CN111893165A - Screening method of tsRNA related to myocardial ischemia reperfusion - Google Patents
Screening method of tsRNA related to myocardial ischemia reperfusion Download PDFInfo
- Publication number
- CN111893165A CN111893165A CN202010810023.4A CN202010810023A CN111893165A CN 111893165 A CN111893165 A CN 111893165A CN 202010810023 A CN202010810023 A CN 202010810023A CN 111893165 A CN111893165 A CN 111893165A
- Authority
- CN
- China
- Prior art keywords
- minutes
- myocardial ischemia
- rna
- myocardial
- reperfusion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention discloses a method for screening tsRNA related to myocardial ischemia reperfusion, which is characterized by constructing a rat myocardial ischemia reperfusion model and screening out differential expression tsRNA in the myocardial ischemia reperfusion process by adopting a sequencing method; constructing an in-vivo rat myocardial ischemia reperfusion model and an in-vitro myocardial cell hypoxia reoxygenation model, and verifying and sequencing by adopting real-time quantitative PCR; the scheme provides the application of the tsRNA in the myocardial ischemia-reperfusion injury process, provides a new idea for researching the pathophysiological process of the myocardial ischemia-reperfusion injury, and provides a new molecular basis or a treatment target for preventing and treating the myocardial ischemia-reperfusion injury.
Description
Technical Field
The invention belongs to the technical field of biomedicine, and particularly relates to a method for screening tsRNA (transport ribonucleic acid) related to myocardial ischemia reperfusion.
Background
Coronary atherosclerotic heart disease (coronary heart disease) is the most common cardiovascular disease, and acute myocardial infarction is one of the leading causes of death in humans. In recent years, early reperfusion therapy using thrombolytic agents and Percutaneous Coronary Intervention (PCI) has achieved certain effects in reducing myocardial infarction. To some extent, reperfusion therapy can salvage ischemic myocardium, but can also convert reversible ischemic injury into irreversible reperfusion injury, thereby increasing the incidence of heart failure. The mechanism of myocardial cell injury caused by ischemia reperfusion injury is multifactorial and complex and is not fully elucidated at present. Intracellular calcium ion overload, oxidative stress, apoptosis, endoplasmic reticulum stress, cell mitochondrial dysfunction, protein kinase activation, inflammation and other processes play important roles and are mutually related.
In the human genome, only 2% of the transcripts encode proteins, while others are non-coding rnas (ncrnas). It does not encode a protein per se, but can regulate gene expression at various levels including epigenetic, transcriptional and posttranscriptional levels, and is widely involved in physiological and pathological processes of the body. In cardiovascular disease, there is a large body of evidence that ncrnas play a role in cardiac development, left ventricular hypertrophy, acute myocardial infarction, and heart failure.
There is a ncRNA derived from tRNA that is cleaved by an endonuclease with a specific cellular ribonuclease, referred to as tRNA-derived small RNA (tsRNA). tsRNA is classified into two types, depending on the length of the tRNA and the cleavage site: one is tRNA derived stress-induced RNA (tirRNA) produced by specific cleavage in the anticodon loop of mature tRNA, which is 28-36nt in length; another is a tRNA derivative fragment (tRF), derived from mature tRNA, that is about 14-30nt in length.
Neither tsRNA is a byproduct of tRNA random cleavage, which can accumulate in different biological processes and play a critical role in pathophysiological processes. In some diseases (including neurodegenerative diseases, acquired metabolic diseases, infectious diseases and cancer) aberrant expression of tsRNA is found. Furthermore, studies have shown that tsRNA can be produced under stress conditions and act primarily in two ways: targeted binding to mRNA, acting like miRNA, regulates gene expression; competitively bind various proteins to affect pathophysiological processes. However, until now, there is no research on the relevance of tsRNA in ischemia-reperfusion, and its molecular interactions and underlying mechanisms remain to be elucidated.
Therefore, the research on the change and the effect of the tsRNA in the myocardial ischemia-reperfusion process is helpful for further understanding the pathophysiological process of myocardial ischemia-reperfusion injury, provides a new idea for clinically preventing and treating reversible ischemia injury, and provides a new effect target for novel drug development and application. However, it is not clear which tsRNAs are involved in the process of myocardial ischemia-reperfusion injury, and the functions performed by these tsRNAs are less well understood.
Therefore, a new idea for studying the pathophysiological process of myocardial ischemia-reperfusion injury and a new molecular basis or therapeutic target point for preventing and treating myocardial ischemia-reperfusion injury are urgently needed.
Disclosure of Invention
The invention aims to provide a screening method and verification of tsRNA related to myocardial ischemia reperfusion, and fills the blank in the field.
In order to achieve the above object, the present invention adopts a first technical solution: a method for screening tsRNA related to myocardial ischemia-reperfusion, which is characterized by comprising the following steps: comprises that
Step 1: constructing a rat myocardial ischemia reperfusion model, and screening tsRNA (transcription-dependent ribonucleic acid) which is differentially expressed in the in-vivo rat myocardial ischemia reperfusion process by sequencing, wherein the method comprises the following specific steps:
1.1. grouping and processing of myocardial ischemia reperfusion in vitro model animals: Sprague-Dawley (SD) male rats (weight 260-;
1.2. SD rats were randomly divided into two groups: sham (sham, n-4), myocardial ischemia-reperfusion (I/R, n-4), rats were anesthetized with 2% sodium pentobarbital (50mg/kg i.p.) and artificially ventilated (80 times/min) with a rodent mask;
1.3. after completion of anesthesia, at the fourth intercostal location on the left side of the rat sternum, skin and muscle tissue was cut laterally from the left sternum border to the left axilla to expose the heart, and the Left Anterior Descending (LAD) coronary artery approximately 2mm from the origin of the coronary artery was ligated using 6-0 surgical suture, and myocardial pallor of the left ventricle under the suture was observed to indicate successful infarction;
1.4. carrying out LAD ligation infarction on the rat for 30 minutes, then perfusing the rat for 2 hours, allowing the rat in the sham operation group to receive suture to pass under the LAD under the anesthesia state without infarction, immediately killing the experimental rat after reperfusion is finished, and taking out the heart to be frozen in a refrigerator at-80 ℃;
1.5. extraction of myocardial tissue RNA:
1.5.1. putting the myocardial tissue and 1ml of TRIzol reagent into a homogenizer to grind and crack the tissue;
1.5.2. adding 0.2ml of chloroform into TRIzol, carrying out vortex oscillation for 10 seconds, standing for 5 minutes at room temperature, centrifuging for 15 minutes at 12000rpm at 4 ℃, sucking the upper aqueous phase, and transferring into a new RNA enzyme-free centrifuge tube;
1.5.3. adding isopropanol with the same volume as the middle upper layer water phase, uniformly mixing, standing for 20 minutes at 4 ℃, then centrifuging for 10 minutes at 12000rpm at 4 ℃, and removing the supernatant to obtain a precipitate;
1.5.4. adding 1ml of 75% ethanol into the precipitate, reversing for several times, centrifuging at 12000rpm at 4 ℃ for 5 minutes, and removing the supernatant;
1.5.5. centrifuging at 12000rpm for 2 minutes at 4 ℃, removing the supernatant, drying at room temperature for 1-2 minutes, adding 20 mul of RNA-free enzyme for dissolving to obtain RNA extract, and storing at-80 ℃ for later use;
1.5.6. extracting total RNA of the two groups of cells, denaturing and diluting to a loading volume of 1.3ml and a loading concentration of 1.8 pM;
1.5.7. sequencing was performed on the illuminainnextseq 500 system using the NextSeq500/550V2 kit, sequencing type 50 cycles;
1.6. collecting sequencing data, analyzing the data by using AgilentGeneSpringGXv12.0 software, and screening out the differentially expressed tsRNA of which the change multiple of the myocardial ischemia-reperfusion group is more than 1.5 times compared with a sham operation group and the P value is less than 0.05;
1.7. the selected differentially expressed tsRNAs are divided into an up-regulation group and a down-regulation group, and tsRNAs which have close relation with the myocardial ischemia-reperfusion activity process are selected according to the sequence of change multiples, namely 3 tsRNAs (tirRNA-Met-CAT-002; tirRNA-Pro-TGG-003; tRF-Asn-GTT-013) are up-regulated compared with a sham operation group in an in-vivo myocardial ischemia-reperfusion model, and 3 tsRNAs (tRF-Cys-GCA-007; tRF-Thr-TGT-024; tRF-Gln-TTG-008) are down-regulated compared with the sham operation group.
Step 2: constructing a rat myocardial ischemia reperfusion model and a myocardial cell hypoxia reoxygenation model, and verifying a sequencing result by adopting real-time quantitative PCR, wherein the method comprises the following specific steps:
2.1. grouping and processing of myocardial ischemia reperfusion in vitro model animals: Sprague-Dawley (SD) male rats (body weight 260-;
2.2. SD rats were randomly divided into two groups: sham (sham, n-4), myocardial ischemia-reperfusion (I/R, n-4), rats were anesthetized with 2% sodium pentobarbital (50mg/kg i.p.) and artificially ventilated (80 times/min) with a rodent mask;
2.3. after completion of anesthesia, at the fourth intercostal location on the left side of the rat sternum, skin and muscle tissue was cut laterally from the left sternum border to the left axilla to expose the heart, and the Left Anterior Descending (LAD) coronary artery approximately 2mm from the origin of the coronary artery was ligated using 6-0 surgical suture, and myocardial pallor of the left ventricle under the suture was observed to indicate successful infarction;
2.4. carrying out LAD ligation infarction on the rat for 30 minutes, then carrying out reperfusion for 2 hours, allowing the rat in the sham operation group to receive a suture line to pass under the LAD under an anesthesia state without infarction, immediately killing the experimental rat after reperfusion is finished, and taking out the heart to be frozen in a refrigerator at-80 ℃;
2.5. constructing an in-vitro myocardial cell hypoxia reoxygenation model:
2.5.1. placing the cardiac muscle cell strain H9c2 in cell culture solution without sugar DMEM and FBS, and respectively placing the cell culture solution in a hypoxia culture box for culturing for 2 hours;
2.5.2. then putting the two groups of cells into an atmospheric oxygen incubator for reoxygenation for 3 hours, establishing a myocardial cell model of myocardial cell hypoxia reoxygenation injury, and culturing the normal group of cells in the atmospheric oxygen incubator for 5 hours;
2.5.3. wherein the hypoxia culture box is<1％O2、5％CO2About 95% N2(ii) a The normal oxygen incubator is 21% O2、5％CO2、74％N2；
2.6 extraction of RNA:
2.6.1. adding 1ml of TRIzol reagent into the tissue sample of the step 2.4 every 50-100mg, and homogenizing by using an electric homogenizer;
2.6.2. directly adding 1ml of TRIzol reagent into the cell sample obtained in the step 2.5 to lyse the cells, and sucking and beating the cells for several times by using a gun during lysis;
2.6.3. adding 0.2ml of chloroform into TRIzol, carrying out vortex oscillation for 10 seconds, standing for 5 minutes at room temperature, centrifuging for 15 minutes at 12000rpm at 4 ℃, sucking the upper aqueous phase, and transferring into a new RNA enzyme-free centrifuge tube;
2.6.4. adding isopropanol with the same volume as the middle upper layer water phase, uniformly mixing, standing for 20 minutes at 4 ℃, then centrifuging for 10 minutes at 12000rpm at 4 ℃, and removing the supernatant to obtain a precipitate;
2.6.5. adding 1ml of 75% ethanol into the precipitate, reversing for several times, centrifuging at 12000rpm at 4 ℃ for 5 minutes, and removing the supernatant;
2.6.6. centrifuging at 12000rpm for 2 minutes at 4 ℃, removing the supernatant, drying at room temperature for 1-2 minutes, adding 20 mul of RNA-free enzyme for dissolving to obtain RNA extract, and storing at-80 ℃ for later use;
2.7. pre-treating the total RNA in the step 2.6:
2.7.1. using rtStarTMAn RNA pretreatment kit;
2.7.2. 3' -terminal deacylation: adding 15 μ L of System A (clarification Reaction Buffer (5X) 3uL, RNase Inhibitor 1 μ L, Input RNA 1-5 μ g, nucleic-free water x μ L), mixing (shaker), incubating at 37 ℃ for 40 min, adding 19 μ L of clarification Stop Buffer, mixing, and room temperature for 5 min;
2.7.3. removal of 3 '-CP and addition of 5' -cP: add 50. mu.L of System B (5. mu.L of Terminal Enzyme reaction Buffer (10X), 5. mu.L of 10mM ATP, 5. mu.L of Terminal Enzyme Mix 3U 1. mu.L, 5. mu.L of nucleic-free water) to System A, incubate 40 min at 37 ℃ and 5 min at 70 ℃;
2.7.4. demethylation: add 50. mu.L of System C (Demethylation Reaction Buffer (5X) 10. mu.L, Demethylation 5. mu.L, RNase Inhibitor 1. mu.L, Input RNA 1-5. mu.g, nucleic-free X. mu.L) to System A, incubate for 2h at 37 ℃, add 40. mu.L of nucleic-free Water, add 10. mu.L Demethylation stop Buffer (5X) to stop the Reaction;
2.8. carrying out reverse transcription on the total RNA in the step 2.7 to synthesize cDNA;
2.8.1. 3' primer binding was performed: mixing system A, nucleic-free Water variable 3.5 muL (Input RNA 0.5-2.5 muL, 3 ' adapter 0.5 muL, RNA Spike-in 0.5 muL), incubating at 70 ℃ for 2 minutes, preparing system B10 muL (3 ' Ligation Reaction Buffer (2X)5 muL, 3 ' Ligation Enzyme mix1.5 muL), adding into system A, and incubating at 25 ℃ for 1 hour;
2.8.2. reverse transcription primer hybridization: preparing a system C (Nuclear-free Water 2.3. mu.L, ReverseTranscription Primer 0.5. mu.L), adding the system B, hybridizing at 75 ℃ for 5 minutes, at 37 ℃ for 15 minutes, and hybridizing at 25 ℃ for 15 minutes;
2.8.3. performing 5' conjugate binding: preparing a system D (5 ' adapter (denuded) 0.5 mu L, 5' Ligation Reaction Buffer 0.5 mu L, 5' Ligation Enzyme Mix 1.2 mu L), adding the system C, and incubating for 1 hour at 25 ℃;
2.8.4. reverse transcription: after completion of system D, mixing was performed as follows (15. mu.L of Adaptor Ligated RNA, 4. mu.L of First-Strand Synthesis Reaction Buffer, 0.5. mu.L of RNase Inhibitor, 0.5. mu.L of ReverseTranscriptase, and 20. mu.L of Total volume), incubating at 50 ℃ for 60 minutes, and cold-storing on ice;
2.9. and (3) carrying out PCR amplification reaction on the cDNA solution obtained in the step (2.8), wherein the amplified upstream and downstream primers are tsRNA specific amplified upstream and downstream primers or GAPDH amplified upstream and downstream primers, and then detecting by using a fluorescence quantitative PCR instrument, wherein the result shows that the tsRNA has close relation with the myocardial ischemia-reperfusion process: 3 tsRNAs (TiRNA-Met-CAT-002; TiRNA-Pro-TGG-003; tRF-Asn-GTT-013) are all up-regulated compared with the sham operation group, and 3 tsRNAs (tRF-Cys-GCA-007; tRF-Thr-TGT-024; tRF-Gln-TTG-008) are all down-regulated compared with the sham operation group, and the result is consistent with the sequencing result;
through the arrangement of the scheme, a myocardial cell hypoxia reoxygenation model is further constructed, and the tirRNA-Met-CAT-002-mimics is adopted to over-express the tirRNA-Met-CAT-002, so that the tirRNA-Met-CAT-002 is proved to reduce myocardial hypoxia reoxygenation injury through regulating and controlling cell autophagy, and the specific steps are as follows:
3.1. constructing a myocardial cell hypoxia reoxygenation model:
3.1.1. placing the cardiac muscle cell strain H9c2 in cell culture solution without sugar DMEM and FBS, and respectively placing the cell culture solution in a hypoxia culture box for culturing for 2 hours;
3.1.2. then putting the two groups of cells into an atmospheric oxygen incubator for reoxygenation for 3 hours, establishing a myocardial cell model of myocardial cell hypoxia reoxygenation injury, and culturing the normal group of cells in the atmospheric oxygen incubator for 5 hours;
3.1.3. wherein the hypoxia culture box is<1％O2、5％CO2About 95% N2(ii) a The normal oxygen incubator is 21% O2、5％CO2、74％N2；
3.2. Adopting the tirRNA-Met-CAT-002-mimics to over-express the tirRNA-Met-CAT-002:
3.2.1. 150ul OPTI-MEM and 1.5ul lipo2000 were added to the reagent tube a; 150ul OPTI-MEM and 5ul mimics-NC and mimics are added into the reagent tube b; standing for 5 minutes;
3.2.2. mixing the tubes a and b, and standing for 15 minutes;
3.2.3. adding OPTI-MEM into the mixed solution to 1ml, placing the mixed solution into a 12-hole plate for 6 hours, changing a complete culture medium to continue culturing for 36 hours, and then performing myocardial anoxia reoxygenation molding;
CCK-8 detection of cell activity;
3.4 Westernblot detection of cell autophagy-related indexes; LC3-II/LC3-I ratio, expression of p62 protein;
3.5. and observing the formation condition of the autophagosome by an electron microscope.
The invention is further provided that the primers of the tirRNA-Met-CAT-002 are as follows:
f5 'GTAAGGTCAGCTAACTAAGCTATCG 3', R5 'TGTGCTCTTCCGATCTGGG 3'; the primers of the tirRNA-Pro-TGG-003 are as follows:
f5 'TCCGACGATCCAAGAAGTAGT 3', R5 'CTTCCGATCTAAAGCTGATATTCT 3'; the primers of the tRF-Asn-GTT-013 are as follows:
f5 'CTACAGTCCGACGATCTAGATTG 3', R5 'GCTCTTCCGATCTACTGGCT 3'; the primer of the tRF-Gln-TTG-008 is as follows: f, 5'GTCCGACGATCATCTCGGTG 3',
r is 5 'CTCTTCCGATCTTGGAGGTCC 3'; the primer of the tRF-Thr-TGT-024 is as follows:
F:5’TCCGACGATCTCTCGCTGG3’，R:5’GCTCTTCCGATCTTGGAGGC3’；
a. the primer of the tRF-Cys-GCA-007 is as follows: f, 5 'TCCGACGATCATCCGGGT 3',
r is 5 'CTCTTCCGATCTTGGAGGGG 3'; the primers of the U6 are as follows:
f5 'GCTTCGGCAGCACATATACTAAAAT 3', R5 'CGCTTCACGAATTTGCGTGTCAT 3'; the target sequence of the tirRNA-Met-CAT-002 mimics is as follows:
5 'AGUAAGGUCAGCUAACUAAGCUAUCGGGCCC 3'; the target sequence of the tirRNA-Met-CAT-002 mimicrsNC is as follows: 5 'CAAGCCAAGGGGUCCUAUGAACGCUUCUAGA 3'.
The second technical scheme adopted by the invention is that the application of tsRNA related to myocardial ischemia reperfusion in predicting and preventing myocardial infarction.
The invention has the beneficial effects that: the invention proves that the expression quantity of 6 tsRNAs is obtained in the myocardial ischemia-reperfusion process, wherein the expression quantity of 3 tsRNAs is up-regulated, the expression quantity of 3 tsRNAs is down-regulated, the bioinformatics analysis shows that 1 tsRNA has close relation with the activity of myocardial cells, and after over-expressing the 1 tsRNA, the autophagy of the cells is reduced, the activity of the cells is increased, which indicates that the 1 tsRNA can reduce myocardial hypoxia-reoxygenation injury by regulating the autophagy level of the cells. Therefore, a new idea is provided for researching the pathophysiological process of myocardial ischemia-reperfusion injury, and a new molecular basis or a new therapeutic target point is provided for preventing and treating the myocardial ischemia-reperfusion injury.
Drawings
FIG. 1 is a schematic diagram of clustering of tsRNA differentially expressed in myocardial ischemia-reperfusion according to example 1 of the present invention;
FIG. 2 is a schematic diagram of real-time quantitative PCR of 6 tsRNAs for myocardial ischemia reperfusion at the global level in example 2 of the present invention;
FIG. 3 is a schematic diagram of real-time quantitative PCR of hypoxia-reoxygenation TiRNA-Met-CAT-002 at the cellular level of cardiomyocytes according to the example of the present invention;
FIG. 4 is a schematic representation of the 6 tsRNA nucleotide sequence listing of example 1 of the present invention;
FIG. 5 is a schematic diagram showing a primer list for real-time quantitative PCR in example 2 of the present invention;
FIG. 6 is a schematic representation of the nucleotide sequence listings of the tirRNA-Met-CAT-002 mimics and the tirRNA-Met-CAT-002 mimicsNC of example 3 of the present invention;
FIG. 7 is a schematic diagram of the involvement of the tirRNA-Met-CAT-002 in the regulation and control of autophagy to improve myocardial hypoxia reoxygenation injury in example 3 of the present invention.
Detailed Description
The present invention will be described in further detail with reference to the drawings and examples, but the present invention is not limited to these embodiments.
As shown in fig. 1-7:
FIG. 1 is a graph of differential tsRNA clusters, after sequencing, differentially expressed tsRNAs were screened for myocardial ischemia reperfusion groups that varied more than 1.5-fold compared to sham groups, and had P values less than 0.05. I/R: myocardial ischemia reperfusion group; and Sham: a sham operation group;
FIG. 2 shows the results of verifying 6 tsRNA expression by Real-timePCR in rat myocardial ischemia-reperfusion model. (A-F) the relative expression of each tsRNA was determined by qRT-PCR using U6 as an internal control. And Sham: sham group, I/R: myocardial ischemia reperfusion group. P <0.0001, P <0.001, P < 0.05;
FIG. 3 shows a hypoxia reoxygenation model of H9c2 cells, and qRT-PCR was performed to detect the relative expression level expression of tirRNA-Met-CAT-002, using U6 as an internal reference. P <0.01 compared to control;
FIG. 4 is a schematic diagram of a sequence listing of 6 tsRNA nucleotides of example 1 of the present invention;
FIG. 5 is a schematic diagram showing a primer list for real-time quantitative PCR in example 2 of the present invention;
FIG. 6 is a schematic representation of the nucleotide sequence listings of the tirRNA-Met-CAT-002 mimics and the tirRNA-Met-CAT-002 mimicsNC of example 3 of the present invention;
FIG. 7 is a schematic diagram of the involvement of the tirRNA-Met-CAT-002 in the regulation and control of autophagy to improve myocardial hypoxia reoxygenation injury in example 3 of the present invention: in a myocardial ischemia reperfusion in vitro hypoxia reoxygenation (H/R) cell model, the tirRNA-Met-CAT-002 influences the activity of cells by regulating autophagy level. (A) In the H/R process, after treating the myocardial cells by using the TiRNA-Met-CAT-002-mimics, the activity of each group of myocardial cells is detected by using CCK-8. (B) In the H/R process, after treating myocardial cells by using the tirRNA-Met-CAT-002-mimics, detecting the expression levels of autophagy marker proteins LC3B-I/II and P62 protein in each group of cells by using WB. (C-D) histogram of each histone in Panel B. (E) Schematic representation of cardiomyocytes by electron microscopy, red arrows represent autophagosomes. P <0.01, p < 0.001; compared with the H/R + mimicNC group, # # p <0.01, # # # p < 0.001.
The invention aims to provide a method for screening tsRNA related to myocardial ischemia reperfusion, and fills the blank in the field.
The invention also aims to provide a method for extracting tsRNA related to myocardial ischemia-reperfusion.
The invention provides tsRNA which is tirRNA-Met-CAT-002, and the nucleotide sequence of the tsRNA is shown in figure 4.
The invention provides relevance of a TiRNA-Met-CAT-002 in myocardial ischemia reperfusion, wherein the TiRNA-Met-CAT-002 has differential expression in a myocardial ischemia reperfusion model.
The invention provides a potential drug molecule aiming at myocardial ischemia-reperfusion, and the nucleotide sequence of the drug molecule is shown in figure 6, wherein the potential drug molecule comprises tirRNA-Met-CAT-002-mimics.
Example 1:
constructing an in vitro myocardial ischemia reperfusion model, and screening tsRNA (transcription-dependent ribonucleic acid) which is differentially expressed in the myocardial ischemia reperfusion process by sequencing comprises the following steps:
a. grouping and processing of myocardial ischemia reperfusion in vitro model animals: Sprague-Dawley (SD) male rats (body weight 260-. SD rats were randomly divided into two groups: sham (sham, n is 4), myocardial ischemia reperfusion (I/R, n is 4). Rats in the myocardial ischemia-reperfusion group were anesthetized with 2% sodium pentobarbital (50mg/kg i.p.) and artificially ventilated (80 times/min) using a rodent mask. After anesthesia was completed, the skin and muscle tissue was cut laterally from the left sternum border to the left axilla at the fourth intercostal location on the left side of the rat sternum to expose the heart. The Left Anterior Descending (LAD) coronary artery approximately 2mm from the start of the coronary artery was ligated using 6-0 surgical sutures. Myocardial pallor of the left ventricle below the suture was observed to indicate successful infarction. Rats were infarcted with LAD ligation for 30 minutes and then perfused for 2 hours. Rats in the sham group received a suture under anesthesia passed under LAD and did not undergo infarction. After reperfusion was complete, the experimental rats were sacrificed immediately and the hearts were frozen in a-80 ℃ freezer.
b. Homogenizing tissue sample, adding 1ml TRIzol reagent per 50-100mg tissue sample, and homogenizing with electric homogenizer.
c. Adding 0.2ml of chloroform into the TRIzol obtained in the step b, carrying out vortex oscillation for 10 seconds, standing for 5 minutes at room temperature, centrifuging for 15 minutes at 12000rpm at 4 ℃, sucking the upper aqueous phase, and transferring into a new RNase-free centrifuge tube;
d. and (3) isopropanol precipitation: adding isopropanol with the same volume as the upper water phase in the step c, uniformly mixing, standing for 20 minutes at 4 ℃, then centrifuging for 10 minutes at 12000rpm at 4 ℃, and removing the supernatant to obtain a precipitate;
e. washing with ethanol: adding 1ml of 75% ethanol into the precipitate in the step d, reversing for several times, centrifuging at 12000rpm at 4 ℃ for 5 minutes, and removing the supernatant;
f. drying RNA: after the supernatant is discarded in the previous step, centrifuging the mixture at 12000rpm for 2 minutes at 4 ℃; discarding the supernatant, drying at room temperature for 1-2 minutes, adding 20 mul of non-RNA enzyme water for dissolving to obtain RNA extract, and storing at-80 ℃ for later use;
g. total RNA from the two groups of cells was extracted, denatured and diluted to a loading volume of 1.3ml and a loading concentration of 1.8 pM. And sequenced on the Illumina NextSeq500 system using the NextSeq500/550V2 kit. The sort type is 50 cycles.
h. And collecting sequencing data, analyzing the data by using Agilent GeneSpring GX v12.0 software, and screening out the differentially expressed tsRNA with the change multiple more than 1.5 times and the P value less than 0.05.
The screened differentially expressed tsRNAs were divided into up-regulated and down-regulated groups. tsRNAs closely related to the myocardial ischemia-reperfusion activity were selected according to fold-change ranking, i.e., 3 tsRNAs (tirRNA-Met-CAT-002; tirRNA-Pro-TGG-003; tRF-Asn-GTT-013) (nucleotide sequences shown in SEQ ID NO.1-SEQ ID NO.3) were all up-regulated compared to the sham group and 3 tsRNAs (tRF-Cys-GCA-007; tRF-Thr-TGT-024; tRF-Gln-TTG-008) (nucleotide sequences shown in SEQ ID NO.4-SEQ ID NO.6) were all down-regulated compared to the sham group in the in vivo myocardial ischemia-reperfusion model, respectively.
The experimental conditions of the myocardial ischemia reperfusion model can well simulate the clinical pathological process of myocardial ischemia reperfusion. In addition, the RNA extraction method has good repeatability, so the reliability of the result of tsRNA sequencing screening is high.
Example 2:
constructing a rat myocardial ischemia reperfusion model and a myocardial cell hypoxia reoxygenation model, and verifying the sequencing result by adopting real-time quantitative PCR.
a. A myocardial ischemia-reperfusion model was constructed as described in a in example 1.
b. Constructing a myocardial cell hypoxia reoxygenation model: placing the cardiac muscle cell strain H9c2 in cell culture solution without sugar DMEM and FBS, and respectively placing the cell culture solutionCulturing in a hypoxia culture box for 2 hours, then putting the two groups of cells into an ordinary oxygen culture box for reoxygenation for 3 hours, establishing a myocardial cell model with myocardial cell hypoxia and reoxygenation injury, and culturing the normal group of cells in the ordinary oxygen culture box for 5 hours; wherein the hypoxia culture box is<1％O2、5％CO2About 95% N2(ii) a The normal oxygen incubator is 21% O2、5％CO2、74％N2；
c. Homogenizing tissue sample, adding 1ml TRIzol reagent per 50-100mg tissue sample, and homogenizing with electric homogenizer. The volume of the sample added must not exceed 10% of the volume of TRIzol reagent used to homogenize the sample.
d. And c, homogenizing the adherent cells of the monolayer, namely adding 1ml of TRIzol reagent into the cells subjected to the anoxic reoxygenation treatment in the step b for cracking, and sucking and beating the cells for several times by using a gun during cracking.
e. Adding 0.2ml of chloroform into the TRIzol obtained in the steps c and d, carrying out vortex oscillation for 10 seconds, standing for 5 minutes at room temperature, centrifuging for 15 minutes at 4 ℃ and 12000rpm, and absorbing the upper aqueous phase and transferring into a new RNase-free centrifuge tube;
f. and (3) isopropanol precipitation: adding isopropanol with the same volume as the upper water phase in the step e, uniformly mixing, standing for 20 minutes at 4 ℃, then centrifuging for 10 minutes at 12000rpm at 4 ℃, and removing the supernatant to obtain a precipitate;
g. washing with ethanol: adding 1ml of 75% ethanol into the precipitate in the step f, reversing for several times, centrifuging at 12000rpm at 4 ℃ for 5 minutes, and removing the supernatant;
h. drying RNA: after the supernatant is discarded in the previous step, centrifuging the mixture at 12000rpm for 2 minutes at 4 ℃; discarding the supernatant, drying at room temperature for 1-2 minutes, adding 20 mul of non-RNA enzyme water for dissolving to obtain RNA extract, and storing at-80 ℃ for later use;
rna pretreatment: using rtStarTMAnd (e) carrying out RNA pretreatment on the RNA extracting solution in the step h by using the RNA pretreatment kit. 3' -terminal deacylation: adding 15. mu.L of System A (Deacylation Reaction Buffer (5X) 3. mu.L, RNaseIII inhibitor 1. mu.L, Input RNA 1-5. mu.g, nucleic-free water X. mu.L), mixing (shaker), incubating at 37 ℃ for 40 minutes, adding 19. mu.L of Deacylation Stop Buffer, mixing, and mixing at room temperature for 5 minutes; removal of 3' -CP andadding 5' -cP: add 50. mu.L of System B (5. mu.L of Terminal Enzyme Reaction Buffer (10X), 5. mu.L of 10mM ATP, 5. mu.L of Terminal Enzyme Mix 3U 1. mu.L, 5. mu.L of nucleic-free water) to System A, incubate 40 min at 37 ℃ and 5 min at 70 ℃; demethylation: to System A, 50. mu.L of System C (Demethylation Reaction Buffer (5X) 10. mu.L, Demethylation 5. mu.L, RNase Inhibitor 1. mu.L, Input RNA 1-5. mu.g, nucleic-free water X. mu.L) was added, and the Reaction was incubated at 37 ℃ for 2 hours, 40. mu.L of nucleic-free Water was added, and 10. mu.L of Demethylation StopBuffer (5X) was added to terminate the Reaction.
Reverse transcription of RNA: and (e) carrying out reverse transcription on the total RNA in the step i to synthesize cDNA. 3' primer binding: 3.5 muL of mixed system ANucllease-free Water variable (0.5-2.5 muL of Input RNA, 0.5 muL of 3 ' adapter, 0.5 muL of RNAscope-in 0.5 muL), incubating at 70 ℃ for 2 minutes, configuring a system B10 muL (5 muL of 3 ' Ligation Reaction Buffer (2X), 1.5 muL of 3 ' Ligation Enzyme Mix) and adding into the system A, and incubating at 25 ℃ for 1 hour; reverse transcription primer hybridization: preparing a system C (2.3 mu L of nucleic-free Water, 0.5 mu L of Reverse Transcription Primer), adding the system B, hybridizing at 75 ℃ for 5 minutes, hybridizing at 37 ℃ for 15 minutes, and hybridizing at 25 ℃ for 15 minutes; 5' conjugate binding: preparing a system D (5 ' adapter (denuded) 0.5 mu L, 5' Ligation Reaction Buffer 0.5 mu L, 5' Ligation Enzyme Mix 1.2 mu L), adding the system C, and incubating for 1 hour at 25 ℃; reverse transcription: after completion of System D, mixing was performed as follows (Adaptor Ligated RNA 15. mu.L, First-Strand Synthesis Reaction Buffer 4. mu.L, RNase Inhibitor 0.5. mu.L, ReverseTranscriptase 0.5. mu.L, Total volume 20. mu.L), incubation was performed at 50 ℃ for 60 minutes, and cold storage was performed on ice.
k, PCR detection: and (e) carrying out PCR amplification reaction on the cDNA solution obtained in the step (j), wherein the amplified upstream and downstream primers are tsRNA specific amplified upstream and downstream primers or U6 amplified upstream and downstream primers, and detecting by using a fluorescent quantitative PCR instrument.
In the myocardial ischemia-reperfusion model, 3 tsRNAs (TiRNA-Met-CAT-002; TiRNA-Pro-TGG-003; tRF-Asn-GTT-013) (the nucleotide sequences of which are shown in SEQ ID NO.1-SEQ ID NO.3) are all up-regulated compared with the sham group, and 3 tsRNAs (tRF-Cys-GCA-007; tRF-Thr-TGT-024; tRF-Gln-TTG-008) (the nucleotide sequences of which are shown in SEQ ID NO.4-SEQ ID NO.6) are all down-regulated compared with the sham group, and the result is consistent with the sequencing result. In addition, the conditions of the in vitro myocardial cell hypoxia reoxygenation model in the b well simulate the clinical myocardial ischemia reperfusion injury. In addition, in the model, the selected tsRNA (tirRNA-Met-CAT-002) is also up-regulated compared with the normal group, and the result is consistent with the sequencing result and the myocardial ischemia-reperfusion model result, and further proves that the tsRNA is changed in the myocardial ischemia-reperfusion process and possibly participates in the pathophysiological process, so that clues and ideas are provided for subsequent functional research.
Example 3:
constructing an oxygen deficiency reoxygenation model of the myocardial cells, and over-expressing the tirRNA-Met-CAT-002 by adopting the tirRNA-Met-CAT-002-mics.
CCK-8 was used to detect cell activity.
Detecting cell autophagy related indexes by using Western blot; LC3-II/LC3-I ratio, expression of p62 protein.
And observing the formation condition of the autophagosome by using an electron microscope.
a. An in vitro cardiomyocyte hypoxia reoxygenation model was constructed as described in b of example 2. Cells were randomized into four groups: a Control group; H/R group; H/R + tirRNA-Met-CAT-002-mix-NC group; H/R + tirRNA-Met-CAT-002-mimics group.
b. Adopting the tirRNA-Met-CAT-002-mimics to over-express the tirRNA-Met-CAT-002: 150ul OPTI-MEM and 1.5ul lipo2000 were added to the reagent tube a; 150ul OPTI-MEM and 5ul mimics-NC and mimics are added into the reagent tube b; standing for 5 minutes, and mixing the tubes a and b; after mixing and standing for 15 minutes, the mixture was added to OPTI-MEM to 1ml and then cultured for another 36 hours after 6 hours with the complete medium change, followed by myocardial hypoxia reoxygenation and molding.
c. CCK-8 was used to detect cell activity.
d. Detecting relevant indexes of cell autophagy by adopting Westernblot; LC3-II/LC3-I ratio, expression of p62 protein.
e. And observing the formation condition of the autophagosome by using an electron microscope.
The primers for the tiRNA-Met-CAT-002 shown in fig. 5 are: f5 'GTAAGGTCAGCTAACTAAGCTATCG 3' (SEQ ID NO.7), R5 'TGTGCTCTTCCGATCTGGG 3' (SEQ ID NO. 8); the primers of the tirRNA-Pro-TGG-003 are as follows: f5 'TCCGACGATCCAAGAAGTAGT 3' (SEQ ID NO.9), R5 'CTTCCGATCTAAAGCTGATATTCT 3' (SEQ ID NO. 10); the primers of the tRF-Asn-GTT-013 are as follows: f5 'CTACAGTCCGACGATCTAGATTG 3' (SEQ ID NO.11), R5 'GCTCTTCCGATCTACTGGCT 3' (SEQ ID NO. 12); the primer of the tRF-Gln-TTG-008 is as follows: f5 'GTCCGACGATCATCTCGGTG 3' (SEQ ID NO.13), R5 'CTCTTCCGATCTTGGAGGTCC 3' (SEQ ID NO. 14); the primer of the tRF-Thr-TGT-024 is as follows: f5 'TCCGACGATCTCTCGCTGG 3' (SEQ ID NO.15), R5 'GCTCTTCCGATCTTGGAGGC 3' (SEQ ID NO. 16); the primer of the tRF-Cys-GCA-007 is as follows: f5 'TCCGACGATCATCCGGGT 3' (SEQ ID NO.17), R5 'CTCTTCCGATCTTGGAGGGG 3' (SEQ ID NO. 18); the primers of the U6 are as follows: f5 'GCTTCGGCAGCACATATACTAAAAT 3' (SEQ ID NO.19), R5 'CGCTTCACGAATTTGCGTGTCAT 3' (SEQ ID NO. 20);
the target sequence of the tirRNA-Met-CAT-002 mimics is as follows: 5 'AGUAAGGUCAGCUAACUAAGCUAUCGGGCCC 3'; the target sequence of the tirRNA-Met-CAT-002 mimicrsNC is as follows: 5 'CAAGCCAAGGGGUCCUAUGAACGCUUCUAGA 3'.
The invention proves that the expression quantity of 3 tsRNAs is up-regulated and the expression quantity of 3 tsRNAs is down-regulated in the myocardial ischemia-reperfusion process. Bioinformatics analysis shows that the TiRNA-Met-CAT-002 has close relation with the activity of myocardial cells, and after the TiRNA-Met-CAT-002 is over-expressed, autophagy of the cells is reduced, and the activity of the cells is increased. This suggests that the tirRNA-Met-CAT-002 can reduce myocardial hypoxia reoxygenation injury by regulating the level of autophagy. Therefore, a new idea is provided for researching the pathophysiological process of myocardial ischemia-reperfusion injury, and a new molecular basis or a new therapeutic target is provided for preventing and treating the myocardial ischemia-reperfusion injury, so that a new idea is provided for clinically preventing and treating the myocardial ischemia-reperfusion injury.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and it is to be understood that the above description is not to be construed as limiting the present invention, and any modifications, equivalents, improvements and the like made within the design concept of the present invention are included in the scope of the present invention.
SEQUENCE LIST
<120> screening method of tsRNA related to myocardial ischemia-reperfusion
<141>2020-08-11
<160>20
<170>SIPOSequenceListing 1.0
<210>1
<211>31
<212>DNA
<213> mouse
<400>1
Agtaaggtca gctaactaag ctatcgggccc 31
<210>2
<211>31
<212>DNA
<213> mouse
<400>2
caagaagtag tttaaataga atatcagctt t 31
<210>3
<211>15
<212>DNA
<213> mouse
<400>3
<210>4
<211>18
<212>DNA
<213> mouse
<400>4
atccgggtgc cccctcca 18
<210>5
<211>17
<212>DNA
<213> mouse
<400>5
tctcgctggg gcctcca 17
<210>6
<211>18
<212>DNA
<213> mouse
<400>6
atctcggtgg gacctcca 18
<210>7
<211>25
<212>DNA
<213> Artificial sequence
<400>7
gtaaggtcag ctaactaagc tatcg 25
<210>8
<211>19
<212>DNA
<213> Artificial sequence
<400>8
tgtgctcttc cgatctggg 19
<210>9
<211>21
<212>DNA
<213> Artificial sequence
<400>9
tccgacgatc caagaagtag t 21
<210>10
<211>24
<212>DNA
<213> Artificial sequence
<400>10
cttccgatct aaagctgata ttct 24
<210>11
<211>23
<212>DNA
<213> Artificial sequence
<400>11
ctacagtccg acgatctaga ttg 23
<210>12
<211>20
<212>DNA
<213> Artificial sequence
<400>12
<210>13
<211>20
<212>DNA
<213> Artificial sequence
<400>13
<210>14
<211>21
<212>DNA
<213> Artificial sequence
<400>14
ctcttccgat cttggaggtc c 21
<210>15
<211>19
<212>DNA
<213> Artificial sequence
<400>15
tccgacgatc tctcgctgg 19
<210>16
<211>20
<212>DNA
<213> Artificial sequence
<400>16
<210>17
<211>18
<212>DNA
<213> Artificial sequence
<400>17
tccgacgatc atccgggt 18
<210>18
<211>20
<212>DNA
<213> Artificial sequence
<400>18
<210>19
<211>25
<212>DNA
<213> Artificial sequence
<400>19
gcttcggcag cacatatact aaaat 25
<210>20
<211>23
<212>DNA
<213> Artificial sequence
<400>20
cgcttcacga atttgcgtgt cat 23
Claims (1)
1. A method for screening tsRNA related to myocardial ischemia-reperfusion, which is characterized by comprising the following steps: comprises that
Step 1: constructing a rat myocardial ischemia reperfusion model, and screening tsRNA (transcription factor RNA) which is differentially expressed in the rat myocardial ischemia reperfusion process by adopting a sequencing method, wherein the method comprises the following specific steps:
1.1. grouping and processing of myocardial ischemia reperfusion model animals: Sprague-Dawley (SD) male rats at 6 weeks of age, weighing 260-;
1.2. SD rats were randomly divided into two groups: the sham-operated group n is 4, the myocardial ischemia reperfusion group I/R, n is 4, the myocardial ischemia reperfusion group rats are anesthetized by using 50mg/kg intraperitoneal of 2% sodium pentobarbital, and are ventilated for 80 times/min by using a rodent mask;
1.3. after completion of anesthesia, at the fourth intercostal location on the left side of the rat sternum, skin and muscle tissue was cut laterally from the left sternum border to the left axilla to expose the heart, and the Left Anterior Descending (LAD) coronary artery approximately 2mm from the origin of the coronary artery was ligated using 6-0 surgical suture, and myocardial pallor of the left ventricle under the suture was observed to indicate successful infarction;
1.4. carrying out LAD ligation infarction on the rat for 30 minutes, then perfusing the rat for 2 hours, allowing the rat in the sham operation group to receive suture to pass under the LAD under the anesthesia state without infarction, immediately killing the experimental rat after reperfusion is finished, and taking out the heart to be frozen in a refrigerator at-80 ℃;
1.5. extraction of myocardial tissue RNA:
1.5.1. putting the myocardial tissue and 1ml of TRIzol reagent into a homogenizer to grind and crack the tissue;
1.5.2. adding 0.2ml of chloroform into TRIzol, carrying out vortex oscillation for 10 seconds, standing for 5 minutes at room temperature, centrifuging for 15 minutes at 12000rpm at 4 ℃, sucking the upper aqueous phase, and transferring into a new RNA enzyme-free centrifuge tube;
1.5.3. adding isopropanol with the same volume as the middle upper layer water phase, uniformly mixing, standing for 20 minutes at 4 ℃, then centrifuging for 10 minutes at 12000rpm at 4 ℃, and removing the supernatant to obtain a precipitate;
1.5.4. adding 1ml of 75% ethanol into the precipitate, reversing for several times, centrifuging at 12000rpm at 4 ℃ for 5 minutes, and removing the supernatant;
1.5.5. centrifuging at 12000rpm for 2 minutes at 4 ℃, removing the supernatant, drying at room temperature for 1-2 minutes, adding 20 mul of RNA-free enzyme for dissolving to obtain RNA extract, and storing at-80 ℃ for later use;
1.5.6. extracting total RNA of the two groups of cells, denaturing and diluting to a loading volume of 1.3ml and a loading concentration of 1.8 pM;
1.5.7. sequencing was performed on the Illumina NextSeq500 system using the NextSeq500/550V2 kit, sequencing type 50 cycles;
1.6. collecting sequencing data, analyzing the data by using Agilent GeneSpring GX v12.0 software, and screening out the differentially expressed tsRNA of which the change multiple of the myocardial ischemia-reperfusion group is more than 1.5 times compared with a sham operation group and the P value is less than 0.05;
1.7. dividing the screened differentially expressed tsRNA into an up-regulation group and a down-regulation group, and sorting out tsRNA closely related to the myocardial ischemia reperfusion activity process according to the sequence of change multiples;
step 2: constructing a rat myocardial ischemia reperfusion model and a myocardial cell hypoxia reoxygenation model, and verifying and sequencing by adopting real-time quantitative PCR, and specifically comprising the following steps:
2.1. grouping and processing of myocardial ischemia reperfusion model animals: Sprague-Dawley (SD) male rats of 6 weeks of age weighing 260-280 g were housed in an animal house at a temperature of 22-25 ℃ and a relative humidity of 50% for a 12 hour/12 hour light and dark cycle and were allowed free access to food and water;
2.2. SD rats were randomly divided into two groups: a sham group, n-4, myocardial ischemia reperfusion group I/R, n-4, myocardial ischemia reperfusion group rats were anesthetized intraperitoneally with 2% sodium pentobarbital 50mg/kg, and were ventilated manually with rodent masks for 80 times/min;
2.3. after completion of anesthesia, at the fourth intercostal location on the left side of the rat sternum, skin and muscle tissue was cut laterally from the left sternum border to the left axilla to expose the heart, and the Left Anterior Descending (LAD) coronary artery approximately 2mm from the origin of the coronary artery was ligated using 6-0 surgical suture, and myocardial pallor of the left ventricle under the suture was observed to indicate successful infarction;
2.4. carrying out LAD ligation infarction on the rat for 30 minutes, then carrying out reperfusion for 2 hours, allowing the rat in the sham operation group to receive a suture line to pass under the LAD under an anesthesia state without infarction, immediately killing the experimental rat after reperfusion is finished, and taking out the heart to be frozen in a refrigerator at-80 ℃;
2.5. constructing an in-vitro myocardial cell hypoxia reoxygenation model:
2.5.1. placing the cardiac muscle cell strain H9c2 in cell culture solution without sugar DMEM and FBS, and respectively placing the cell culture solution in a hypoxia culture box for culturing for 2 hours;
2.5.2. then putting the two groups of cells into an atmospheric oxygen incubator for reoxygenation for 3 hours, establishing a myocardial cell model of myocardial cell hypoxia reoxygenation injury, and culturing the normal group of cells in the atmospheric oxygen incubator for 5 hours;
2.5.3. wherein the hypoxia culture box is<1％O2、5％CO2About 95% N2(ii) a The normal oxygen incubator is 21% O2、5％CO2、74％N2；
2.6 extraction of RNA:
2.6.1. adding 1ml of TRIzol reagent into the tissue sample of the step 2.4 every 50-100mg, and homogenizing by using an electric homogenizer;
2.6.2. directly adding 1ml of TRIzol reagent into the cell sample obtained in the step 2.5 to lyse the cells, and sucking and beating the cells for several times by using a gun during lysis;
2.6.3. adding 0.2ml of chloroform into TRIzol, carrying out vortex oscillation for 10 seconds, standing for 5 minutes at room temperature, centrifuging for 15 minutes at 12000rpm at 4 ℃, sucking the upper aqueous phase, and transferring into a new RNA enzyme-free centrifuge tube;
2.6.4. adding isopropanol with the same volume as the middle upper layer water phase, uniformly mixing, standing for 20 minutes at 4 ℃, then centrifuging for 10 minutes at 12000rpm at 4 ℃, and removing the supernatant to obtain a precipitate;
2.6.5. adding 1ml of 75% ethanol into the precipitate, reversing for several times, centrifuging at 12000rpm at 4 ℃ for 5 minutes, and removing the supernatant;
2.6.6. centrifuging at 12000rpm for 2 minutes at 4 ℃, removing the supernatant, drying at room temperature for 1-2 minutes, adding 20 mul of RNA-free enzyme for dissolving to obtain RNA extract, and storing at-80 ℃ for later use;
2.7. pre-treating the total RNA in the step 2.6:
2.7.1. using rtStarTMAn RNA pretreatment kit;
2.7.2. 3' -terminal deacylation: adding 15 μ L of System A (clarification Reaction Buffer (5X) 3uL, RNase Inhibitor 1 μ L, Input RNA 1-5 μ g, nucleic-free water x μ L), mixing by a shaker, incubating at 37 ℃ for 40 min, adding 19 μ L of clarification Stop Buffer, mixing, and cooling at room temperature for 5 min;
2.7.3. removal of 3 '-CP and addition of 5' -cP: add 50. mu.L of System B (5. mu.L of Terminal Enzyme reaction Buffer (10X), 5. mu.L of 10mM ATP, 5. mu.L of Terminal Enzyme Mix 3U 1. mu.L, 5. mu.L of nucleic-free water) to System A, incubate 40 min at 37 ℃ and 5 min at 70 ℃;
2.7.4. demethylation: add 50. mu.L of System C (Demethylation Reaction Buffer (5X) 10. mu.L, Demethylation 5. mu.L, RNase Inhibitor 1. mu.L, Input RNA 1-5. mu.g, nucleic-free X. mu.L) to System A, incubate for 2h at 37 ℃, add 40. mu.L of nucleic-free Water, add 10. mu.L Demethylation stop Buffer (5X) to stop the Reaction;
2.8. carrying out reverse transcription on the total RNA in the step 2.7 to synthesize cDNA;
2.8.1. 3' primer binding was performed: mixing system A, nucleic-free Water variable 3.5 muL (InputtRNA 0.5-2.5 muL, 3 ' adapter 0.5 muL, RNA Spike-in 0.5 muL), incubating at 70 ℃ for 2 minutes, preparing system B10 muL (3 ' Ligation Reaction Buffer (2X)5 muL, 3 ' Ligation Enzyme mix1.5 muL), adding into system A, and incubating at 25 ℃ for 1 hour;
2.8.2. reverse transcription primer hybridization: preparing a system C (Nuclear-free Water 2.3. mu.L, ReverseTranscription Primer 0.5. mu.L), adding the system B, hybridizing at 75 ℃ for 5 minutes, at 37 ℃ for 15 minutes, and hybridizing at 25 ℃ for 15 minutes;
2.8.3. performing 5' conjugate binding: preparing a system D (5 ' adapter (denated) 0.5. mu.L, 5' Ligation reaction Buffer 0.5. mu.L, 5' Ligation Enzyme Mix 1.2. mu.L) and adding the system C, and incubating for 1 hour at 25 ℃;
2.8.4. reverse transcription: after completion of system D, mixing was performed as follows (15. mu.L of Adaptor Ligated RNA, 4. mu.L of First-Strand Synthesis Reaction Buffer, 0.5. mu.L of RNase Inhibitor, 0.5. mu.L of ReverseTranscriptase, and 20. mu.L of Total volume), incubating at 50 ℃ for 60 minutes, and cold-storing on ice;
2.9. and (3) carrying out PCR amplification reaction on the cDNA solution obtained in the step (2.8), wherein the amplified upstream and downstream primers are tsRNA specific amplified upstream and downstream primers or GAPDH amplified upstream and downstream primers, and detecting by using a fluorescence quantitative PCR instrument to obtain tsRNA for verifying a sequencing result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010810023.4A CN111893165A (en) | 2020-08-13 | 2020-08-13 | Screening method of tsRNA related to myocardial ischemia reperfusion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010810023.4A CN111893165A (en) | 2020-08-13 | 2020-08-13 | Screening method of tsRNA related to myocardial ischemia reperfusion |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111893165A true CN111893165A (en) | 2020-11-06 |
Family
ID=73229537
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010810023.4A Withdrawn CN111893165A (en) | 2020-08-13 | 2020-08-13 | Screening method of tsRNA related to myocardial ischemia reperfusion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111893165A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113999848A (en) * | 2021-10-25 | 2022-02-01 | 中南大学湘雅三医院 | tsRNA molecule and application thereof |
| CN114404617A (en) * | 2021-05-14 | 2022-04-29 | 川北医学院附属医院 | Model construction of influence of endoplasmic reticulum stress on NLRP3 on myocardial ischemia |
-
2020
- 2020-08-13 CN CN202010810023.4A patent/CN111893165A/en not_active Withdrawn
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114404617A (en) * | 2021-05-14 | 2022-04-29 | 川北医学院附属医院 | Model construction of influence of endoplasmic reticulum stress on NLRP3 on myocardial ischemia |
| CN113999848A (en) * | 2021-10-25 | 2022-02-01 | 中南大学湘雅三医院 | tsRNA molecule and application thereof |
| CN113999848B (en) * | 2021-10-25 | 2023-06-23 | 中南大学湘雅三医院 | tsRNA molecule and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2837437T3 (en) | Diagnostic, prognostic and therapeutic uses of long non-coding RNAs for heart disease and regenerative medicine | |
| US8574838B2 (en) | Methods and kits for miRNA isolation and quantitation | |
| EP3029156B1 (en) | Method for the diagnosis and/or prognosis of acute renal damage | |
| CN106488777A (en) | LncRNA for hypertrophic therapy and diagnosis | |
| Williams et al. | Profiling Schistosoma mansoni development using serial analysis of gene expression (SAGE) | |
| CN111893165A (en) | Screening method of tsRNA related to myocardial ischemia reperfusion | |
| US9121066B2 (en) | Methods for selecting competent oocytes and competent embryos with high potential for pregnancy outcome | |
| CN108977443B (en) | Circular RNA for expressing atherosclerosis inflammation activity and application thereof | |
| CN111440792B (en) | PiRNA and kit for detecting and/or predicting male reproductive dysfunction | |
| CN111118170B (en) | Application of chi-miR-450-5p as goat follicle maturation miRNA marker | |
| CN109913458B (en) | circRNA and application thereof in detecting hypoxic-ischemic brain injury | |
| JP2010502177A (en) | Diagnosis method | |
| CN113234819B (en) | Application method of long-chain non-coding RNA LOC107987064 and detection and treatment preparation | |
| CN114908156A (en) | CircRNA marker and application thereof | |
| KR101725985B1 (en) | Prognostic Genes for Early Breast Cancer and Prognostic Model for Early Breast Cancer Patients | |
| Kee et al. | Characterization of beef transcripts correlated with tenderness and moisture | |
| CN112941176A (en) | Tumor lactic acid microenvironment related non-coding small RNA molecular spectrum and application thereof | |
| CN112921104B (en) | Variable shear marker for assisting in selecting weight of sheep tail fat, detection primer and application thereof | |
| CN111763735B (en) | Tumor differential expression gene and application thereof | |
| CN109355372B (en) | Application of long-chain non-coding RNA PEV71I-1 in molecular marker for EV71 infection diagnosis | |
| CN107254537A (en) | The application of miR 1912 and its target gene in diagnosis and treatment myocardial infarction | |
| CN112680509A (en) | Coronary heart disease prognosis evaluation molecular marker miR-302e, reverse transcription primer and amplification primer thereof and application of reverse transcription primer and amplification primer | |
| RU2678441C1 (en) | Method for predicting risk of development of hypertensive disease factored in genetic and environmental factors | |
| CN114875128A (en) | miRNA marker related to skin repair and application thereof | |
| Chi et al. | The mechanism by which piR-000699 targets SLC39A14 regulates ferroptosis in aging myocardial ischemia/reperfusion injury |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20201106 |
|
| WW01 | Invention patent application withdrawn after publication |