A Pending CN111926091A (en) 2020-09-10 2020-09-10 Method for identifying relationship of black bear in northeast China by using microsatellite markers

Country Status (1)

Country Link
CN (1) CN111926091A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113160892A (en) * 2021-05-25 2021-07-23 北京众诚天合系统集成科技有限公司 Method and system for determining genetic relationship of mixed DNA typing

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
高建伟: "应用微卫星DNA标记对延边圈养黑熊进行亲子鉴定和遗传多样性研究", 《中国博士学位论文全文数据库农业科技辑》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113160892A (en) * 2021-05-25 2021-07-23 北京众诚天合系统集成科技有限公司 Method and system for determining genetic relationship of mixed DNA typing
CN113160892B (en) * 2021-05-25 2023-12-01 北京众诚天合系统集成科技有限公司 Mixed DNA typing genetic relationship determination method and system

Similar Documents

Publication Publication Date Title
Turner et al. Genomic islands of speciation in Anopheles gambiae
Borevitz et al. Large-scale identification of single-feature polymorphisms in complex genomes
Houston et al. Development and validation of a high density SNP genotyping array for Atlantic salmon (Salmo salar)
Matukumalli et al. Development and characterization of a high density SNP genotyping assay for cattle
Huang et al. High-throughput genotyping by whole-genome resequencing
CM Dekkers Application of genomics tools to animal breeding
JP7198199B2 (en) Methods to Identify Microsatellite Instability
King et al. Detection of structural mosaicism from targeted and whole-genome sequencing data
Hayes et al. The origin of selection signatures on bovine chromosome 6
CN111705140B (en) SNPs molecular marker related to weight traits and application thereof in Hu sheep assisted breeding
Jamann et al. QTL mapping using high-throughput sequencing
Beal et al. Whole genome sequencing for quantifying germline mutation frequency in humans and model species: cautious optimism
Zhou et al. Development of a 50K SNP array for Japanese flounder and its application in genomic selection for disease resistance
US20180119210A1 (en) Fetal haplotype identification
CN111926091A (en) Method for identifying relationship of black bear in northeast China by using microsatellite markers
CN114303202A (en) System and method for determining genetic patterns in embryos
Zhu et al. Screening for highly heterozygous chickens in outbred commercial broiler lines to increase detection power for mapping quantitative trait loci
US20090264307A1 (en) Array-based polymorphism mapping at single nucleotide resolution
JP7446343B2 (en) Systems, computer programs and methods for determining genome ploidy
CN111172248B (en) General kit for verifying copy number variation based on fragment analysis technology
Dicks et al. Haplotyping MHC class IIa by high throughput screening in an isolated sheep population 2
Herry et al. Restriction site-associated DNA sequencing technologies as an alternative to low-density SNP chips for genomic selection: a simulation study in layer chickens
Wilson et al. Identification of single nucleotide polymorphisms for use in a genetic stock identification system for greater white-fronted goose (Anser albifrons) subspecies wintering in California
CN115961054B (en) Genetic marker for identifying south China tiger individuals and/or paternity testing and application thereof
CN114875160B (en) Application of reagent for detecting SNP molecular marker related to chicken heat stress tolerance, primer combination and detection and identification method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20201113