CN111893127B - Expression vector containing low-temperature and QS dual inducible promoter and application thereof - Google Patents

Abstract

The invention discloses an expression vector containing a low-temperature and QS dual inducible promoter and application thereof, and the expression vector containing the low-temperature and QS dual inducible promoter, wherein the base sequence of the promoter is shown as a sequence table SEQ ID NO. 1. The expression vector can start host cells with low cell density to express a large amount of exogenous target protein under the induction of low temperature and signal molecules. The low-temperature and QS dual inducible promoter provided by the invention can control protein expression, can be applied to production of related proteins in the fields of food, medicine and the like, and also provides a new method for researching the biological function of specific protein.

Description

Expression vector containing low-temperature and QS dual inducible promoter and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to an expression vector containing a low-temperature and QS dual inducible promoter and application thereof.

Technical Field

Promoters (Promoters) are DNA sequences located upstream of the 5' end of a structural gene, and can activate RNA polymerase, enable the RNA polymerase to be accurately combined with template DNA and have the specificity of transcription initiation, and control the initiation time and the expression intensity of gene expression. Promoters are generally a stretch of DNA sequence containing cis-acting elements that play a key role in the regulation of gene expression: determines the specificity, direction and efficiency of transcription of downstream genes. In addition, the promoter plays a key role in the process of constructing a vector capable of expressing heterologous genes at high levels, and determines the temporal and spatial sequence of expression of the foreign genes, the expression intensity, the transcription efficiency and the expression level of the genes. Therefore, the research on the functions of the promoter has very important scientific significance for gene expression regulation and control mechanisms and gene engineering which matures day by day.

Analysis of promoter regions of various genes shows that the promoters of most functional protein genes have a common structural pattern and generally consist of a promoter core element and an upstream element. For example, in some plant functional promoters, TATAbox located-20 to-30 bp upstream of the transcription initiation site is a core element of the promoter, is an AT-rich conserved sequence region, is related to the melting of double strands of DNA (deoxyribonucleic acid), and determines the selection of the transcription initiation point, and is necessary for the correct expression of most plant promoters. The conserved sequence upstream of TATA box is called promoter upstream element, and includes general upstream promoter elements such as CAAT box at-75 bp and GC box near-80 to-110 bp, and other special upstream elements such as Jasmonate Response Element (JRE), Ethylene Response Element (ERE) (Zhang Chun Xiao, Wang wen chess, Jianxiangning, etc.. plant gene promoter research progress [ J ]. Gen Xue, 2004,31(12): 1455. quick 1464; Loujing, Huayan, Haoyaku, etc.. higher plant promoter and its application research progress [ J ]. Natural science progress, 2004,8: 002.). Among them, the CAAT box is a relatively conserved sequence, which is involved in recognition and binding of RNA (ribonucleic acid) polymerase, and has a strong activation effect on gene transcription. If these conserved structural blocks are present, they may have a function of promoting the expression of downstream genes in response.

Inducible promoters (Inducible promoters) are defined as promoters that significantly increase the transcription level of a gene when stimulated by certain specific physical or chemical signals. Currently, although some research on inducible promoters is involved, the research is not very mature, and related research in some species and microorganisms is not very much, and further development space is still available.

A Low-Temperature Inducible (Low-Temperature-Inducible) promoter refers to a promoter which can greatly improve the transcription level of a gene under Low-Temperature stimulation. The low-temperature expression system can greatly reduce the formation of protein inclusion bodies and can also obviously improve the stability of heterologous proteins, particularly some thermosensitive proteins. Quorum Sensing (Quorum Sensing) is a general mechanism of information transmission among bacteria, bacteria control the behavior of the whole bacterial population through synthesizing and secreting signal molecules (also called self-inducing molecules), and when the concentration of the signal molecules reaches a certain threshold along with the population density of the bacteria, a large amount of expression of certain specific genes can be started so as to regulate the adaptation function of the bacterial population. The ice nucleus gene inaQ promoter is cloned from pseudomonas syringae MB03 in the prior art, relative quantitative analysis is carried out through transcription activity, and the results of comparison of gene transcription activity levels in growth stages under the culture conditions of 16 ℃ and 28 ℃ respectively show that the transcription level of the ice nucleus gene of the promoter under the culture condition of 16 ℃ is obviously higher than that under the normal culture temperature of 28 ℃ of pseudomonas syringae, the former is nearly twice as high as the latter in the middle and later stages of logarithmic growth, and the transcription level reaches nearly 6 times in the middle and later stages of a stable period, and is favorable for the continuous transcription expression of the ice nucleus gene at 16 ℃ (Meng, the research on the transcription activity of the low-temperature dependent promoter of the ice nucleus protein gene MB03 of pseudomonas syringae), which fully embodies the advantage that the low-temperature promoter has better low-temperature expression.

Although many prokaryotes and eukaryotes express foreign genes, most commercially valuable proteins produced by recombinant DNA techniques are synthesized in E.coli. The optimum growth temperature of Escherichia coli is 37 ℃, but the Escherichia coli grows slowly in a low-temperature environment (4 ℃), so that the expression of the vector which can be efficiently expressed at the optimum temperature (37 ℃) under low-temperature induction cannot meet the requirement of people on the expression quantity. In addition, although the low-temperature inducible gene expression plasmid constructed by XWYang et al can induce and express protein at low temperature (XW Yang,2015, Applied and Environmental Microbiology,5519), it takes a long time to culture the host bacteria to late logarithmic phase in order to produce a large amount of required foreign protein.

Pseudomonas fluorescens belongs to a psychrophilic microorganism, is an environmental contaminant, and is also one of the main spoilage bacteria of food under refrigeration conditions (guo quan you, 2009, food and machinery, 87-90). Studies have shown that P.fluorescens has quorum sensing and increased spoilage as quorum density increases (Machen, 2013, microbiological bulletin, 2005-2013). Therefore, the promoter PFF doubly induced by low temperature and/or QS is screened out by utilizing the characteristics of pseudomonas fluorescens cold adaptation and QS regulation, and the plasmid constructed based on the method can accurately, rapidly and controllably express a large amount of target proteins by adding signal molecules with different concentrations only under the conditions of low temperature and low cell density, so that the requirements on various expressions are met. Although the genome of P.fluorescens has been disclosed, in particular as shown in Pseudomonas fluorescens strain PF08 chromosome, complete genome, Sequence ID: CP032618.1, the research on the promoter of PF08, in particular the research on the promoter involving low temperatures, has not been addressed at present.

Compared with the existing promoter known in the art, the low-temperature and/or QS-induced promoter provided by the invention has the characteristics of low temperature, low cell density and strong induced expression and controllability of target protein expression quantity, greatly improves the protein expression efficiency, and provides a new method for researching the biological function of specific protein.

Disclosure of Invention

The invention aims to provide a promoter pWFF1028 capable of promoting the expression of a target gene at low temperature and/or QS induction and application thereof.

The promoter provided by the invention is derived from pseudomonas fluorescens PF08, and is positioned in a 5' -non-coding region of a gene norD. The nucleotide sequence is shown as SEQ ID NO. 1. Specifically, the sequence of SEQ ID NO.1 is:

CAATCCCCAAGAGGGCGGCCCGGCAGGTTCTGCGGGCCGTTTTACGTCTGGAGCACTTCACATGGCCTTTACCCTTGAGTTGGAAGAGTGGGTCGGCAGTGTCTGGC。

the invention aims to provide a promoter pWFF1028 for promoting the expression of a target gene at low temperature and/or under QS induction, wherein the promoter has a nucleotide sequence shown as SEQ ID No. 1.

Furthermore, the invention also provides an expression vector containing the promoter. Wherein the expression vector is preferably a microbial expression vector, more preferably a vector such as E.coli or P.fluorescens.

Further, the invention also provides a transformant of the expression vector, wherein the transformant is escherichia coli.

Another object of the present invention is to provide the use of the above promoter in the preparation of transgenic microorganisms.

Another object of the present invention is to provide the use of the above expression vector in the preparation of a transgenic microorganism, wherein the transgenic microorganism is Escherichia coli or Pseudomonas fluorescens.

It is still another object of the present invention to provide a method for preparing a transgenic microorganism using the promoter, comprising the steps of:

(1) constructing a promoter with a sequence shown as SEQ ID No. 1;

(2) operably inserting the promoter into an expression vector to construct a microbial expression vector;

(3) and (3) transforming the microbial expression vector obtained in the step (2) into a host to obtain the transgenic microbe.

In the invention, a gene engineering method is adopted, and the promoter is inserted into a proper expression vector to obtain a microbial expression vector containing the promoter.

The transformant of the present invention can be obtained by transforming an appropriate host with the above-mentioned microbial expression vector. Specifically, an expression vector containing a promoter is transformed into a target microorganism by an electric shock method to obtain a transformant, namely a transgenic microorganism.

The promoter and the reporter gene are used for constructing an expression vector, and the expression vector is transformed into a host to obtain a transformant containing the promoter. The transgenic host is preferably Pseudomonas fluorescens or Escherichia coli.

A preferred expression vector is the commercial broad host expression vector pBBR1 MCS-5.

The invention provides a method for expressing a target gene by pseudomonas fluorescens under low-temperature induction, which is characterized in that the target gene is inserted into a recombinant vector containing a promoter, the recombinant vector is introduced into the pseudomonas fluorescens, and the expression of the target gene is induced under the condition of low temperature (4-15 ℃).

The invention provides a method for expressing a target gene by pseudomonas fluorescens under the induction of a signal molecule 3-oxo-C8-HSL, which is characterized in that the target gene is inserted into a recombinant vector containing a promoter, the recombinant vector is introduced into the pseudomonas fluorescens, and the expression of the target gene is induced under the condition of adding a certain concentration of the signal molecule.

The invention also provides an application of the recombinant vector containing the promoter in researching the biological function of the specific protein in the pseudomonas fluorescens.

Compared with the prior art, the promoter provided by the invention has the characteristics of low temperature, low cell density and strong inducible expression and controllability of inducible expression, greatly reduces the formation of protein inclusion bodies, obviously improves the protein stability and the protein expression efficiency, and provides a new method for researching the biological function of specific protein.

Compared with the prior art, the invention has the following advantages and beneficial effects:

1. the promoter can specifically drive the downstream target gene to express under the induction of low temperature or signal molecule 3-oxo-C8-HSL, and has the specificity of inducible expression.

2. The promoter can start host cells with low cell density to express a large amount of exogenous target protein under the induction of low temperature and/or signal molecules. The low-temperature and/or QS inducible promoter provided by the invention can control protein expression, can be applied to production of related proteins in the fields of food, medicine and the like, and also provides a new method for researching the biological function of specific protein.

Drawings

FIG. 1 is a PCR electrophoretic map of the low temperature/QS dual inducible promoter pWFF 1028;

FIG. 2 is a map of a recombinant vector;

FIG. 3 is a graph showing the results of GFP intensity under different temperature conditions;

FIG. 4 is a graph showing the results of GFP intensity at different signal molecule concentrations;

Detailed Description

The method of the present invention is described in detail below with reference to the drawings, but the following description is intended to be illustrative, and not to limit the scope of the invention. The test materials used in the test methods in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Example 1: determination of sequence of Low temperature and/or QS inducible promoter pWFF1028

1. Pseudomonas fluorescens PF08 was inoculated into LB broth and cultured at 4 ℃ and 30 ℃ respectively, total Pseudomonas fluorescens PF08 total RNAs cultured at 4 ℃ and 30 ℃ to the early logarithmic phase and the late logarithmic phase were extracted with E.Z.N.A. Total RNA Kit (OMEGA), respectively, and the extracted RNAs were tested for purity using a Nanodrop ultramicro nucleic acid protein analyzer. The OD meets the library building requirement through determination. The pseudomonas fluorescens PF08 is preserved in China center for type culture Collection, and the preservation number is as follows: CCTCC AB 2019272, address: eight-path Lojia mountain in Wuchang district, Wuhan city, Hubei province, preservation date: year 2019, month 07, day 17.

2. Taking the total RNA extracted in the step 1,

II Q RT SuperMix (+ gDNA wrapper) (Vazyme) Kit is used for reverse transcription to obtain cDNA, an Illumina Truseq RNA sample prep Kit reagent is used for constructing a library, and prokaryotic strand specific transcriptome sequencing is carried out.

3. And (3) obtaining a gene norD which simultaneously meets the requirement of obviously increasing the expression level under low temperature and high density according to the transcriptome sequencing result of the step (2), and obtaining a 2000bp sequence of the upstream 5' -non-coding region of the gene according to a genome database of pseudomonas fluorescens PF 08. The highest-scoring 107bp promoter sequence pWFF1028 was obtained using promoter prediction software.

Example 2: separation of pWFF1028 promoter sequence and construction of recombinant expression vector

1. Designing the enzyme cutting sites of the primers according to the characteristics of the selected vector pBBR1MCS-5, wherein the upstream primer (5'-CTATAGGGCGAATTGGAGCTCcaatccccaagagggcggc-3') has SacI enzyme cutting sites: GAGCTC, downstream primer (5'-GGTACCGGGCCCCCCCTCGAGgccagacactgccgac-3') with XhoI cleavage site: CTCGAG, a primer synthesized by Biotechnology engineering (Shanghai) GmbH.

2. Extracting pseudomonas fluorescens PF08 DNA as a template, and carrying out PCR amplification on a promoter according to the primer designed in the step 1, wherein the PCR reaction system is as follows: 1 mu L of DNA template; 1 mu L of upstream primer; 1 mu L of downstream primer; dNTP4 μ L; 5 Xpfu buffer 10. mu.L; pfu Enzyme 1. mu.L; ddH₂O32. mu.L. The PCR reaction program is: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 2min, and 30 cycles; extending for 10min at 72 ℃, and keeping the temperature at 4 ℃.

3. The PCR results of step 2 were verified by electrophoresis on a 1.0% agarose gel, as shown in FIG. 1. The 107bp band is the target band, and the sequence is shown as SEQ ID NO: 1 is shown as pWFF1028 promoter.

4. The promoter fragment verified the success of PCR in Step 3 was ligated into the vector pBBR1MCS-5 using the Clon express Multi One Step Cloning Kit, and the map of the recombinant vector is shown in FIG. 2. The reaction system is as follows: 5 × CE Multis buffer 4 μ L; cloning 50-200 ng of a vector; 20-200 ng of DNA amplified fragment; 2 μ L of Exnase Multis; ddH₂O was added to 20. mu.L of the total. The reaction solution was mixed well and reacted at 37 ℃ for 30 min. After the reaction was completed, the reaction tube was immediately placed in an ice-water bath to cool for 5min and stored at-20 ℃ for further use.

Example 3: functional verification of pWFF1028 promoter

1. Enhanced Green Fluorescent Protein (EGFP) is used as a reporter gene, the recombinant expression vector is digested by XbaI and SacI endonuclease, and an EGFP fragment is connected with a pWFF1028 promoter of the recombinant expression vector by using Clon express multiple One Step Cloning Kit to obtain a recombinant expression vector pWFF1028:: EGFP. The reaction system is as follows: 5 × CE Multis buffer 4 μ L; cloning 50-200 ng of a vector; 20-200 ng of DNA amplified fragment; 2 μ L of Exnase Multis;ddH₂o was added to 20. mu.L of the total. The reaction solution was mixed well and reacted at 37 ℃ for 30 min. After the reaction was completed, the reaction tube was immediately placed in an ice-water bath to cool for 5min and stored at-20 ℃ for further use.

2. Transforming the recombinant vector constructed in the step 1 into an E.coli WM3064 competent cell under the following transformation conditions: adding 5 μ L of the reaction solution obtained in step 2 into 100 μ L of E.coli WM3064 competent cells, standing on ice for 30min, heat-shocking at 42 deg.C for 45s, and ice-water bathing for 2 min; adding 1mL of LB culture medium, and shaking the bacteria at 37 ℃ for 1 h; 100. mu.L of the bacterial suspension was applied to a gentamicin-containing plate and cultured overnight at 37 ℃.

3. E.coli WM3064 transformed with the recombinant plasmid in the step 2 is jointed with pseudomonas fluorescens PF08 to obtain a recombinant bacterium,

4. and (3) inoculating the recombinant bacteria obtained in the step (3) into LB broth containing gentamicin, performing shake culture at 25 ℃ and 4 ℃ respectively, absorbing 200 mu L of bacteria liquid into a 96-hole enzyme label plate after the bacteria liquid grows to the middle and later logarithmic phase, and performing EGFP fluorescence detection by using SpectraMax i3x, wherein the excitation wavelength is 485nm, and the absorption wavelength is 535 nm. According to the fluorescence intensity, compared with 25 ℃, the expression quantity of EGFP at 4 ℃ is improved by 18.74 times (as shown in figure 3), which indicates that the pWFF1028 promoter can highly induce the expression of EGFP gene under low-temperature stress, and ensures the activity of the EGFP gene.

5. And (3) inoculating the recombinant bacteria obtained in the step (3) into LB broth containing gentamicin, culturing at 4 ℃ until OD600 is 0.3, adding 3-oxo-C8-HSL with final concentration of 0, 10, 50 and 100 mu M, continuing culturing for 3h, then sucking 200 mu L of bacterial liquid into a 96-well enzyme label plate, and carrying out EGFP detection by using SpectraMax i3x, wherein the wavelength of excitation light is 485nm and the absorption wavelength is 535 nm. As shown in FIG. 4, compared with the control group, the expression level of EGFP increases with the increase of the concentration of the signal molecule 3-oxo-C8-HSL, and under the induction of 100 mu M3-oxo-C8-HSL, the expression level of EGFP reaches the middle and later logarithmic level, thereby greatly shortening the culture time.

From the above results, it can be seen that the promoter of the present invention can promote the expression of a large amount of exogenous target protein in host cells with low cell density under the induction of low temperature and/or signal molecules. The low-temperature and/or QS inducible promoter provided by the invention can control protein expression, can be applied to production of related proteins in the fields of food, medicine and the like, and also provides a new method for researching the biological function of specific protein.

Sequence listing

<110> Zhejiang university of industry and commerce

<120> expression vector containing low-temperature and QS dual inducible promoter and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 107

<212> DNA

<213> Pseudomonas fluorescens (P. fluoroscens)

<400> 1

caatccccaa gagggcggcc cggcaggttc tgcgggccgt tttacgtctg gagcacttca 60

catggccttt acccttgagt tggaagagtg ggtcggcagt gtctggc 107

Claims (4)

1. An expression vector containing a low-temperature and QS dual inducible promoter is characterized in that the base sequence of the promoter is shown in a sequence table SEQ ID NO. 1.

2. Use of the expression vector of claim 1 in the preparation of a transgenic microorganism.

3. Use according to claim 2, characterized in that: the transgenic microorganism is escherichia coli or pseudomonas fluorescens.

4. A method for producing a transgenic microorganism using the expression vector of claim 1, characterized in that: the method comprises the following steps:

(1) constructing a promoter with a sequence shown as SEQ ID No. 1;

(2) operably inserting the promoter into an expression vector to construct a microbial expression vector;

(3) and (3) transforming the microbial expression vector obtained in the step (2) into a host to obtain the transgenic microbe.

Images