CN111925439A

CN111925439A - Method for rapidly screening new coronavirus RBD (radial basis function) specific fully human neutralizing monoclonal antibody

Info

Publication number: CN111925439A
Application number: CN202010839232.1A
Authority: CN
Inventors: 金艾顺; 韩晓建; 王应明; 胡超; 李婷婷; 王建为; 李胜龙; 申美莹
Original assignee: Chongqing Medical University
Current assignee: Chongqing Medical University
Priority date: 2020-08-19
Filing date: 2020-08-19
Publication date: 2020-11-13

Abstract

The invention belongs to the technical field of monoclone, and particularly discloses a method for rapidly screening a full-human-derived neutralizing monoclonal antibody of new coronavirus RBD specificity, which comprises the following steps: S1-S3, collecting peripheral blood of a patient recovering from the new coronary pneumonia, sorting RBD specific memory B cells, and obtaining antibody variable region cDNA by RT-PCR amplification; s4, amplifying the cDNA of the antibody variable region obtained from S1-S3 by adopting nested PCR, and constructing an antibody variable region gene expression cassette; s5, transducing the antibody variable region gene expression box obtained in S4 into cell expression antibody, collecting supernatant, and screening RBD specific monoclonal antibody; s6, detecting the activity of blocking pseudovirus infected cells by using the RBD specific antibody supernatant obtained in S5, detecting the binding capacity of the RBD and ACE2 blocked by using ELISA, detecting the neutralizing capacity of the monoclonal antibody by using a double method, and screening the RBD specific neutralizing monoclonal antibody. The invention can quickly and efficiently obtain the specific fully humanized neutralizing monoclonal antibody of the new coronavirus RBD.

Description

Method for rapidly screening new coronavirus RBD (radial basis function) specific fully human neutralizing monoclonal antibody

Technical Field

The invention belongs to the technical field of monoclone, and particularly relates to a method for rapidly screening a full-human neutralizing monoclonal antibody with new coronavirus RBD specificity.

Background

The research finds that: the new coronavirus (SARS-CoV-2) has four main structural proteins, namely spike protein (S protein), nucleocapsid protein (N protein), membrane protein (M protein) and envelope protein (E protein), wherein the S protein has two subunits of S1 and S2, and a receptor binding site (RBD) is positioned on the S1 subunit, and has the main functions of recognizing a host cell surface receptor and mediating the fusion of SARS-CoV-2 and a host cell.

At present, specific drug-specific treatment is not available for new pathogen COVID-19, and the development of vaccines requires a current day. The plasma of a patient who is cured and discharged recently contains high-concentration specific antigen neutralizing antibodies, and after the plasma is input into the body of the patient, the plasma can neutralize new corona pathogens and mediate effective immune response, so that the plasma in the recovery period is expected to provide an effective treatment means for treating the patient infected with new corona viruses, the death rate is reduced, and the life safety of the patient is guaranteed.

The Chinese invention patent application with the application publication number of CN111303280A discloses a fully human monoclonal antibody with high neutralizing activity against SARS-CoV-2, which is prepared by the following steps: (1) sorting of individually labelled individuals using flow cytometry (CD 3)^neg/CD20^low/CD19^high/CD27^high/CD38^high) The plasma cell of (a); (2) amplifying the variable region gene of the fully human monoclonal antibody by utilizing reverse transcription-PCR and nested-PCR technologies; (3) constructing a linear expression frame; (4) constructing an expression vector and performing enzyme digestion identification; (5) transient expression of monoclonal antibody and affinity chromatographic purification.

The above patent provides fully human monoclonal antibodies recognizing the non-RBD region of S1, but the fully human monoclonal antibodies obtained in the above patent have limited blocking effect against viruses since invasion of new coronavirus into host cells is bound to ACE2 of host cells through RBD, and the above patent obtains antibody cDNA by labeling plasma cells, which causes limited humoral immune response.

Disclosure of Invention

The invention aims to provide a method for rapidly screening a new coronavirus RBD specific fully human neutralizing monoclonal antibody aiming at an RBD receptor binding site of SARS-CoV-2 and capable of triggering stronger humoral immune response.

In order to achieve the purpose, the technical scheme of the invention is as follows:

the method for rapidly screening the fully human neutralizing monoclonal antibody with the new coronavirus RBD specificity comprises the following steps:

S1-S3, collecting peripheral blood of a patient with the rehabilitation of the new coronary pneumonia, sorting RBD specific memory B cells, and obtaining antibody variable region cDNA through mRNA of the RBD specific memory B cells;

s4, amplifying the cDNA of the antibody variable region obtained from S1-S3 by adopting nested PCR, and constructing an antibody variable region gene expression cassette;

s5, transducing the antibody variable region gene expression box obtained in S4 into cell expression antibody, collecting supernatant, and screening RBD specific monoclonal antibody;

s6, detecting the RBD specific antibody supernatant obtained in S5 to block the activity of pseudovirus infected cells, detecting the RBD and ACE2 binding capacity of the supernatant, detecting the neutralizing capacity of the monoclonal antibody by a double method, and screening the RBD specific neutralizing monoclonal antibody.

Preferably, S2, first removing Dead cells of PBMC obtained from S1 by Dead cell removal Dye (Dead Dye), then using CD19, mIgG, mIgD and S-RBD to stain the PBMC with a memory B cell stain marker which is specific to the living RBD and has high binding capacity, and screening the memory B cells specific to the RBD; s3, obtaining the antibody variable region cDNA by RT-PCR amplification. The method can accurately screen the memory B cells with RBD specificity and high binding capacity by a simple labeling method, and has the advantages of high flux, rapidness, simplicity and convenience.

Preferably, in S5, the antibody variable region gene expression cassette obtained in S4 is transduced into mammalian cells to express the antibody for 48 hours and the supernatant is collected, coated with RBD using 384-well plates, and the supernatant is examined to screen for monoclonal antibodies specific to RBD. The invention can screen the RBD specific monoclonal antibody and has the advantages of high flux, rapidness, convenience and the like.

Preferably, in S4, the antibody variable region cDNA obtained from S1-S3 is amplified by nested PCR, and then an antibody variable region gene expression cassette is constructed. The technical scheme has high amplification accuracy.

The principle and the beneficial effects of the invention are as follows:

(1) the monoclonal antibody prepared by the screening method has RBD specificity, has virus blocking effect compared with a monoclonal antibody aiming at an S1 non-RBD region, has a larger chance of screening a neutralizing antibody, and provides wider application values for screening antibody medicines, diagnosing, preventing and treating new coronary pneumonia.

(2) The monoclonal antibody prepared by the screening method is obtained by sorting RBD specific memory B cells, but compared with plasma cells, the memory B cells react quickly after being activated in humoral immunity, so that the memory B cells can initiate a humoral immune response which is faster and stronger than an initial response.

In addition, the invention only aims at RBD specific memory B cells to carry out subsequent RT-PCR, nested PCR and antibody function analysis, greatly improves the screening efficiency, shortens the research and development period of monoclonal antibodies, and particularly shortens the workload and the working time after screening the RBD specific memory B cells.

(3) Compared with the screening method in the prior art, the RBD specific memory B cell is obtained by marking, then the mammalian cell is directly transduced by using an antibody gene expression cassette to harvest supernatant within 48 hours, the RBD antigen is coated by a 384-well reaction plate to detect the supernatant, the RBD specific monoclonal antibody is screened, and the neutralizing capacity of the antibody is evaluated by a double method of detecting the capacity of the antibody supernatant for blocking pseudovirus infected cells and detecting the capacity of the antibody for blocking ACE2 and RBD binding, so that the method has the advantages of high throughput, rapidness, simplicity and convenience.

Drawings

FIG. 1 is a diagram of cell sorting by flow cytometry analysis of memory B cells;

FIG. 2 is a diagram of cell sorting by flow cytometry analysis of memory B cells;

FIG. 3 is a gel electrophoresis of the PCR product of the antibody gene of a single cell;

FIG. 4 is a photograph of agarose gel electrophoresis following PCR amplification of an antibody gene expression cassette containing the CMV promoter, WPRE-gamma or WPRE-kappa element;

FIG. 5 is a graph showing the result of RBD-specific detection;

FIG. 6 is a graph showing the result of RBD-specific detection;

FIG. 7 is a graph showing the result of RBD-specific detection;

FIG. 8 is a graph showing the result of RBD-specific detection;

FIG. 9 is a graph showing the result of RBD-specific detection;

FIG. 10 is a graph showing the result of RBD-specific detection;

FIG. 11 is a graph showing the result of RBD-specific detection;

FIG. 12 is a graph showing the result of RBD-specific detection;

FIG. 13 is a graph showing the result of RBD-specific detection;

FIG. 14 is a graph showing the results of the detection of the neutralizing ability of an antibody by a pseudovirus infection test;

FIG. 15 is a graph showing the results of the detection of the neutralizing ability of antibody blocking the binding of RBD to ACE2 by ELISA.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The embodiment provides a method for rapidly screening a new coronavirus RBD specific fully humanized neutralizing monoclonal antibody, which comprises the steps of obtaining a single RBD specific memory B cell from peripheral blood of a new coronary pneumonia rehabilitation patient by separation, then obtaining mRNA of the RBD specific memory B cell, then constructing an antibody variable region gene expression box through RT-PCR and nested PCR, then transferring the antibody variable region gene expression box into 293T cell expression antibody and collecting supernatant, detecting the RBD specificity of the supernatant by an ELISA method, and screening to obtain the RBD specific monoclonal antibody; and detecting the activity of blocking pseudovirus infected cells by using the obtained supernatant, detecting the RBD and ACE2 binding capacity of the supernatant by using an ELISA method, detecting the neutralizing capacity of the monoclonal antibody by using a double method, and screening the RBD specific neutralizing monoclonal antibody.

The method specifically comprises the following steps:

s1, collecting peripheral blood of a plurality of patients with the new coronary pneumonia, separating to obtain PBMC, and freezing and storing in a refrigerator at-80 ℃ for later use.

S2, firstly removing Dead cells of PBMC obtained by S1 by using Dead cell Dye (Dead Dye), then adopting CD19, mIg-G, mIg-D and S-RBD to stain and mark the memory B cells with high specificity and binding capacity for the living RBD in the PBMC, and screening out the memory B cells specific to the RBD; specific memory B cells were sorted using a flow cytometric sorter onto 96-well plates, one specific memory B cell per well, and frozen at-80 ℃ in a freezer for use.

Specifically, the preferred concentration range of the Dead Dye staining in this embodiment is 1-2 μ g/mL, and the preferred concentration range of the Dead Dye staining in this embodiment is 1.5 μ g/mL; CD19 is a B cell marker produced by Biolegend and is stained at a concentration ranging from 1 to 2. mu.g/mL, preferably at a concentration of 1.5. mu.g/mL for CD19 in this example. mIg-G is a B cell surface receptor produced by Biolegend, and the concentration range of the mIg-G during staining is 1-2 mu G/mL, and the concentration of the mIg-G during staining is 1.5 mu G/mL in the embodiment; mIg-D is B cell surface receptor produced by Biolegend, and the concentration range when staining is 1-2 μ g/mL, and the concentration when staining mIg-D is 1.5 μ g/mL is preferred in the embodiment; S-RBD is a novel coronavirus produced by sinobiological, is a protein receptor domain, and is stained at a concentration ranging from 1 to 2. mu.g/mL, and the concentration of S-RBD staining is preferably 1.5. mu.g/mL in this example.

Cell sorting of PBMC by CD19, mIg-G, mIg-D and S-RBD for RBD-specific memory B cells by flow cytometry cell sorting of PBMC with S-RBD-specific memory B cells cell sorting profiles are shown in FIGS. 1 and 2, where Batch

ID

0428, 0505, 0522, 0528 in FIG. 2 are screening batches. The principle of screening RBD-specific memory B cells by CD19, mIg-G, mIg-D and S-RBD in this example is as follows: PBMC were stained with Dead cell stain (Dead Dye), B cell marker CD19, memory B cell markers mIg-G positive and mIg-D negative, and memory B cells expressing RBD-specific IgG, and then a CD19 cell population was divided from the cell population using a flow cytometer, and mIg-G was divided from the CD19 positive cell population⁺mIg-D^-Cell population from mIg-G⁺mIg-D^-Dividing the cell group into RBD positive memory B cells, and sorting the RBD positive memory B cells by a flow cytometry sorter.

S3, sorting to obtain mRNA of single RBD specific memory B cell, and obtaining antibody variable region cDNA by RT-PCR amplification. Specifically, when RT-PCR is used to amplify antibody variable region cDNA, the primer front segment of the primer designed in this example is designed with a universal Leader (see primer sequence listing i and primer sequence listing ii), which effectively improves the amplification rate of antibody gene, and the experimental result is shown in fig. 3.

S4, amplifying the antibody variable region cDNA obtained from S1-S3 by adopting nested PCR, and constructing an antibody variable region gene expression cassette.

S3 and S4 were performed in total by the following six sections: (1) extracting mRNA of RBD specific memory B cells; (2) single cell mRNA Reverse Transcription (RT); (3) adding a G tail (TDT); (4) first round PCR (1st PCR); (5) second round PCR (2nd PCR); (6) BCR-ORF PCR amplification constructs gene expression cassettes; (7) CMV, WPRE-gamma/kappa/l fragment amplification and CMV, BCR-Vgamma/kappa/l ((6) products), WPRE-gamma/kappa/l overlap PCR (overlap PCR) pre-connection; (8) BCR-gamma ORF, BCR-kappa ORF and BCR-lPCR amplification.

The preparation and reaction conditions of each part of reaction liquid are as follows:

(1) using Dynabeads^TM mRNA DIRECT^TMThe single cell mRNA extraction is carried out by a Purification Kit (Thermo Fisherscientific), and the method specifically comprises the following steps:

centrifuging: taking out the 96-well plate sorted with single RBD specific memory B cells from a refrigerator at-80 ℃, and centrifuging the plate at 600 Xg for 30s to enable the cells to be centrifuged at the bottom of the well;

cleaning: taking out a Dynabeads oligo (dT)25 microsphere bottle, uniformly mixing the Dynabeads oligo (dT)25 microsphere bottle by vortex, sucking enough microspheres according to 2 mu l/hole, placing the microspheres on a magnet block, standing for 30s, discarding supernatant, and resuspending the microspheres by using 500 mu l of lysine Buffer;

preparing: adding the microspheres into a 50mL centrifuge tube according to 9. mu.l/hole lysine Buffer, adding the 500. mu.l microsphere suspension, and uniformly blowing by using a gun;

fourthly, subpackaging: subpackaging the microspheres by using an eight-connecting tube, and then adding the microspheres into a cell plate according to 9 mu l/hole by using a row gun;

moistening and washing: pasting a film on a 96-hole plate, then rinsing the periphery of the tube wall for 2 cycles;

sixthly, incubation: standing at room temperature for 5min to fully release and combine mRNA of the RBD specific memory B cells to the microspheres, and after the incubation is finished, performing 600 Xg instantaneous centrifugation to enable the microspheres to be centrifuged at the bottom of the hole. Place 96-well plates in DynaMag^TM-96side Magnet magnetic plate, pipette off supernatant;

seventhly, washing by Wash A: adding Washing Buffer A according to 8 mul/hole, walking the plate back and forth for 7-8 times to fully wash the microspheres, and discarding the supernatant;

and (8) washing with Wash B: wash Buffer B was added at 8. mu.l/well, the plate was walked back and forth 7-8 times to wash the microspheres thoroughly, the supernatant was discarded, and then the pre-prepared Reverse Transcription (RT) reaction was added at 10. mu.l/well. The reagent preparation and reaction conditions are described in the following (2).

(2) Reverse Transcription (RT) (10. mu.l system) and reagents required to be formulated are shown in Table 1 below.

Name of reagent	Volume of
		DEPC-H₂O	4.5μl
5×primerscript Buffer	2.0μl
		2.5mM dNTP	2.0μl
RNase Inhibitor	1μl
		Sample	beads
PrimerScript Ⅱ RTase	0.5μl
		Total volume	10μl

Reaction conditions are as follows: 42 ℃ for 60min (mix every 20 min).

After the reaction was completed, the 96-well plate was instantaneously centrifuged at 600 Xg, and then the 96-well plate was separatedIs placed in DynaMag^TMOn a 96-side Magnet magnetic plate, the supernatant was aspirated off by a discharge gun, and then a previously prepared TDT reaction solution was added at 10. mu.l/well, and the reagent preparation and reaction conditions were as described in (3) below.

(3) Add G tail (TDT) (10. mu.l system): the reagents required for formulation are shown in table 2 below.

Name of reagent	Volume of
		H₂O	6.4μl
5×TdT buffer	2.0μl
		10mM dGTP	0.5μl
0.1％BSA	1.0μl
		Sample	beads
TdT	0.1μl
		Total volume	10μl

Reaction conditions are as follows: 37 ℃ for 40min (mix every 20 min).

After the reaction, the reaction mixture was centrifuged at 600 Xg in a 96-well plate and then placed in DynaMag^TMOn a 96-side Magnet magnetic plate, the supernatant was aspirated off by a pipette, and then a first PCR (1st PCR) reaction solution prepared in advance was added at 10. mu.l/well, and the reagent preparation and reaction conditions were as described in (4) below.

(4)1st PCR (10. mu.l system) (see primer sequence Listing): the reagents required for formulation are shown in table 3 below.

Name of reagent	Volume of
		H₂O	1.9μl
2×GC Buffer	5μl
		2.5mM dNTP	1μl
FP:AP3-dC(10μM)	0.5μl
		RP1:Cg-1st(10μM)	0.5μl
RP2:Ck-1st(10μM)	0.5μl
		RP3:CI-RT(10μM)	0.5μl
PrimesTAR	0.1μl
		sample	beads
Total volume	10μl

Based on the PCR principle, the experimental reaction conditions of 1st PCR are as follows: firstly, pre-denaturation is carried out for 3min at 95 ℃; ② denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 5sec, extension at 72 ℃ for 1min, 30-35cycles, preferably 30cycles in the embodiment; ③ extension for 5min at 72 ℃ and preservation at 4 ℃.

(5) Second round PCR (2nd PCR) (10. mu.l system) (see primer sequence Listing one and primer sequence Listing two): the reagents required for formulation are shown in table 4 below.

Name of reagent	Volume of
		H₂O	1.5μl
2×GC Buffer	5μl
		2.5mM dNTP	1μl
FP:MAC-AP3/AP3(10μM)	0.5μl
		RP:Cg-nest/K20/CI-nest(10μM)	0.5μl
PrimesTAR	0.5μl
		sample	1μl
Total volume	10μl

Based on the PCR principle, the experimental reaction conditions of 2nd PCR are as follows: firstly, pre-denaturation is carried out for 3min at 95 ℃; ② denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 5s, extension at 72 ℃ for 1min, 30-35cycles, preferably 35cycles in the embodiment; extending for 5min at 72 deg.C, and storing at 4 deg.C.

After the PCR is finished: mu.l of each well was subjected to 1.5% agarose gel electrophoresis. The cell pore paired with the Gamma chain and Kappa chain or Lamada chain was sequenced.

(6) Amplification and construction of antibody expression cassette (BCR-ORF): PCR amplification promoter region (CMV promoter), WPRE-gamma (antibody gamma chain) and WPRE-kappa (antibody kappa chain) the PCR amplification system is shown in Table 5 below.

The PCR amplification conditions were: firstly, pre-denaturation is carried out for 3min at 95 ℃; ② denaturation at 95 ℃ for 15sec, annealing at 56 ℃ for 15sec, extension at 72 ℃ for 1min, 30 cycles; ③ extension for 5min at 72 ℃ and preservation at 12 ℃.

(7) CMV, WPRE-gamma/kappa/l fragment amplification and CMV, BCR-Vgamma/kappa/l, WPRE-gamma/kappa/l overlap PCR (overlap PCR) pre-ligation: the experimental system is shown in table 6 below.

The PCR amplification conditions were: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15sec, annealing at 50 ℃ for 15sec, extension at 72 ℃ for 1.5min, 10 cycles; extending for 5min at 72 deg.C, and storing at 12 deg.C.

(8) BCR-gamma ORF, BCR-kappa ORF and BCR-l PCR amplification: the experimental system is shown in table 7 below.

PCR amplification procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15sec, annealing at 58 ℃ for 15sec, extension at 72 ℃ for 1.5min, 30 cycles; extending for 5min at 72 deg.C, and storing at 12 deg.C.

After amplification, agarose gel electrophoresis is adopted, whether the size of the obtained antibody variable region gene is correct or not is analyzed by gel imaging, the experimental result is shown in figure 4, the Marker is in the middle position, and the band is in the position of 5000 bp.

BCR-gamma ORF and BCR-kappa/ORF ethanol precipitation: placing 30 μ l of PCR products of BCR-gamma ORF and BCR-kappa ORF in 8 connecting tubes respectively, adding 120 μ l of anhydrous ethanol and 6 μ l of sodium acetate solution, mixing well, and standing at-80 deg.C for 30 min; 10000rpm, centrifuging for 20min, discarding the supernatant, sequentially rinsing with 200 μ l of 70% ethanol and anhydrous ethanol once respectively, fully volatilizing the ethanol at 56 deg.C, adding 40 μ l of sterile water, oscillating to fully dissolve the precipitate, and detecting the concentration of antibody variable region gene.

The Leader primers used in S3 and S4 are described in the primer sequence Listing I below:

the J-region primers used for S3 and S4 are described in the following primer sequence Listing:

primer ID	sequence
		IGHJ_01	GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGACCAGGGTGCCCTGGCCCCAGT
IGHJ_02	GATGGGCCCTTGGTGGAGGGTGAGGAGACAGTGACCAGGGTGCCACGGCCCCAGA
		IGHJ_03	GATGGGCCCTTGGTGGAGGGTGAAGAGACGGTGACCATTGTCCCTTGGCCCCAGA
IGHJ_04	GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGACCGTGGTCCCTTGCCCCCAGA
		IGKJ_01	GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCC
IGKJ_02	GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCC
		IGKJ_03	GATGGTGCAGCCACAGTTCGTTTGATATCCACTTTGGTCCCAGGGCCGAAAGTGA
IGKJ_04	GATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGTGA
		IGKJ_05	GATGGTGCAGCCACAGTTCGTTTAATCTCCAGTCGTGTCCCTTGGCCGAAGGTGA
IGLJ_01	GGGGCAGCCTTGGGCTGACCTAGGACGGTGACCTTGGTCCCAGTTCCGAAGACAT
		IGLJ_02	GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCA
IGLJ_03	GGGGCAGCCTTGGGCTGACCTAAAATGATCAGCTGGGTTCCTCCACCAAATACAA
		IGLJ_04	GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTCGGTCCCCTCACCAAACACCC
IGLJ_05	GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTCCGTCCCCTCACCAAACACCC
		IGLJ_06	GGGGCAGCCTTGGGCTGACCGAGGACGGTCACCTTGGTGCCACTGCCGAACACAT
IGLJ_07	GGGGCAGCCTTGGGCTGACCGAGGACGGTCAGCTGGGTGCCTCCTCCGAACACAG
		IGLJ_08	GGGGCAGCCTTGGGCTGACCGAGGGCGGTCAGCTGGGTGCCTCCTCCGAACACAG

s5, the variable region gene expression cassette of the antibody obtained in S4 is transduced into 293T cells to express the antibody within 48 hours, the supernatant is collected, the RBD specificity of the supernatant is detected by an ELISA method, and RBD specific fully human monoclonal antibodies are screened (the screened RBD specific fully human monoclonal antibodies are shown in figures 5-13).

(A) Antigen was diluted with PBS (final concentration 2. mu.g/mL), 10. mu.l/well, and coated onto 384-well ELISA plates overnight at 4 ℃ or 2h at 37 ℃ (4 ℃ overnight is preferred in this example). NOTE: after the addition, the liquid is instantly centrifuged to ensure that the liquid is at the bottom.

The experimental system is shown in table 8 below:

name of reagent	Goods number	Original concentration	Final concentration	Dilution ratio
					SARS-COV-2RBD	Cat:40592-V08H	200μg/mL	2μg/mL	1:100
Goat pab to Hu IgG－ALP	Cat:ab97221	1mg/mL	2μg/mL	1:500

(B) Formulation of PBST (0.05% Tween 20, Cat # TB 220): 1L of PBS was added with 0.5mL of Tween 20;

PBST machine washed plates (Thermoscientific wellwash versa) or hand washed (plates that were machine washed were still manually photographed/centrifuged using a microplate centrifuge (MPC-P25) for 1min to make the plates invisible to water and air bubbles).

And (3) sealing: mu.l of 5% BSA (BioFroxx, Cat. NO:4240GR100) (formulated in PBST) were added to the washed plates and incubated for 1h at 37 ℃ in an incubator. PBST machine washing board or hand washing.

(C) Sample adding and standard substance. Wherein, the standard substance: 10 μ l/well stock concentration 1 μ g/mL, gradient dilutions 250ng/mL, 125ng/mL, 62.5ng/mL, 31.25ng/mL, 15.63ng/mL, 7.81ng/mL, 3.9ng/mL, and 1.95 ng/mL. (blocking solution dilution); sample preparation: cell supernatants transfected with antibody genes. Negative control/blank wells: blocking solution 10. mu.l/well.

Incubate at 37 ℃ for 30 min. PBST machine washing board or hand washing.

(D) Secondary antibody was added at a concentration of 10. mu.l/well, followed by incubation at 37 ℃ for 30min, and the experimental systems are shown in Table 9 below.

Name of secondary antibody	Goods number	Original concentration	Final concentration	Dilution ratio
					goat-anti-human IgG-ALP	A18808	1.5mg/ml	0.3μg/ml	1:5000
Goat pab to Hu IgG-ALP	Ab98532	0.5mg/ml	0.25μg/ml	1:2000

PBST machine washing board or hand washing. Mu.l/well of PNPP (disodium p-nitrophenylphosphate) and OD (450mm) values were measured using (Thermoscientific Muttiskan GO) for 5min, 10min, 15min, 20min, 25min, 30min, 35min, 40min, 45min, 50min, 55min and 60 min. 50mg PNPP powder (Thermo, Prod #34045) +40mL ddH₂O +10mL of Diethylhanol amine substrate Buffer (5X), and PNPP was stored at 4 ℃ protected from light. As shown in FIGS. 5 to 13, the results were positive when the OD was greater than 0.1.

The embodiment also comprises S6, and the neutralizing capacity of the RBD specificity supernatant detection antibody obtained from S5 for blocking pseudovirus infection of Vero6 cells or 293T cells (293T cells are preferred in the embodiment) expressed by ACE 2; the ELISA method is used for detecting the capacity of the antibody for blocking the combination of ACE2 and RBD, and the specific experimental steps are as follows:

(a) first day 293T cells were plated: plating was performed with 6-well plates 293T, 1x10^6 cells per well, 2mL of medium. After 24h of culture, the cell density reaches 70-80%.

(b) The following day transfection was performed with X-fect transfection reagent: before use, X-fet polymers and buffers were returned to room temperature, the polymers were protected from light, and the polymers were vortexed for 10 sec. Xfect^TMThe purchase information of the transformation Reagent is: catalog No.631317, TaKaRa, Japan. The reaction system is shown in table 10 below:

when mix is prepared, firstly adding DNA into a buffer, carrying out vortex oscillation for 5sec, then adding a polymer, oscillating for 10sec, standing at room temperature in a dark place for 10min, and carrying out instant separation for no more than 30 min. The cultured 293T cells were removed and 1mL of the medium was discarded. Mu.l of mix was dropped to the remaining medium. Shake the plate front and back and left and right. After 4h incubation, 2mL of fresh medium was replaced and incubation continued for up to 48 h.

(c) Day three neutralization experiments were plated with 293T-ACE2 cells: using 96-well plates, 2X10^ 4/well were inoculated, 100. mu.l of medium per well.

(d) The fourth day, toxin collecting and neutralization experiments.

Firstly, toxin collection: the supernatant was collected in a 15mL tube, carefully removed from contact with the bottom and from aspiration of the cells, and centrifuged at 300 Xg for 7min to slowly descend. The collected supernatant was filtered through a 0.45 μm filter, and the supernatant was dispensed and stored at-80 ℃ until use.

② neutralization experiment: the RBD-specific fully human monoclonal antibody (hereinafter referred to as antibody) obtained in S5 was incubated with the virus: mu.l of the antibody solution diluted in a gradient manner per well was mixed with 50. mu.l of a virus stock solution (supernatant prepared in (r)), incubated at 37 ℃ for 1 hour, then 5. mu.g/mL of polybrene (hexadimethrine bromide) was added to the mixture of the antibody and the virus, the stock culture solution of 293T-ACE2 was removed, the mixture of the antibody and the virus was added, 3 multiple wells were provided for each set, and luciferase activity was detected after 3 days.

(e) And detecting the luciferase activity at the seventh day.

Taking out Promega Bright-Glo prepared in advance and stored in refrigerator at-80 deg.C^TMThe reagent (2) was incubated at room temperature, and 293T-ACE2 cells cultured 0.5h before detection were incubated at room temperature. Promega Bright-Glo^TMThe purchase information of (2) is: catalog No. E2610, Promega, Madison, Wis., USA.

Resuspend the cells with a rifle, then add 100. mu.l Bright-Glo per well^TMAnd (3) uniformly mixing the reagents, and detecting by using a thermolfisher LUX reader after 2 min.

The neutralizing capacity of antibodies to block RBD binding to ACE2 was tested by ELISA:

(1) the first day antigen was diluted with PBS (final concentration 2. mu.g/mL), 10. mu.l/well, coated onto 384-well ELISA plates overnight at 4 ℃ or 2h at 37 ℃ (4 ℃ overnight preferred). The experimental system is the same as in table 8. NOTE: and (5) instantly centrifuging after the sample is added.

(2) PBST (phosphate tween buffer) was prepared the following day: 0.5mL of Tween 20 was added to 1L of PBS, and the purchase information for 0.05% Tween 20 was: cat # TB 220; PBST machine-washed plates (Thermoscientific wellwash versa) or hand-washed, the machine-washed plates were still manually photographed/centrifuged for 1min using a microplate centrifuge (MPC-P25) to make the plates invisible to water and air bubbles.

And (3) sealing: mu.l of 5% BSA (BioFroxx, Cat. NO:4240GR100) (prepared in PBST) was added to each well and incubated at 37 ℃ for 1 h. PBST machine washing board or hand washing.

(3) Sample adding and standard substance.

And (3) standard substance: 10 μ l/well stock concentration 1 μ g/mL, gradient dilutions 250ng/mL, 125ng/mL, 62.5ng/mL, 31.25ng/mL, 15.63ng/mL, 7.81ng/mL, 3.9ng/mL, 1.95 ng/mL.

Sample preparation: cell supernatant antibodies from multiple samples.

Negative control/blank wells: blocking solution 10. mu.l/well.

(4) The reaction plate to which the cell supernatant was added was incubated at 37 ℃ for 30 min.

(5) PBST machine washing board or hand washing.

(6) Add secondary antibody, 10. mu.l/well. (blocking solution dilution) the experimental system is the same as in Table 9.

(7) The secondary antibody was incubated at 37 ℃ for 30 min.

(8) PBST machine washing board or hand washing.

(9)10 μ l/well PNPP, OD value was measured using (thermal Muttiskan GO) for 5min, 10min, 15min, 20min, 25min, 30min, 35min, 40min, 45min, 50min, 55min, 60 min.

50mg PNPP powder (Thermo, Prod #34045) +40mL ddH₂O +10mL Diethanolaminesubstrate Buffer (5X), and PNPP was stored at 4 ℃ protected from light.

The neutralizing antibodies were further screened on the basis of the RBD-specific monoclonal antibodies shown in fig. 5 to fig. 13 (abscissa of the number of monoclonal antibodies), and the experimental results are shown in fig. 14 and fig. 15, and the higher the OD value shows that the antibody supernatant sample has high blocking ability and high neutralizing ability (generally, 85% or more of the blocking ability is considered to be a monoclonal antibody having high neutralizing potential).

The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.

Claims

1. The method for rapidly screening the fully human neutralizing monoclonal antibody with the new coronavirus RBD specificity is characterized by comprising the following steps of:

s4, constructing an antibody variable region gene expression cassette;

2. The method for rapidly screening the neutralizing monoclonal antibody against the RBD specificity of the neocoronavirus according to claim 1, wherein S2 is performed by removing the Dead cells of PBMC obtained from S1 by Dead cell removal Dye (Dead Dye), and then screening the memory B cells specific to RBD by using the staining markers of the memory B cells with the specificity and high binding capacity of the viable RBD in PBMC by using CD19, mIgG, mIgD and S-RBD; s3, obtaining the antibody variable region cDNA by RT-PCR amplification.

3. The method for rapidly screening the neutralizing monoclonal antibody against the RBD specificity of the novel coronavirus according to claim 1 or 2, wherein the variable region gene expression cassette of the antibody obtained in S4 is transduced into mammalian cells to express the antibody for 48 hours and the supernatant is collected at S5, the RBD is coated using a 384-well plate, and the supernatant is assayed to screen the monoclonal antibody specific to the RBD.

4. The method for rapidly screening the fully human neutralizing monoclonal antibody with the RBD specificity of the novel coronavirus according to claim 1 or 2, wherein the variable region cDNA of the antibody obtained from S1-S3 is amplified by nested PCR in S4, and then an antibody variable region gene expression cassette is constructed.