CN111893180A - Application of LEF1 in enhancing sensitivity of colorectal cancer to oxaliplatin - Google Patents

Abstract

The invention provides a drug resistance gene, and the sequence of LEF1 is GAGAAGCAGTGGGGAGGCGCAGCCGCTCACCTGCGGGGCAGGGCGCGGAGGAGGGACCCGGGCTGCGCGC. The invention firstly detects that the LEF1 gene has a new loop structure in a drug-resistant cell HCT116OxR through a DLO Hi-C technology, and detects that the expression of the LEF1 gene is higher in the HCT116 OxR. Reduction of expression of LEF1 in HCT116OxR to assess IC of LEF1 against drug-resistant cells₅₀Influence of value, the use of LEF1 as a target gene for reducing colorectal cancer resistance was proposed.

Description

Application of LEF1 in enhancing sensitivity of colorectal cancer to oxaliplatin

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for enhancing sensitivity of colorectal cancer to oxaliplatin by using LEF1 (Lymphoid enhancer-binding factor 1) as a target point and application of the method.

Background

Colorectal cancer is one of the most common malignant tumors in the world, and the morbidity and mortality of the colorectal cancer are in the front. Clinically, most patients are diagnosed only for tumor complications such as intestinal obstruction, bleeding and the like, so that most patients are diagnosed at the stage of tumor 3-4. Surgical resection may be the only option for curing patients with colorectal cancer, but is limited by the staging of the tumor and the failure rate is still high. Chemotherapy is the most important treatment for patients who have advanced relapses and who have developed metastases.

Oxaliplatin is a cisplatin analogue with a tetravalent platinum molecule, called platinum coordination complex. Oxaliplatin acts as an alkylation, causing cross-linking within and between DNA strands, thereby inhibiting synthesis of DNA, RNA and proteins and activating apoptosis. Oxaliplatin plays an important role in treating ineffective metastatic colorectal cancer by cisplatin and carboplatin, and not only can improve objective response rate and metastatic resection rate, but also can obviously improve overall survival rate. Thus, oxaliplatin is widely used as a standard first-line chemotherapeutic drug for colorectal cancer. Unfortunately, acquired resistance to oxaliplatin-based monotherapy or combination therapy is a major cause of treatment failure, and the development of chemoresistance limits its effectiveness in clinical treatment. Therefore, elucidating the cause of drug resistance and finding targets associated therewith is the key to the effective treatment of colorectal cancer with oxaliplatin.

LEF1 is a member of the T-cell factor family, is a downstream mediator of the Wnt/β -catenin signaling pathway, but can also independently regulate gene transcription. LEF1 is essential in stem cell maintenance and organ development, and functions in EMT, particularly by activating transcription of EMT effector molecules (including N-cadherin, Vimentin and Snail). In addition, multiple studies indicate that aberrant LEF1 activity leads to cancer progression, and knockdown and inhibition against LEF1 has been shown to be effective in alleviating the growth and metastasis of colorectal, glioblastoma multiforme and prostate cancers.

In view of the important role of LEF1 in tumor progression and the fact that LEF1 has not been reported in tumor cell resistance, we knocked down expression of LEF1 in drug-resistant cells HCT116OxR by detecting IC₅₀Verification of Low Table of LEF1The sensitivity of drug-resistant cells to oxaliplatin is obviously improved, and the transfer capacity of the drug-resistant cells is reduced.

Disclosure of Invention

The invention provides application of improving the sensitivity of colorectal cancer to oxaliplatin by taking LEF1 as a target aiming at the phenomenon that the colorectal cancer is insensitive to the oxaliplatin clinically.

In order to achieve the purpose, the invention is realized by adopting the following technical scheme:

a tumor treatment reagent, which can detect the expression of LEF1 in a sample, LEF1 sequence GAGAAGCAGTGGGGAGGCGCAGCCGCTCACCTGCGGGGCAGGGCGCGGAGGAGGGACCCGGGCTGCGCGC.

Preferably, the tumor is colorectal cancer.

Preferably, the tumor treatment agent is used for detecting the expression of LEF1 in the sample by using a high throughput sequencing method and/or a quantitative PCR method.

Preferably, the high throughput sequencing method refers to DLO Hi-C sequencing and the second generation sequencing technology introduced by the company illumina.

Preferably, the method for quantitative PCR comprises primers that specifically amplify LEF 1. The primer sequence is as follows: forward 5'-AACACCCCGATGACGGAAAG-3' and reverse 5'-TGCACCACGGGCACTTTATT-3'.

Preferably, the method for reducing expression of LEF1 comprises an RNA interference (RNAi) technique. The RNA sequence is: 5'-CCGUGAAGAGCAGGCUAAA-3' are provided.

Preferably, the sample is colorectal cancer cell HCT116 and colorectal cancer anti-oxaliplatin cell line HCT116OxR cell line (purchased from the cell resource center of the institute of basic medicine of Chinese medical sciences).

The application of the gene in preparing colorectal cancer preparations.

(1) DLO Hi-C technology

Mammalian genomes fold at multiple scales, each highlighting important interactions between structure and function. The development of Hi-C technology has enabled the capture of deeper three-dimensional chromatin conformations throughout the genome. The peak regions were identified using the hicccups algorithm in the Juicer software. The loop structure of both sets of cells was determined by hicccups using default parameters to determine all locally enriched peak at 5 kb, 10 kb and 25 kb resolution. Most of chromatin loops are promoter-enhancer loops, and although the linear distance between an enhancer and a target gene is far, the enhancer and a target gene promoter are positioned on one loop and are close in space, so that the regulation mechanism of the enhancer on the target gene is explained.

(2)RNA-seq

Most known mrnas are found and identified by cDNA clone sequencing. The method requires the construction of a cDNA library of mRNA, followed by PCR amplification, and subsequent cloning of the amplified product into an expression vector for sequencing. High-throughput sequencing, also known as next-generation sequencing technology, is a revolutionary change to conventional sequencing, and performs sequence determination on hundreds of thousands to millions of DNA molecules at a time, thereby greatly improving the sequencing efficiency. High throughput sequencing at the same time makes it possible to perform a detailed global analysis of the transcriptome and genome of a species and is therefore also referred to as deep sequencing.

(3) Real-time fluorescent quantitative PCR technology (Real-time PCR, RT-PCR)

The fluorescence detection PCR instrument can draw a dynamic change curve for the accumulation rate of the amplified sequence in the whole PCR process. The greater the initial concentration of target sequence in the reaction mixture, the fewer PCR cycles (typically expressed in terms of a particular threshold cycle number Ct) are required to obtain a particular yield of amplified product. RT-PCR has many advantages such as the specificity is high, the sensitivity is good, fast simple.

Compared with the prior art, the invention has the advantages and positive effects that:

in the invention, a new loop structure of the LEF1 gene in a drug-resistant cell HCT116OxR cell is screened by a DLO Hi-C technology (figure 1). The increased expression of LEF1 in HCT116OxR cells was detected by RNA-seq and verified by RT-PCR (FIG. 2). The expression of LEF1 was reduced in HCT116OxR cells by RNAi technology (figure 3), and the effect of LEF1 on drug resistance of HCT116OxR was assessed (figure 4), suggesting the use of LEF1 for drug-resistant treatment of colorectal cancer.

Drawings

FIG. 1 shows the loop structure of the LEF1 gene in HCT116 and HCT116OxR cells. FIG. 2 shows the expression of LEF1 in HCT116 and HCT116 OxR. FIG. 3 is a graph of LEF1 expression in HCT116OxR and si-HCT116OxR cells. FIG. 4 is IC of HCT116OxR and si-HCT116OxR cells on oxaliplatin₅₀The value is obtained.

Detailed Description

In order that the above objects, features and advantages of the present invention may be more clearly understood, the present invention will be further described with reference to specific embodiments. It should be noted that the embodiments and features of the embodiments of the present application may be combined with each other without conflict.

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced in other ways than those specifically described herein, and thus the present invention is not limited to the specific embodiments of the present disclosure.

The concrete operation steps

Identification of Loop Structure

Collecting 1X 10⁹Cross-linking and fixing HCT116 and HCT116OxR cells, cracking the cells, taking a proper amount of nuclear suspension, carrying out restriction enzyme digestion on the cells by using restriction enzymes, extracting DNA by using a phenol chloroform method, and identifying the concentration of the DNA by using agarose gel. And carrying out restriction enzyme digestion on the cyclized DNA by using restriction enzyme, and then carrying out gel cutting recovery, amplification and purification. After the library is constructed, detecting the insert size of the library by using Agilent 2100, and after the insert size meets the preset condition, accurately quantifying the effective concentration of the library by using a PCR method (the effective concentration of the library)>2 nM) to ensure library quality. Raw data peak areas were identified in the Juicer software using the HiCCUPS algorithm. The loop structure of both sets of cells was determined by hicccups using default parameters to determine all locally enriched peak at 5 kb, 10 kb and 25 kb resolution.

(di) RNA-seq

Total RNA sample detection: total RNA amount and fragment distribution were determined on an Agilent 2100 pic 600.

Library construction: after the sample is qualified, the mRNA of the eukaryote is enriched by binding the pIyA tail of the mRNA through the complementary pair of A-T by using magnetic beads with oligo (dT). Fragmentation buffer was then added to break the mRNA into short fragments, single-stranded cDNA was synthesized using six-base random primers (random hexamers) using the mRNA as a template, and double-stranded cDNA was then synthesized by adding buffer, dNTPs and DNA polymerase I, followed by purification of the double-stranded cDNA using AMPureXP beads. And (3) carrying out end repair on the purified double-stranded cDNA, adding A tail and connecting a sequencing adaptor, then carrying out fragment size selection by using AMPure XP beads, and finally carrying out PCR enrichment to obtain a final cDNA library.

And (4) library inspection: and (3) quantifying the cDNA by using the qubit2.0, diluting to 1ng/ul, detecting the insert size of the library by using Agilent 2100, and quantifying the effective concentration of the library by using a PCR method (the effective concentration of the library is more than 2 nM) after the detection result accords with the prediction result, thereby ensuring the quality of the library.

And (3) machine sequencing: HiSeq sequencing was performed on the different libraries after posing as required for effective concentrations and target off-machine data volumes.

(III) Total RNA sample preparation in HCT116 and HCT116OxR cells

Extracting total RNA in cells according to the instructions of the Feijie total RNA rapid extraction kit.

Taking HCT116 and HCT116OxR cells in good growth states, digesting and dropping, centrifuging and collecting, leaving cell masses and 100 mu l of supernatant, and fully shaking until no cell masses exist; adding 500 mul of RA2 solution into the treated sample tube, fully reversing and uniformly mixing for 5-10 times, and standing for 1min at room temperature; sucking the lysate into the inner casing, and centrifuging at 12000rpm for 1 min; taking out the inner sleeve, sucking and removing the liquid in the outer sleeve, then putting the inner sleeve back, adding 500 mu l of Wash buffer, and centrifuging at 12000rpm for 1 min; washing again; taking out the inner sleeve, and centrifuging again without adding washing liquid after absorbing and discarding the liquid in the outer sleeve; the inner cannula was transferred to a new 1.5ml EP tube and 50. mu.l of eluent was added to the center of the membrane; after standing at room temperature for 1min, the mixture was centrifuged at 12000rpm for 1min to obtain total RNA.

(IV) RT-PCR detection of expression of LEF1 in HCT116 and HCT116OxR cells

Reverse transcription was performed according to the PrimeScript TM RT reagent Kit instructions, reverse transcription reaction 15min at 37 ℃ and inactivation reaction 5sec at 85 ℃. The reaction system was set as follows:

5×PrimeScriptTM Buffer (for real time) 2µl

PrimeScriptTM RT Enzyme Mix Ⅰ 0.5µl

Oligo dT Primer(50µM) 0.5µl

Random 6 mers(100µM) 0.5µl

Total RNA 500ng

RNase Free ddH2O added to 10 μ l

RT-PCR was then performed using the synthesized cDNA as template according to the TB Green TM Premix Ex Taq TM II kit instructions. The reaction conditions were 40 cycles of 42 ℃ for 5min,95 ℃ for 30s of pre-denaturation, 95 ℃ for 5s, 60 ℃ for 30 s. The reaction system is as follows:

TB Green 5µl

ROX ReferenceDye Ⅱ 0.2µl

PCR Forward Primer (10µM) 0.2µl

PCR Reverse Primer (10µM) 0.2µl

ddH2O 3.4µl

template cDNA 1 mu l

The total volume is 10 mu l

In the PCR experiments, the replicates and negative control experiments (no cDNA template added in the negative control experiments) were performed, and each sample was repeated 3 times in the quantification experiments. Relative expression level of LEF1 with GAPDH as internal reference 2^-ΔΔCtAnd (4) calculating.

(V) RNAi technique

Will be 5X 10⁵The individual cells were seeded in 6-well plates to reach 70% confluence the next day; adding 5 μ l Lipofectamine 2000 into 250 μ l Opti-MEM, and standing at room temperature for 5 min; at 250. mu.l Opti-MEM was supplemented with 5. mu.l siRNA; mixing the diluted Lipofectamine 2000 and siRNA gently, and standing for 20min at room temperature; adding the mixed solution into the well plate paved the previous day, incubating for 4-6h, removing the mixed solution, and replacing with a normal culture medium containing serum. Total RNA was extracted after 48h and expression of LEF1 was detected using RT-PCR.

(VI) IC₅₀Measurement of (2)

Taking HCT116 and HCT116OxR cells with good growth state, digesting, counting, and dividing by 5X 10 per well³The individual cells were seeded in 96-well plates, and the medium was added to 100. mu.l per well, and cultured in an incubator for 48 hours. Oxaliplatin (purchased from zilu pharmaceuticals) was added to each well in order at final concentrations of 0, 5, 10, 15, 20, 25, 30 μ M and the culture was continued for 48 h. Mu.l of CCK-8 was added to each well in the dark and incubated for 2h in an incubator. The light absorption of each well was measured using a microplate reader at a wavelength of 450 nm. Growth curves for each group were plotted using GraphPadPrism software.

Secondly, analyzing the results

The LEF1 gene is screened by DLO Hi-C technology to form a new loop structure in the drug-resistant cell HCT116OxR, as shown in figure 1. As can be seen from FIG. 1, the LEF1 gene formed a new loop structure in HCT116OxR cells (indicated by the arrow).

The expression of the LEF1 gene was detected to be elevated in HCT116OxR cells by RNA-seq and verified by RT-PCR, see FIG. 2. As can be seen from fig. 2, LEF1 was expressed in higher amounts in HCT116OxR cells.

Expression of LEF1 was reduced in HCT116OxR cells by RNAi technology and verified by RT-PCR, see figure 3. As can be seen in FIG. 3, the expression of LEF1 decreased after transfection of the small interfering RNA of LEF 1.

IC of HCT116OxR cells on oxaliplatin following decreased expression of LEF1₅₀The value was 15. mu.M, see FIG. 4. As can be seen in FIG. 4, after transfection of the small interfering RNA of LEF1, the IC of the drug-resistant cells₅₀The temperature dropped to 15. mu.M.

The above description is only a preferred embodiment of the present invention, and not intended to limit the present invention in other forms, and any person skilled in the art may apply the above modifications or changes to the equivalent embodiments with equivalent changes, without departing from the technical spirit of the present invention, and any simple modification, equivalent change and change made to the above embodiments according to the technical spirit of the present invention still belong to the protection scope of the technical spirit of the present invention.

SEQUENCE LISTING

<110> secondary Hospital of Shandong university

<120> use of LEF1 for enhancing sensitivity of colorectal cancer to oxaliplatin

<130>1

<160>3

<170>PatentIn version 3.5

<210>1

<211>70

<212>DNA

<213> Artificial sequence

<400>1

gagaagcagt ggggaggcgc agccgctcac ctgcggggca gggcgcggag gagggacccg 60

ggctgcgcgc 70

<210>2

<211>40

<212>DNA

<213> Artificial sequence

<400>2

aacaccccga tgacggaaag tgcaccacgg gcactttatt 40

<210>3

<211>19

<212>RNA

<213> Artificial sequence

<400>3

ccgugaagag caggcuaaa 19

Claims (9)

1. An oxaliplatin drug resistance related target gene for treating tumors is characterized in that the nucleotide sequence of the target gene is shown as SEQ ID NO. 1.

2. Target gene according to claim 1, characterized in that said tumor is colorectal cancer.

3. The target gene of claim 1, wherein the expression of lymphoid-enhancing factor 1 in a cell is detected by high throughput sequencing and/or quantitative PCR.

4. The target gene of claim 3, wherein the high throughput sequencing method is a second generation sequencing technique.

5. A target gene according to claim 3, wherein the method for quantitative PCR comprises primers for specific amplification of lymphoid enhancer 1.

6. A target gene according to claim 3, wherein the primer sequence is 5'-AACACCCCGATGACGGAAAG-3' in forward direction and 5'-TGCACCACGGGCACTTTATT-3' in reverse direction.

7. Application of RNAi for reducing expression of specific amplification lymphoid enhancement factor 1 in preparation of drugs for treating colorectal cancer.

8. The use of claim 7, wherein the RNAi sequence is 5'-CCGUGAAGAGCAGGCUAAA-3'.

9. The application of the specific amplification lymphoid enhancement factor 1 as a target gene in improving the sensitivity of colorectal cancer to oxaliplatin.

Images