CN111879941B

CN111879941B - Protein behavior detection system based on self-assembly nano-pores and preparation and use methods thereof

Info

Publication number: CN111879941B
Application number: CN202010623610.2A
Authority: CN
Inventors: 张�成; 杨静; 赵楠
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2020-06-29
Filing date: 2020-06-29
Publication date: 2021-11-02
Anticipated expiration: 2040-06-29
Also published as: CN111879941A

Abstract

The invention belongs to the technical field of nanopore detection, and particularly discloses a protein behavior detection system based on self-assembled nanopores and a preparation and use method thereof. The protein behavior detection system based on the self-assembly nano-pores is used by combining a solid nano-pore monomolecular sensor and consists of a linear DNA long double-chain and a DNA tetrahedron fixed on the linear DNA long double-chain; the interior of the DNA tetrahedron is matched with the target protein, and the binding position of the target protein in the structure of the DNA tetrahedron can be manually adjusted. The invention also provides a preparation method and a using method of the system. The system can analyze the spatial position and the via hole direction of the protein molecule via hole by electric signals, and further can control the spatial direction of the protein.

Description

Protein behavior detection system based on self-assembly nano-pores and preparation and use methods thereof

Technical Field

The invention belongs to the technical field of nanopore detection, and particularly relates to a protein behavior detection system based on self-assembled nanopores and a preparation and use method thereof.

Background

Nanopore is a versatile technique for detecting and characterizing individual molecules in a solution. Nanopores are mainly classified into biological nanopores and solid-state nanopores. For biological nanopores, the most common are biological protein nanopores, such as α -hemolysin (α -HL). Early biological nanopores are mainly used for detecting nucleic acids, but the biological protein nanopores have low spatial and temporal resolution and are insufficient in the aspects of stability, durability and the like, and solid-state nanopores are produced at the same time. The solid-state nanopore belongs to an artificial nanopore, has controllable size, better stability and more sensitivity, can be repeatedly utilized, and is an ideal tool for detecting protein molecules.

Compared with other traditional single molecule detection technologies, the nanopore single molecule sensor has the advantages of low cost and high flux. When a charged biomolecule passes through a nanopore in an electrophoresis mode under the action of an external electric field force, due to the physical occupation effect and the strong interaction between the charged biomolecule and the wall of the nanopore, an ion current can change instantly and is represented as short-time peaks, each peak corresponds to a translocation event, and the characteristics of the charged characteristic, the shape and the size, the movement behavior and the like of the molecule to be detected can be obtained through analysis of current change and translocation time. Therefore, nanopores are widely used in the detection of single molecules, such as nucleic acid molecules, proteins, nucleic acid-protein conjugates, etc., and even in the recognition of single DNA bases and protein amino acids.

Because the charged states, orientations, secondary structures, etc. of nucleic acid molecules and protein molecules generate different modulation currents, it is very challenging to realize high-precision detection of nucleic acid molecules and protein molecules. Currently, researchers have been able to detect the presence of protein molecules through nanopores and to distinguish between different species of protein molecules, as well as different morphologies of the same protein, such as a folded state and an unfolded state. When the conjugate of nucleic acid and protein passes through the pore, the amount of protein bound to the nucleic acid can be analyzed. However, until now, there has been no accurate study and determination about the specific form of protein passing through the nanopore, because the protein is a spatial three-dimensional structure, and it cannot be determined whether the protein is deformed or not during passing through the nanopore, and the present invention is to solve this problem.

Disclosure of Invention

The invention provides a protein behavior detection system based on self-assembly nanopores and a preparation and use method thereof, aiming at analyzing specific actions including deformation, space rotation and the like when protein molecules pass through the pores.

The protein behavior detection system based on the self-assembly nano-pores is used by combining a solid nano-pore monomolecular sensor and consists of a linear DNA long double-chain and a DNA tetrahedron fixed on the linear DNA long double-chain; the interior of the DNA tetrahedron is matched with the target protein, and the binding position of the target protein in the structure of the DNA tetrahedron can be manually adjusted.

The protein behavior detection system based on the self-assembly nano-pores takes a DNA self-assembly tetrahedral structure as a nucleic acid carrier of protein, and carries target protein with through holes by combining target protein aptamers in DNA tetrahedron with the target protein. Because the DNA tetrahedron is fixed on the linear DNA long double-strand, the position of the DNA tetrahedron can not be changed and rotated freely, and the position of the target protein combined on the target protein aptamer in the DNA tetrahedron is fixed and can not swing freely. The whole structure is pulled through the solid-state nanopore by the linear DNA long double strand, so that the structure can longitudinally rotate by taking the linear DNA long double strand as an axis, but cannot transversely rotate. According to the previous research results, the direction of the double-stranded via hole is easily distinguished, so that the direction of the whole conjugate via hole can be determined, and further the direction of the target protein via hole can be determined. When designing a DNA tetrahedron, the position of the aptamer can be mobilized, so that the combination position and direction of the target protein in the nucleic acid tetrahedron can be changed, and the direction and the form of the protein via hole can be accurately distinguished according to the difference of electric signals of experimental results. Furthermore, the method can realize the accurate control of the via hole direction of the protein molecules and has wide application prospect.

The length of the long double strand of DNA is preferably such that it pulls the DNA tetrahedron through the solid state nanopore.

When the target protein is thrombin, the nucleotide sequences of four DNA single strands forming the DNA tetrahedron are respectively shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6;

SEQ ID NO.3 is:

SEQ ID NO.4 is:

SEQ ID No.5 is:

SEQ ID NO.6 is:

when the target protein is streptavidin, the nucleotide sequences of four DNA single strands forming the DNA tetrahedron are respectively shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.205 and SEQ ID NO. 206;

SEQ ID No.205 is:

AAAGGCAGTTGAGACGAACATTCCTAAGTCTGAACTATCCGATTATTTATCAGCGTGCATAGTAGCTGAATCGTTACGTAACATCAGTAAGGTTTTT-biotin；

SEQ ID No.206 is:

TCGATCTAGCTCGAAATCGGATAGTTCAGACTTAGGAATGTTCGACATGCGAGGGTCTAATAGCTACAACTCGTTACGATTAGAGCTTGCTACTTTT-biotin。

the method for preparing the protein behavior detection system based on the self-assembled nanopore comprises the following steps:

1) designing four DNA single strands according to the size and the adaptive sites of the target protein, combining the four DNA single strands into a DNA tetrahedron through base complementary pairing, and fixing the DNA tetrahedron on the linear DNA long double strand through base complementary; requiring that the target protein is combined with a target protein aptamer in a DNA tetrahedron through the adaptation site, and the adaptation position is in the interior of the DNA tetrahedron;

2) synthesizing four designed DNA single strands, and annealing to form a DNA tetrahedron;

3) DNA tetrahedrons are fixed on linear DNA long double strands by base complementarity.

Preferably, the DNA tetrahedron is formed by annealing four DNA single strands designed to be mixed in a ratio of 1: 1.

Specifically, in application, the DNA tetrahedron can be bound to the target protein first, and then the DNA tetrahedron is fixed on the linear DNA long double strand by base complementation, preferably at any position except one half of the long double strand.

Since the half position cannot be distinguished from the front and back, the tetrahedron is fixed at any position except the half position of the long double-stranded chain.

Alternatively, the DNA tetrahedron can be bound to the linear DNA long duplex before binding to the target protein.

Preferably, for ease of synthesis and formation of a double strand that is more stable than single-stranded DNA, the linear DNA long double strand may be synthesized by taking one single-stranded DNA molecule as a backbone strand and then designing multiple short single strands (stapled strands) for complementary pairing therewith. Before synthesizing the double-stranded DNA, the position of the DNA tetrahedron to be combined is determined, then the staple chain at the combining position is removed, and then the double-stranded DNA synthesis is carried out, so that the obtained DNA double-stranded DNA has a gap of the DNA tetrahedron to be combined, and the DNA tetrahedron can be combined in the subsequent step.

The linear DNA long double strand can also be synthesized by other means by those skilled in the art, as long as it is ensured that it can tetrahedrally bind to DNA.

The method for using the protein behavior detection system based on the self-assembled nanopore comprises the following steps:

A. designing a plurality of self-assembly nanopore-based protein behavior detection systems with different adaptation rear directions of target protein in a DNA tetrahedron, and respectively mixing the target protein with the target protein in a solution, wherein the preferable molar ratio of the DNA tetrahedron to the target protein is 1: 20 to obtain a plurality of tetrahedron-protein combinations with different target protein directions fixed on a linear DNA long double chain;

B. and adding a solid-state nano-pore single-molecule sensor for via hole passing, and identifying, training and classifying the captured current signals by using a machine learning algorithm to distinguish the behaviors of the target proteins in different via hole directions.

In the invention, when the tetrahedron-protein combination is prepared in the step A, the DNA tetrahedron is combined with the target protein, and then the DNA tetrahedron is fixed on the linear DNA long double-chain through base complementation.

Preferably, the immobilization position of the target protein on the long double strand of linear DNA is a position other than one-half of the long double strand of linear DNA.

The invention also provides application of the protein behavior detection system based on the self-assembled nanopore in detecting protein molecules.

The invention also provides application of the protein behavior detection system based on the self-assembled nanopore in controlling the protein space direction.

The invention has the advantages that a novel detection mechanism of the DNA carrying protein via hole is developed, the protein carrier is a regular tetrahedron structure formed by four DNA single chains in complementary pairing, protein molecules are combined in the tetrahedron, and the whole structure is drawn by a longer DNA double chain via hole. In this configuration, the binding site of the protein molecule can be arbitrarily changed to pass through the nanopore in different spatial directions. The structure has good applicability to protein molecules except thrombin, and only the aptamer in the structure is replaced by the aptamer corresponding to the protein to be detected. Through the protein via hole mode, the spatial position and the via hole direction of the protein molecule via hole can be analyzed through electric signals. Namely, the tetrahedral structure designed by the invention can control the space direction of the protein, which is a breakthrough of nanopore detection protein molecules.

The experimental result proves that the mechanism of the DNA tetrahedron carried protein molecule via hole is feasible, and the DNA tetrahedron carried protein molecule via hole has wider application prospect in the medical fields of molecular sensing, disease monitoring and the like.

Drawings

FIG. 1 is a schematic diagram showing the structure of a DNA tetrahedron in example 1 of the present invention.

FIG. 2 is a schematic view showing the structure of a tetrahedron-thrombin conjugate in example 1 of the present invention;

wherein, 1 is a DNA tetrahedron, 2 is an aptamer, 3 is thrombin, and 4 is an aptamer site.

FIG. 3 is a schematic representation of the vias of the tetrahedron-thrombin conjugate of example 2 of the present invention.

FIG. 4 is a signal trace diagram of a sample via in example 2 of the present invention, wherein the left diagram is a signal trace diagram of a via with only DNA tetrahedral structure (no thrombin bound) in example 1; the right panel is a schematic signal trace of the tetrahedral-thrombin conjugate pore formed in example 1.

FIG. 5 is a schematic diagram showing the structure in which the tetrahedron-thrombin conjugate is immobilized on a quarter of a long double strand of linear DNA in example 3 of the present invention.

FIG. 6 is a schematic view showing the structure in which a tetrahedron-thrombin conjugate is immobilized on one half of a long double strand of linear DNA in example 3 of the present invention.

FIG. 7 is a schematic representation of the via of the tetrahedral-thrombin conjugate immobilized on a long duplex of linear DNA in example 3 of the present invention.

FIG. 8 is a schematic diagram showing the signal traces of the sample vias in which tetrahedron-thrombin conjugates are immobilized at different positions on a long double strand of linear DNA according to example 3 of the present invention; fig. 8A and 8B are schematic diagrams of current signal traces corresponding to the samples fixed at the quarter positions; fig. 8C is a schematic diagram of a current signal trace corresponding to a sample fixed at one-half.

FIG. 9 is a schematic representation of the structure of the first sample tetrahedron-thrombin conjugate of example 4 of the present invention.

FIG. 10 is a schematic representation of the structure of a second sample tetrahedron-thrombin conjugate of example 4 of the present invention.

FIG. 11 is a photograph showing the results of experiments observed on PAGE gels after incubation with thrombin at different ratios in the same concentration of DNA tetrahedron solution in example 1 of the present invention.

Fig. 12 shows the classification results of the current signals of different via holes in embodiment 4 of the present invention.

Fig. 13 shows the classification results of the current signals of different via holes in the embodiment 5 of the present invention.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Preparation of Experimental materials

(1) All DNA strands were designed and simulated by NUPACK software.

(2) All designed DNA strands were purchased from Shanghai workers.

(3) Thrombin (Thrombin) used for the experiments and various other proteins were purchased from Solebao.

(4) All DNA strands were dissolved in experimental water and the concentration was determined with a Nanodrop 2000 instrument.

(5) The nanometer hole is a solid silicon nitride nanometer hole with the thickness of 30nm, and is perforated by an ion beam electron microscope, and the diameter of the perforation is 15 nm.

(6) DNA tetrahedron preparation at 1 XTAE/Mg²⁺In buffer (40mM Tris, 20mM acetic acid, 2mM EDTA, and 12.5mM magnesium acetate, final pH 8.0).

(7) The nanopore chamber buffer was a 1M potassium chloride (KCl) solution (11.182 g of potassium chloride was weighed out and dissolved in 50mL of water at 37 ℃).

(8) Polyacrylamide gel electrophoresis (PAGE) the mother liquor used for the experiment was a 45% PAGE solution (217 g acrylamide and 8g methylenebisacrylamide were weighed and dissolved at 37 ℃ and deionized water was added to make a volume of 500 mL).

Polyacrylamide gel electrophoresis (PAGE) experimental detection: 12% PAGE gels (12ml distilled water, 6ml 45% PAGE solution, 150ul 10% Ammonium Persulfate (APS) solution, 15ul Tetramethylethylenediamine (TEMED) solution) were prepared.

And (3) nano-pore experiment detection:

an experimental instrument: nanopore devices, patch-clamp amplifiers.

EXAMPLE 1 formation of DNA tetrahedron and Thrombin (protein of interest) conjugates

To investigate whether thrombin can enter the interior of the DNA tetrahedron and stably bind thereto, PAGE experiments were used for visual demonstration.

Thrombin has a spatial diameter of about 4nm, and has two aptamer binding sites of T-29 and T-15. The four DNA single-stranded nucleotide sequences of the DNA tetrahedron designed for thrombin are shown in Table 1. TET-S1, TET-S2, TET-S3, TET-S4 are four DNA strands that generate a tetrahedral structure, which is unable to bind any protein inside (no aptamer to the target protein); TET-S1 and TET-S2 were replaced by TET-S1-IN and TET-S2-IN (containing aptamers) for thrombin, so that the tetrahedron generated by TET-S1-IN, TET-S2-IN, TET-S3, TET-S4 could bind thrombin.

TABLE 1 design of four DNA Single-stranded nucleotide sequences of DNA tetrahedron for Thrombin

The four DNA single strands are joined into DNA tetrahedra (TET-S3, TET-S4, TET-S1-IN, TET-S2-IN) by base complementary pairing, wherein the ends of the two single strands TET-S1-IN and TET-S2-IN each contain an aptamer to thrombin. Firstly, four DNA single-strands are mixed in a ratio of 1: 1 for annealing, the mixture is maintained at 94 ℃ for 4 minutes, and then the temperature is reduced to room temperature (25 ℃) at a constant speed within 5 minutes to form a DNA tetrahedron, and the structure of the DNA tetrahedron is shown in figure 1, so that a DNA tetrahedron solution is obtained. In the formed DNA tetrahedron 1, the two aptamers 2 are positioned at two opposite sides and are separated by 4.5nm, and the space diameter of thrombin is about 4nm and can be combined just, the structure of the obtained tetrahedron-thrombin combination body is shown in figure 2, after the thrombin 3 is combined with the aptamers 2 through the adaptation sites 4, the adaptation positions of the thrombin 3 are inside the DNA tetrahedron 1.

Different molar ratios of thrombin were added to the same concentration of DNA tetrahedral solution and incubated for 1 hour at room temperature, and the results of the experiment were observed on PAGE gels, as shown in FIG. 11.

The experimental results demonstrate that the sample added with thrombin forms a bond of DNA tetrahedron and thrombin, and the more thrombin, the more bond is formed, up to complete bonding. It was shown that the DNA tetrahedron formation of this example was very good.

Example 2 DNA tetrahedron Individual Via and tetrahedron-Thrombin conjugate Via

The same nanopore was used to perform the detection of two samples, one sample being the DNA tetrahedral structure of example 1 only (consisting of TET-S3, TET-S4, TET-S1-IN, TET-S2-IN) and the other sample being the tetrahedral-thrombin conjugate formed IN example 1. The two samples prepared firstly ensure the same concentration, both are 2nM, the nanopore device is cleaned by water, air bubbles in the device are discharged by ethanol, and finally the samples are rinsed by 1M KCl buffer solution, then the samples are added into the Cis-potential end chamber (Cis) of the nanopore device, the moving direction of the samples is shown by an arrow in figure 3, under the action of an external voltage, the sample structure can pass through the nanopore from the Cis-potential end chamber to the Trans-potential end chamber (Trans), and the track of a signal can be clearly seen by a patch clamp amplifier, which is shown in figure 4. The process of the structural via hole is easily analyzed according to the signal trace, and the current level when the structural via hole is absent is called level 0 in the embodiment. The current drop occurs when the DNA tetrahedron or tetrahedron-thrombin conjugate passes through the pore, the current level is level1, and the current level returns to level 0 after the DNA tetrahedron or tetrahedron-thrombin conjugate passes through the nanopore. The two sample traces were analyzed by the MATLAB program in terms of both blocking current and via time, and from the analysis results, it can be seen that the blocking current is higher in the vias of the structure carrying thrombin, i.e., the level of level1 with thrombin (see the right-hand graph in FIG. 4) is lower than the level of level1 without thrombin (see the left-hand graph in FIG. 4). This feature clearly distinguishes whether the structure of the via carries thrombin or not, and also demonstrates that the presence of thrombin can be detected using a nanopore of 15 nm.

Example 3 sample vias with DNA tetrahedra fixed in different positions on long double strands of linear DNA

In the embodiment, the linear DNA long double strand is prepared by using cut m13mp18 as a raw material, m13mp18 is a circular single-stranded DNA molecule with the length of 7249 nucleotides, a recognition SITE of endonuclease is formed by complementing a short chain (SITE, shown as SEQ ID NO. 7), and then the single-stranded DNA molecule is formed by cutting with the endonuclease (the framework chain Lm13, shown as SEQ ID NO. 8). Then, the backbone chain Lm13 was complementarily paired with a plurality of short single strands (stapled strands) to synthesize a linear double-stranded DNA. This example uses 190 stapled strands (1L-190L, see Table 2 for sequence), before synthesizing double strands, the position where DNA tetrahedron is to be bound is determined, two stapled strands at the binding position are removed, the resulting gap is left for binding of DNA tetrahedron, and the rest of stapled strands are all complementary to the backbone strand Lm13 to synthesize double strands. In this example, when the DNA tetrahedron is bound at the quarter position, the two stapled strands 47L and 48L are removed to form a linear DNA long double strand for use. The two stapled 95L and 96L strands are removed when the DNA tetrahedron is half-bound to form a linear DNA long duplex ready for use.

TABLE 2

The specific operation process of fixing the DNA tetrahedron on the long chain is that enzyme cutting is carried out firstly, the circular DNA is made into linear DNA, the base sequence of the tetrahedron is properly adjusted according to the bases of different preset connection positions of the linear DNA, the two tetrahedrons can be complemented, and the DNA tetrahedron is fixed on the skeleton chain of the long double chain by utilizing base complementary pairing.

To verify that the additional spike generated by the transient drop IN current is due to the via hole of the tetrahedron-thrombin conjugate, this example changed the position of the DNA tetrahedron fixed on the linear DNA long duplex, one of which was fixed IN one quarter of the backbone single strand IN the linear DNA long duplex (see FIG. 5), for which TET-S3, TET-S4 IN the four sequences constituting the DNA tetrahedron IN example 1 were adjusted to TET-S3-quartz, TET-S4-quartz (see Table 3 for specific sequences), and the DNA tetrahedron (consisting of the sequences TET-S1-IN, TET-S2-IN, TET-S3-quartz, TET-S4-quartz) was formed IN the same manner as IN example 1 and then combined with the corresponding linear DNA long duplex. The other was fixed at an intermediate position (see FIG. 6), for which TET-S3, TET-S4 among the four sequences constituting the DNA tetrahedron IN example 1 were adjusted to TET-S3-half, TET-S4-half (see Table 3 for specific sequences), and the binding structure of the DNA tetrahedron (consisting of the sequences TET-S1-IN, TET-S2-IN, TET-S3-half, TET-S4-half) with thrombin was formed IN the same manner as IN example 1 and then combined with the corresponding linear DNA long duplex.

The tetrahedral-thrombin conjugate samples fixed on the linear DNA long double strand at two positions were separately punched. The subsequent nanopore detection procedure was the same as described in example 2 above, with the direction of movement of the sample indicated by the arrow in fig. 7.

TABLE 3

The current signals corresponding to the two samples of the embodiment in which the tetrahedron-thrombin combination is fixed at different positions on the long double-strand will generate a two-stage drop, the schematic diagram of the current signal trajectory is shown in fig. 8, the current level when no structural via hole is formed is level 0, the current drop is generated only when the double-strand via hole is formed, at this time, the current level is level1, and when the tetrahedron-thrombin combination is via hole, an additional current drop is generated, at this time, the current level is level 2.

The current traces observed for the two samples are different, and the current signal traces corresponding to the samples with the tetrahedron-thrombin conjugates fixed at one quarter are schematically shown in FIGS. 8A and 8B, and the additional falling peaks generated by the two samples are respectively at one quarter (shown in FIG. 8A) and three quarters (shown in FIG. 8B) of the level1 blocking current, because the double-stranded DNA has two via directions, which may be a short first via or a long first via; the tetrahedron is fixed at the current signal corresponding to the sample at the middle position, and the extra falling peak generated by the tetrahedron is positioned at the middle position of the level1 blocking current (as shown in FIG. 8C). According to the data analysis results of MATLAB, the via time and the blocking current for both samples were substantially the same. This result indicates that the electrical signal spikes appear due to tetrahedral and protein vias.

Example 4 protein molecules were passed through the pores in different orientations

IN order to detect the signal difference of the protein molecules passing through the holes IN different directions, this example changed the positions of the aptamers IN the tetrahedron based on the tetrahedron-thrombin conjugate of example 2, the first sample was one of the aptamers moved upward along the edge of the tetrahedron to rotate the protein molecules by a certain angle, the structure of the adjusted tetrahedron-thrombin conjugate is schematically shown IN FIG. 9, and the DNA tetrahedral sequences of the tetrahedron are TET-S3, TET-S4, TET-S1-IN, TET-S2-IN 2; the second sample is another aptamer moving along the edge to rotate the protein molecule, the structure of the adjusted tetrahedron-thrombin conjugate is schematically shown IN FIG. 10, and the DNA tetrahedron sequences of the conjugate are TET-S3, TET-S4, TET-S1-IN2 and TET-S2-IN; the last sample (third sample) was an aptamer position invariant tetrahedron-thrombin conjugate of example 2, see in particular FIG. 2. The sequences of TET-S1-IN2 and TET-S2-IN2 are shown IN Table 4.

TABLE 4 Single-stranded nucleotide sequences designed for the modulation of aptamer position

The tetrahedron-thrombin conjugate of this example was designed to be immobilized in one quarter of the linear DNA duplex of example 3, and TET-S3, TET-S4 were adjusted to TET-S3-quater, TET-S4-quater of example 3, respectively, so that under the pull of the linear DNA duplex formed by the m13mp18 single strand, three samples would yield six via orientations, but as a result of the previous step (example 3), the two opposite orientations of the same sample are easily distinguished by the location of the additional spike. Therefore, this embodiment mainly distinguishes different samples with smaller rotation angles of the target protein.

The signal tracks of the three samples passing through the nanopore device are analyzed by an MATLAB program, and according to the result obtained by analyzing MATLAB data, if only two parameters of the blocking current and the via hole time are analyzed, the three samples are not greatly different, then the current signals corresponding to the three samples can be obviously distinguished by identifying, training and classifying the captured current signals by using a machine learning algorithm, and the classification result is as shown in FIG. 12. The enclosed parts of the three ellipses (1, 2, 3) in the figure correspond to the via events of the first sample, the second sample and the third sample, and as can be seen from the figure, the three samples can be well distinguished. The mean amplitude and peak width of the third sample were minimal, indicating that the amplitude and peak width increased to different extents when the thrombin position in the third sample was changed.

Example 5 DNA tetrahedra and different protein binding Via

In order to prove that the tetrahedral structure vector has good applicability, the present example replaces different protein aptamers, such as streptavidin, etc., inside the DNA tetrahedron by adjusting the nucleotide sequence, and repeats the above research process, all with similar results. Therefore, the method for researching the protein via behavior by carrying out the via hole on the tetrahedron protein molecules is proved to be reliable and effective.

For streptavidin, binding was achieved by avidin (biotin) modifications at the ends of the sequence, and the information on the altered tetrahedral sequence capable of binding streptavidin is shown in Table 5, with the other sequences (TET-S3, TET-S4, TET-S3-quartz, TET-S4-quartz) as above. That is, the DNA tetrahedral sequence that can bind streptavidin is: TET-S1-SA, TET-S2-SA, TET-S3, TET-S4. The first sample four DNA tetrahedral sequence that can bind streptavidin and can be ligated in one quarter of the long double strand of linear DNA of example 3 is: TET-S3-quater, TET-S4-quater, TET-S1-SA, TET-S2-SA 2; the four DNA tetrahedral sequences for the second sample are: TET-S3-quater, TET-S4-quater, TET-S1-SA2, TET-S2-SA; the fourth DNA tetrahedral sequence of the third sample is: TET-S3-quater, TET-S4-quater, TET-S1-SA, TET-S2-SA. The signal traces of three samples of this example through the nanopore device were analyzed with the MATLAB program (see example 4) and the results of the classification are shown in fig. 13. From the figure it is clear that the samples can be well distinguished.

TABLE 5

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Claims

1. A protein behavior detection system based on self-assembly nano-pores is used by combining a solid-state nano-pore single-molecule sensor, and is characterized in that the detection system is composed of a linear DNA long double-chain and a DNA tetrahedron fixed on the linear DNA long double-chain; the interior of the DNA tetrahedron is matched with a target protein, the binding position of the target protein in the structure of the DNA tetrahedron can be manually adjusted, and the fixed position of the target protein on the linear DNA long double-strand is a position beyond one half of the linear DNA long double-strand.

2. The self-assembled nanopore based protein behavior detection system as claimed in claim 1, wherein when the target protein is thrombin, the nucleotide sequences of the four DNA single strands constituting the DNA tetrahedron are shown as SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, respectively;

SEQ ID NO.3 is:

GCTGATAAAACGAGCTAGATCGAGTAGCAAGCTCTAATCGACGGGAAGAGCATGCTCATCCAGTGTCATACAAACGATTCAGCTACTATGCAC；

SEQ ID NO.4 is:

AGCATGCTCTTCCCGAAACGAGTTGTAGCTATTAGACCCTCGCATGACTCAACTGCCTTTACCTTACTGATGTTACGAGTATGACACTGGATG；

SEQ ID No.5 is:

AAAGGCAGTTGAGACGAACATTCCTAAGTCTGAACTATCCGATTATTTATCAGCGTGCATAGTAGCTGAATCGTTACGTAACATCAGTAAGGTTTTTAGTCCGTGGTAGGGCAGGTTGGGGTGACT；

SEQ ID NO.6 is:

TCGATCTAGCTCGAAATCGGATAGTTCAGACTTAGGAATGTTCGACATGCGAGGGTCTAATAGCTACAACTCGTTACGATTAGAGCTTGCTACTTTTGGTTGGTGTGGTTGG；

SEQ ID No.205 is:

SEQ ID No.206 is:

3. a method of preparing the self-assembled nanopore based protein behavior detection system of claim 1 or 2, comprising the steps of:

4. A method of using the self-assembled nanopore based protein behavior detection system of claim 1 or 2, comprising the steps of:

A. designing a plurality of self-assembly nanopore-based protein behavior detection systems with different target protein adaptation rear directions in a DNA tetrahedron, and mixing the self-assembly nanopore-based protein behavior detection systems with the target protein in a solution respectively to obtain a plurality of tetrahedron-protein combinations with different target protein directions fixed on a linear DNA long double chain;

5. The method of claim 4, wherein said tetrahedron-protein conjugate is prepared in step A by first binding said DNA tetrahedron to said target protein and then fixing said DNA tetrahedron to said linear DNA long duplex by base complementarity.

6. Use of the self-assembled nanopore based protein behavior detection system of claim 1 or 2 for detecting protein molecules.

7. Use of the self-assembled nanopore based protein behavior detection system of claim 1 or 2 to control the spatial orientation of proteins.