CN111893176A - MiRNA (micro ribonucleic acid) diagnosis marker for predicting bovine mastitis milk-derived exosomes - Google Patents
MiRNA (micro ribonucleic acid) diagnosis marker for predicting bovine mastitis milk-derived exosomes Download PDFInfo
- Publication number
- CN111893176A CN111893176A CN202010814817.8A CN202010814817A CN111893176A CN 111893176 A CN111893176 A CN 111893176A CN 202010814817 A CN202010814817 A CN 202010814817A CN 111893176 A CN111893176 A CN 111893176A
- Authority
- CN
- China
- Prior art keywords
- mir
- milk
- derived exosomes
- primer
- exosomes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a milk-derived exosome miRNA diagnosis marker for predicting bovine mastitis, which takes milk-derived exosomes miR-223 and miR-200b as diagnosis markers of bovine mastitis; successfully separating and identifying milk source exosomes of Holstein cows; the level of miR-223 in the mammitis individual exosomes of the Holstein cow is obviously increased compared with that of a control group (P is less than 0.001); the level of miR-200b is obviously reduced compared with that of a control group (P < 0.001). Because most protein components are removed in the extraction process of the exosome, the exosome miRNA can more accurately reflect whether the dairy cow individual suffers from mastitis compared with the milk miRNA.
Description
Technical Field
The invention relates to a diagnostic marker for predicting holstein cow mastitis, and further provides an early diagnosis of holstein cow mastitis by taking a milk-derived exosome miR-223/miR-200b as a diagnostic marker, belonging to the technical field of cow disease biological diagnosis.
Background
Cow mastitis is one of three recognized diseases of cows in the world, and causes the cows to temporarily or permanently reduce milk yield and milk quality, prolong the postpartum oestrus cycle, lose reproductive performance and the like. For a long time, the economic loss of dairy cow mastitis to the dairy cow breeding industry is the first of various diseases, and the disease is high-cost disease in the dairy industry.
About one third of 2.2 million cows in the world stock are reported to have mastitis and stealth mastitis, with high incidence rates and some differences in the incidence of mastitis in cows in different countries and regions. Mastitis is an inflammation of the breast tissue, which can be caused by various infectious agents, usually as a result of microbial infections caused by pathogens such as staphylococcus aureus, streptococcus uberis and escherichia coli, and is a chronic or acute disease characterized clinically by local changes in the breast and abnormal milk secretion, characterized by an elevated number of somatic cells, usually accompanied by physical, chemical or microbial changes in milk.
With the evolution of organisms, both prokaryotes and eukaryotes have evolved compact and efficient intercellular communication strategies. Classical cell biology believes that there are two ways in which cell-cell communication can occur, either through direct contact interaction or through indirect interaction by secretion of soluble factors such as hormones, growth factors, cytokines, etc. Research in recent years shows that exosome as the third newly found important intercellular communication carrier can mediate the transport of protein, lipid, nucleic acid and other biological macromolecules between cells, and widely influences the physiological and pathological processes of organisms. The exosome is a vesicle structure formed by wrapping protein, lipid and nucleic acid by a phospholipid bilayer membrane and secreted by different types of cells, can transport the protein, the lipid and the nucleic acid among cells, and is a powerful carrier for mediating the communication among the cells. mirnas are present in a variety of body fluids and are selectively packaged in exosomes, a membrane vesicle secreted by most cell types. These exosome mirnas may be actively delivered into recipient cells, and may modulate target gene expression and recipient cell function. Exosomes are naturally present in various body fluids, such as blood, urine, saliva, cerebrospinal fluid and milk, and provide a basis for it to regulate the physiological and pathological processes of the body extensively.
Disclosure of Invention
The invention discloses a diagnostic marker for indicating the mastitis of a Holstein cow, which takes milk-derived exosomes miR-223 and miR-200b as diagnostic markers to carry out early diagnosis on the mastitis of the Holstein cow and solves the defect of detecting the mastitis of the Holstein cow in the prior art.
The invention discloses a diagnostic marker for predicting holstein cow mastitis, which is characterized in that the diagnostic marker is as follows: milk-derived exosomes miR-223 and miR-200 b; wherein the content of the first and second substances,
the miR-223 diagnostic marker sequence is shown in SEQ No. 1;
the miR-200b diagnostic marker sequence is shown in SEQ No. 2.
The invention relates to an early diagnosis method for predicting holstein cow mastitis by taking milk-derived exosomes miR-223 and miR-200b as diagnosis markers, which comprises the following steps:
1. and (3) performing gradient low-speed centrifugation on the milk sample:
300 Xg/min, 10 min; 3000 Xg/min, 20 min; centrifuging at 10000 Xg/min for 30 min to collect supernatant;
then, carrying out gradient ultracentrifugation for 30000 Xg/min and 60 min; 50000 Xg/min, 90 min; 70000 Xg/min, 90 min; 95000 Xg/min 60 min; 120000 Xg/min, 90 min; 120000 Xg/min, 90 min;
wherein, after 50000 Xg/min of milk sample is centrifuged, two thirds of supernatant is taken and filtered by a filter membrane with the thickness of 3 μm, then the centrifugation is carried out by 70000 Xg/min, two thirds of supernatant is taken and filtered by filter membranes with the thickness of 1 μm and 0.45 μm, finally, after the centrifugation is carried out by 95000 Xg/min, two thirds of supernatant is taken and filtered by a filter membrane with the thickness of 0.22 μm, then the ultracentrifugation is carried out by 120000 Xg, and milk-derived Exosomes are collected.
2. Two pairs of primer sequences designed according to the miR-223 and miR-200b genes and promoter sequences of the cattle are as follows:
miR-223：
F-primer TGCGGTGTCAGTGTCAAAT，
R-primer CAGTGCAGGGTCCGAGGT；
miR-200b：
F-primer TGCGGTAATACTGCCTGGTA，
R-primer CAGTGCAGGGTCCGAGGT。
3. extracting total RNA of exosome from milk-derived Exosomes of the lactating dairy cow separated in the step 1) by using a TRIzol method, and carrying out RT-qPCR (reverse transcription-quantitative polymerase chain reaction) on the total RNA of the milk-derived Exosomes into cDNA by using a reverse transcription kit to detect the abundance levels of miR-223 and miR-200b in the lactating dairy cow sample;
the reaction system comprises 0.5 mu L of miR-223 and miR-200b upstream primers respectively designed in the step 2), 0.5 mu L of downstream primers respectively, 1 mu L of cDNA and ddH2O3. mu.L, Mix 5. mu.L, 10. mu.L total, each replicate 3 times;
the reaction conditions are as follows: 2min at 50 ℃; 10min at 95 ℃; 95 ℃ 10s, 60 ℃ 30s (45 cycles); 15s at 95 ℃; 15s at 55 ℃; 95 ℃ for 15 s.
The invention analyzes the expression of miR-223 and miR-200b with milk specificity in milk-derived exosomes of Holstein cows and discusses the possibility of the miR-223 and miR-200b as a cow mastitis marker.
And (3) separating and extracting milk-derived exosomes by adopting an optimized ultracentrifugation method, and analyzing the expression and difference of miR-223 and miR-200b with milk specificity in the milk-derived exosomes of individuals suffering from mastitis and healthy individuals by adopting a real-time fluorescent quantitative polymerase chain reaction (qRT-PCR) technology. The specificity and the sensitivity of the miR-223 and miR-200b are obviously higher than those of the existing mastitis detection technology.
The invention has the positive effects that:
discloses milk-derived exosomes miR-223 and miR-200b as diagnostic markers of Holstein cow mastitis; successfully separating and identifying milk source exosomes of Holstein cows; the level of miR-223 in the mammitis individual exosomes of the Holstein cow is obviously increased compared with that of a control group (P is less than 0.001); the level of miR-200b is obviously reduced compared with that of a control group (P < 0.001). Because most protein components are removed in the extraction process of the exosome, the exosome miRNA can more accurately reflect whether the dairy cow individual suffers from mastitis compared with the milk miRNA.
Drawings
FIG. 1 is a morphological structure and particle size distribution diagram under a transmission electron microscope of milk-derived exosomes and identification of a marker protein CD81/TSG 101;
FIG. 2 shows the expression levels of milk-derived exosomes miR-223/miR-200b of healthy cows and mammitis cows.
Detailed Description
For the purpose of enhancing the understanding of the present invention, the present invention will be further described in detail with reference to the following examples and the accompanying drawings, which are only used for explaining the present invention and are not to be construed as limiting the scope of the present invention.
Example 1
Firstly, milk sample collection:
1. the Chinese Holstein cow milk sample is from great northern barren cattle farm of Heilongjiang. 25 cases of the Holstein cows with mastitis in the cattle farm in 2019 and 10 months are selected as a research group, and 25 cases of the healthy Holstein cows are selected as a control group.
2. Collecting and storing milk samples: collecting milk samples by adopting a clean and sterile collection bottle, then immediately subpackaging the milk samples into 50 mL centrifuge tubes after a laboratory, gradually centrifuging for 300 Xg 10min, 3000 Xg 20 min and 10000 Xg 30 min, taking supernate, respectively removing impurities such as cells, large-particle interference, fat and the like, and then freezing and storing at-80 ℃.
Secondly, separating milk-derived exosomes:
1. thawing the pre-treated milk sample stored at-80 deg.C on ice, centrifuging the milk sample for 300 × g10 min, 3000 × g 20 min, and 10000 × g 30 min, collecting supernatant, and removing impurities such as cell, protein, fat, etc. The sample was further subjected to 30000 Xg 60 min, 50000 Xg 90min, 70000 Xg 90min, 95000 Xg 60 min, 120000 Xg 90min, wherein two thirds of the supernatant after 50000 Xg centrifugation were filtered using a 3 μm filter, two thirds of the supernatant after 70000 Xg centrifugation were filtered using a 1 μm and 0.45 μm filter, two thirds of the supernatant after 95000 Xg centrifugation were filtered using a 0.22 μm filter, and then to 120000 Xg ultracentrifugation.
2. Particle size and concentration of exosomes were analyzed: the number of particles and the particle size distribution were analyzed by Nanoparticle-packing analysis (NTA). The pellet was resuspended in 30ul of particle-free PBS and diluted 1000-fold before testing.
3. The morphology of exosomes was observed by transmission electron microscopy: the exosome heavy suspension is dripped into a 200-mesh copper mesh and is kept still for 5min, then the liquid is sucked dry by filter paper, and the exosome heavy suspension is negatively dyed for 2min after being subjected to 1% phosphotungstic acid, washed twice by PBS and observed by a transmission electron microscope. The morphology and size of the exosomes were observed by transmission electron microscopy (JEM-2100JEOL, Tokyo, Japan) (see FIG. 1).
4. Westenblot detection of exosome markers: exosome proteins were extracted using RIPA (Pierce, USA) lysates and protein concentrations were determined by BCA (Pierce, USA). Proteins were separated by 12% SDS-PAGE, and the amount of total protein was 40ug per lane. Transferring protein onto PVDF membrane by wet transfer method, sealing with 5% skimmed milk powder at room temperature for 1h, adding TSG101 and CD81 antibodies (1:1000), sealing at 4 deg.C overnight, washing with TBST for 3 times for 5min, adding HRP-labeled secondary antibody (1:10000), incubating at room temperature for 1h, washing with TBST for multiple times, preparing developer (ECL, Pierce, USA) at a ratio of 1:1, slowly dropping the developer onto PVDF membrane, spreading the whole membrane, and absorbing the residual developer to avoid too much developer causing too black background. The exposure time was 5s, 10s, 15s, 20s, 30 s.
Because the interference of casein in milk is serious, the invention is optimized on the basis of the traditional ultracentrifugation, fat layer, cells, casein and other proteins with larger molecular weight in the milk are removed by a low-speed differential centrifugation method, and finally exosomes in the milk are extracted by the ultracentrifugation method. The milk-derived exosome obtained by the method in the experiment is approximately circular, part of the milk-derived exosome is concave, the particle size is about 100nm, the milk-derived exosome expresses the marker molecules of exosomes such as TSG101 and CD81, and no obvious difference exists between a research group and a control group. Further NTA analysis shows that the particle sizes of the separated exosomes are not uniform and are mainly distributed near 100nm, which indicates that the milk-derived exosomes of Holstein cows are successfully separated.
Thirdly, determining a milk-derived exosome miR-223/miR-200 b:
exosome RNA extraction and quantitative and real-time quantitative PCR: exosome total RNA was extracted and 1mL of TRIzol was added to each 200 μ L sample. Exosome samples were transferred to 1.5mL EP tubes and left at 15-30 ℃ for 5 minutes. 0.2 mL of chloroform was added, covered, shaken vigorously by hand for 15 seconds, left at 15-30 ℃ for 2-3 minutes, and then centrifuged at 12,000 Xg for 15 minutes at 2-8 ℃. After centrifugation, the mixture was separated into three layers, the lower red being a phenol-chloroform phase and one intermediate layer, one side being a colorless aqueous phase. RNA is only present in the aqueous phase. The aqueous phase constituted 60% of the total TRIzol. The upper aqueous phase was transferred to another clean EP tube, 0.5mL isopropanol was added, and 20. mu.L of trace RNA precipitant was added, allowed to stand for 10 minutes at 15-30 ℃ and then centrifuged at 12,000 Xg for 10 minutes at 2-8 ℃. Flocculent gel-like precipitates, which are RNA precipitates, can be seen on the side walls and bottom of the tube before centrifugation. The supernatant was removed, 1mL of 75% cold ethanol was added to wash the RNA pellet, the pellet was mixed well with a shaker, centrifuged 7,500 Xg for 5 minutes at 2-8 ℃. Removing supernatant, placing in vacuum or air for 5-10 min, and drying RNA precipitate. Resuspending RNA precipitate with RNase-free water, repeatedly blowing with a gun head for several times, measuring concentration, and storing at-20 deg.C.
The extracted tissue RNA was reverse transcribed into cDNA samples using TaKaLa reverse transcription kit. The reverse transcription conditions were: (1) denaturation of RNA: 5 XgDNA Eraser Buffer 2. mu.L, gDNA Erase 1. mu.L, 1ug total RNA, the RNA samples were heat denatured in a 42 ℃ water bath for 2min and immediately cooled on ice. (2) Preparing a reaction solution: 5 × RT buffer 2 μ L; RT Enzyme mix 0.5. mu.L; prime mix 0.5. mu.L; 1 μ L of RNA, then using nucleic-free ddH2O make up to 10. mu.L and was performed on ice. (3) Reverse transcription reaction: metal bath at 37 deg.C for 15 min. (4) Enzyme inactivation: metal bath at 85 deg.C for 5 s. The resulting product was stored in a freezer at-80 ℃ until use. And carrying out real-time fluorescent quantitative PCR (polymerase chain reaction) experiments by using fluorescent dye SYBR Green for dyeing by reverse transcription to obtain cDNA serving as a template, detecting the expression quantity of miR-223 and miR-200b in two groups of milk-derived exosomes, and repeatedly detecting each sample for 3 times.
The quantitative primer sequences of miR-223 and miR-200b are respectively as follows:
F-Primer TGCGGTGTCAGTGTCAAAT，
R-Primer CAGTGCAGGGTCCGAGGT；
F-Primer TGCGGTAATACTGCCTGGTA，
R-Primer CAGTGCAGGGTCCGAGGT；
the primer sequence of the reference gene U6 is as follows:
F-Primer CTCGCTTCGGCAGCACA，
R-Primer AACGCTTCACGAATTTGCGT。
RT-qPCR was performed using cDNA obtained by reverse transcription as a template. The reaction system was 5. mu.L each for the forward primer, 5. mu.L each for the reverse primer, 1. mu.L for cDNA, 8. mu.L for Mix, 10. mu.L for total, and each sample was repeated 3 times. The reaction conditions are as follows: 2min at 50 ℃; 10min at 95 ℃; 95 ℃ 10s, 60 ℃ 30s (45 cycles); 15s at 95 ℃; 15s at 55 ℃; 95 ℃ for 15 s. The resulting data was analyzed using SPSS after the reaction was complete.
Test example 1
The expression of miR-223/miR-200b in milk-derived exosomes in a study group is as follows:
Q-PCR is adopted to detect miR-223 and miR-200b in milk-derived exosomes (as shown in figure 2), and the expression abundance of miR-223 in milk-derived exosomes of individuals suffering from mastitis in a research group is remarkably increased (P is less than 0.001), and the expression abundance of miR-200b is remarkably reduced (P is less than 0.001). Therefore, the derivatives can be used as markers for diagnosing the mastitis of the Holstein cow, and the specificity and the sensitivity of the miR-223 and miR-200b disclosed by the invention are obviously higher than those of the existing mastitis detection technology.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> Jilin university
<120> miRNA diagnostic marker for milk-derived exosomes indicative of Holstein cow mastitis
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>15
<212>DNA
<213> cattle (Bos taurus)
<400>1
gcaggcaaaa cccca 15
<210>2
<211>14
<212>DNA
<213> cattle (Bos taurus)
<400>2
aaacgccgga agag 14
<210>3
<211>19
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>3
tgcggtgtca gtgtcaaat 19
<210>4
<211>18
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>4
cagtgcaggg tccgaggt 18
<210>5
<211>20
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>5
tgcggtaata ctgcctggta 20
<210>6
<211>18
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>6
cagtgcaggg tccgaggt 18
Claims (4)
1. An extraction method of emulsion source Exosomes with the diameter of 100nm is characterized by comprising the following steps:
and (3) performing gradient low-speed centrifugation on the milk sample:
300 Xg/min, 10 min; 3000 Xg/min, 20 min; centrifuging at 10000 Xg/min for 30 min to collect supernatant;
then, carrying out gradient ultracentrifugation for 30000 Xg/min and 60 min; 50000 Xg/min, 90 min; 70000 Xg/min, 90 min; 95000 Xg/min 60 min; 120000 Xg/min, 90 min; 120000 Xg/min, 90 min;
wherein, after 50000 Xg/min of milk sample is centrifuged, two thirds of supernatant is taken and filtered by a filter membrane with the thickness of 3 μm, then the centrifugation is carried out by 70000 Xg/min, two thirds of supernatant is taken and filtered by filter membranes with the thickness of 1 μm and 0.45 μm, finally, after the centrifugation is carried out by 95000 Xg/min, two thirds of supernatant is taken and filtered by a filter membrane with the thickness of 0.22 μm, then the ultracentrifugation is carried out by 120000 Xg, and milk-derived Exosomes are collected.
2. A miRNA diagnosis marker for predicting bovine mastitis milk-derived exosomes of Holstein, which is characterized in that the diagnosis marker is as follows: milk-derived exosomes miR-223 and miR-200 b; wherein the content of the first and second substances,
the miR-223 diagnostic marker sequence is shown in SEQ No.1
（UGUCAGUUUGUCAAAUACCCCA），
The diagnostic marker sequence of miR-200b is shown in SEQ No.2
（UAAUACUGCCUGGUAAUGAUG）。
3. An early diagnosis method for predicting holstein cow mastitis by taking milk-derived exosomes miR-223 and miR-200b as diagnosis markers is characterized in that two pairs of primer sequences designed according to genes and promoter sequences of the cow miR-223 and miR-200b are as follows:
miR-223：
F-primer TGCGGTGTCAGTGTCAAAT，
R-primer CAGTGCAGGGTCCGAGGT；
miR-200b：
F-primer TGCGGTAATACTGCCTGGTA，
R-primer CAGTGCAGGGTCCGAGGT。
4. the method for early diagnosis of milk-derived exosomes miR-223 and miR-200b as diagnosis markers for predicting holstein cow mastitis in claim 3, comprising the following steps:
extracting exosome total RNA from milk-derived Exosomes of the lactating dairy cow separated by the extraction method of claim 1 by a TRIzol method, and carrying out RT-qPCR (reverse transcription-quantitative polymerase chain reaction) on the milk-derived Exosomes total RNA which is reversely transcribed into cDNA by a reverse transcription kit to detect the abundance levels of miR-223 and miR-200b among samples of the lactating dairy cow;
the reaction system comprises 0.5 muL of miR-223 and miR-200b upstream primer, 0.5 muL of downstream primer, 1 muL of cDNA and ddH related to claim 32O3. mu.L, Mix 5. mu.L, 10. mu.L in total,each sample was repeated 3 times;
the reaction conditions are as follows: 2min at 50 ℃; 10min at 95 ℃; 95 ℃ 10s, 60 ℃ 30s (45 cycles); 15s at 95 ℃; 15s at 55 ℃; 95 ℃ for 15 s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010814817.8A CN111893176B (en) | 2020-08-13 | 2020-08-13 | miRNA diagnostic marker for indicating milk cow mammitis exosomes of Holstein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010814817.8A CN111893176B (en) | 2020-08-13 | 2020-08-13 | miRNA diagnostic marker for indicating milk cow mammitis exosomes of Holstein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111893176A true CN111893176A (en) | 2020-11-06 |
| CN111893176B CN111893176B (en) | 2023-05-05 |
Family
ID=73230662
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010814817.8A Active CN111893176B (en) | 2020-08-13 | 2020-08-13 | miRNA diagnostic marker for indicating milk cow mammitis exosomes of Holstein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111893176B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113061571A (en) * | 2021-04-08 | 2021-07-02 | 江苏省农业科学院 | Method for separating and identifying Hostan cow milk exosomes |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2010504350A (en) * | 2006-09-19 | 2010-02-12 | アシュラジェン インコーポレイテッド | Genes and pathways regulated by miR-200 as targets for therapeutic intervention |
| CN103961706A (en) * | 2013-01-30 | 2014-08-06 | 中国医学科学院医药生物技术研究所 | Application of microRNA or inhibitor thereof to lipid metabolism regulation |
| CN110496138A (en) * | 2019-06-11 | 2019-11-26 | 中国农业大学 | A kind of extracting method and its application of yak milk excretion body |
-
2020
- 2020-08-13 CN CN202010814817.8A patent/CN111893176B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2010504350A (en) * | 2006-09-19 | 2010-02-12 | アシュラジェン インコーポレイテッド | Genes and pathways regulated by miR-200 as targets for therapeutic intervention |
| CN103961706A (en) * | 2013-01-30 | 2014-08-06 | 中国医学科学院医药生物技术研究所 | Application of microRNA or inhibitor thereof to lipid metabolism regulation |
| CN110496138A (en) * | 2019-06-11 | 2019-11-26 | 中国农业大学 | A kind of extracting method and its application of yak milk excretion body |
Non-Patent Citations (4)
| Title |
|---|
| LI R等: "Transcriptome MicroRNA Profiling of Bovine Mammary Glands Infected with Staphylococcus aureus", 《INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES》 * |
| MINGCHENGCAI等: "Genome-widemicroRNAprofilingofbovinemilk-derivedexosomesinfectedwithStaphylococcusaureus", 《CELLSTRESS&CHAPERONES》 * |
| 王星果等: "miR-223的表达调控及生物功能研究进展", 《生命科学》 * |
| 边艳杰等: "miR-200b对奶牛乳腺上皮细胞泌乳功能的影响", 《河南农业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113061571A (en) * | 2021-04-08 | 2021-07-02 | 江苏省农业科学院 | Method for separating and identifying Hostan cow milk exosomes |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111893176B (en) | 2023-05-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104755628B (en) | The stabilisation of biological sample | |
| EP3235910A1 (en) | Method for identifying pathogens of bacterial infectious diseases by using bacteria-derived nanovesicles | |
| JP5132557B2 (en) | Method for improving cell permeability of foreign particles | |
| CN106399250A (en) | Method and kit for separating exosome | |
| Neerukonda et al. | Comparison of exosomes purified via ultracentrifugation (UC) and Total Exosome Isolation (TEI) reagent from the serum of Marek’s disease virus (MDV)-vaccinated and tumor-bearing chickens | |
| CN107012145B (en) | Long non-coding RNA and application thereof in diagnosis/treatment of bile duct cancer | |
| US20180312905A1 (en) | Method detecting avian necrotic enteritis | |
| CN107841498B (en) | Simple and rapid DNA extraction method of whole chicken blood | |
| CN106970224B (en) | A kind of kit and its application using CD45 immunofluorescences joint CEP probe identification circulating tumor cells | |
| CN106970225B (en) | A kind of kit and its application for combining 8 probe identification circulating tumor cells of CEP using CD45 immunofluorescences | |
| US20110236895A1 (en) | Method for preparing sample, solution for preparing sample and stool collection kit method for analyzing a nucleic acid | |
| CN110804659B (en) | Application of serum exosome ssc-miR-92b-3p as molecular marker for early pregnancy diagnosis of sows | |
| CN111893176A (en) | MiRNA (micro ribonucleic acid) diagnosis marker for predicting bovine mastitis milk-derived exosomes | |
| CN109136229B (en) | Aptamer for specifically recognizing trachinotus ovatus-derived nervous necrosis virus and application thereof | |
| CN109022580B (en) | Canine circular RNA gene as diagnosis marker of canine breast tumor | |
| WO2017114007A1 (en) | Pml gene and rara gene detection probe, preparation method therefor, and test kit | |
| JPWO2002101037A1 (en) | Method for evaluating phagocytic function and use thereof | |
| CN112094809A (en) | Method for extracting exosome from serum or plasma | |
| CN110546260A (en) | Biomarkers for early embryo viability and methods thereof | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| KR102505617B1 (en) | Urinary exosome-derived miRNA gene biomarkers for diagnosis of T cell-mediated rejection in kidney allografts and use thereof | |
| CN107190010A (en) | One group of high-affinity aptamers and its application with Vibrio vulnificus specific binding | |
| CN109161548B (en) | Aptamer and application thereof in detection of trachinotus ovatus-derived nervous necrosis virus | |
| CN107400719B (en) | Tussah microsporidian detection primers and application thereof | |
| CN111349698A (en) | Excretor-in-vivo nucleic acid marker related to central nervous system infection diseases and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |