CN111876495A

CN111876495A - Tagman Real-Time PCR detection kit for echinococcus and application thereof

Info

Publication number: CN111876495A
Application number: CN202010861647.9A
Authority: CN
Inventors: 赵莉; 王冰洁; 班万里; 郭宝平; 张旭; 闫昊; 张壮志; 胡燕; 肖海龙; 卡那提别克·开比热; 刘志强; 努尔·库尔玛那里; 郭涛; 王方; 吕凤军; 丁伟强; 喻昌盛; 艾沙江·阿布拉; 陆桂丽; 阿依江·卡那提别克
Original assignee: Xinjiang Academy Of Animal Sciences Veterinary Research Institute
Current assignee: Xinjiang Academy Of Animal Sciences Veterinary Research Institute
Priority date: 2020-08-24
Filing date: 2020-08-24
Publication date: 2020-11-03
Anticipated expiration: 2040-08-24
Also published as: CN111876495B

Abstract

The invention discloses a Taqman Real-Time PCR detection kit for echinococcus and application thereof, wherein the Taqman Real-Time PCR detection kit for echinococcus comprises an amplification premix, a negative control, a positive control, a nucleotide sequence shown in SEQ ID NO: 1 to SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the probe of SEQ ID NO: 6 and SEQ ID NO: 7. The invention also discloses a preparation method and application of the Taqman Real-Time PCR detection kit for the echinococcus.

Description

Tagman Real-Time PCR detection kit for echinococcus and application thereof

Technical Field

The invention belongs to the technical field of animal epidemic disease detection, and relates to a Taqman Real-Time PCR detection kit for Echinococcus granulosus and a preparation method and application thereof, in particular to the Taqman Real-Time PCR detection kit for detecting Echinococcus granulosus and Echinococcus multilocularis and the application thereof.

Background

Echinococcosis, commonly known as echinococcosis, is a disease caused by parasitism of the middle-taenia larvae of echinococcus in the internal organs of mammals, and is a serious zoonosis. Echinococcus contains 5 species, namely echinococcus granulosus (e.grandilosus), echinococcus multilocularis (e.multilamellaris), echinococcus oligonulatus (e.oligarhtus), echinococcus fortunei (e.vogelli) and echinococcus shiquius.

Echinococcosis is worldwide distributed throughout five continents and prevalent in parts of the middle east, south europe, latin america, central asia, australia and africa. The disease is found in 21 provinces and municipalities in China, the disease area accounts for 86.9% of the total area of the country, and the disease is particularly most popular in the provinces (the municipalities) in western regions, such as Xinjiang, Gansu, Ningxia, Qinghai, Tibet, Sichuan, inner Mongolia and the like. At present, 2 types of echinococcosis are mainly infected among people and livestock in China, namely: echinococcosis granulosa (echinococcosis granulosa, or echinococcosis, CE) caused by echinococcus granulosus larvae and echinococcosis granulosa (echinococcosis multibladae, or alveolar coccidiosis, alveolaris echinococcosis, AE). Among them, CE causes human echinococcosis with a high incidence rate, accounting for 95% of echinococcosis. More than 50 of every 100000 people in the endemic area are reported to be infected with echinococcosis, which can reach 5-10% mortality in some high-incidence areas; AE, also known as "insect cancer", is highly lethal to humans up to 94%.

According to statistics, the existing echinococcosis patients in China at least reach 100 million, the threatened population is 6600 million, about 38 million echinococcosis patients in China exist, and the average prevalence rate in plateau areas is 1.2-1.8%. The treatment of the echinococcosis between people is preferably performed by surgical operation, the operation cost and the post-operation repair period cost are up to tens of thousands of yuan, the recurrence rate is high, and huge economic burden is brought to patients and families. Meanwhile, the animal infection echinococcosis causes the economic loss of domestic animal products to reach more than 30 hundred million yuan, and brings great harm to the physical health of local residents and the production and development of animal husbandry.

The TaqMan probe method is a highly specific quantitative PCR technique, and is characterized in that the 3 '→ 5' exonuclease activity of Taq enzyme is utilized to cleave a probe, thereby generating a fluorescent signal. Since the probe is specifically bound to the template, the intensity of the fluorescent signal represents the amount of template. The quantitative PCR reaction system of the TaqMan probe method comprises a pair of PCR primers and a probe. The probe binds specifically only to the template, with the binding site between the two primers. The 5 'end of the probe is labeled with a Reporter group (R) such as FAM, VIC, etc., and the 3' end is labeled with a fluorescence quenching group (Q) such as TAMRA, etc. When the probe is complete, the fluorescent energy emitted by the reporter group is absorbed by the quenching group and no signal is detected by the instrument. As the PCR proceeds, Taq enzyme encounters the template-bound probe during the strand extension, its 5 '→ 3' exonuclease activity cleaves the probe, the reporter group is removed from the quenching group, and its energy is not absorbed, i.e., a fluorescent signal is generated. Therefore, the fluorescent signal has a synchronous exponential growth process as the target fragment every PCR cycle. The intensity of the signal represents the copy number of the template DNA. The fluorescence labeling probe can improve the efficiency, the sensitivity and the specificity of the real-time fluorescence quantitative PCR result.

At present, the echinococcus granulosus (Eg) and echinococcus multilocularis (Em) are distinguished in China mainly by microscopic examination, molecular biology, immunology detection methods and the like, and the methods have the problems of harmfulness to operators and environment, complex operation, low sensitivity, omission, false positive and the like. Therefore, how to rapidly, accurately and sensitively detect the echinococcus granulosus and the echinococcus multilocularis becomes a problem to be solved urgently.

Disclosure of Invention

The invention aims to overcome the defect that the prior art cannot meet the requirement of rapid, sensitive and accurate quantitative detection, and provides a Taqman Real-Time PCR detection kit for echinococcus and a preparation method and application thereof. Therefore, the detection method capable of quickly, sensitively and accurately identifying the echinococcus granulosus and the echinococcus multilocularis is provided, and the echinococcus granulosus and the echinococcus multilocularis are distinguished by designing specific primers and probes for mitochondrial NADH3 genes of the echinococcus granulosus and the echinococcus multilocularis and adopting a Taqman Real-time PCR detection method.

The specific technical scheme is as follows:

a Taqman Real-Time PCR detection kit for Echinococcus stolonifer comprises an amplification premix, a negative control, a positive control, a nucleotide sequence shown in SEQ ID NO: 1 to SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the probe of SEQ ID NO: 6 and SEQ ID NO: 7.

Further, the probe sequence SEQ ID NO: 4, the 5 'end marker is FAM reporter fluorophore, and the 3' end marker is TAMRA quenching fluorophore.

Further, the probe sequence SEQ ID NO: 5 'end marker is VIC report fluorescent group, 3' end marker is TAMRA quenching fluorescent group.

Further, the amplification primers SEQ ID NO: 1 and SEQ ID NO: 2 amplified band sequences are as follows: SEQ ID NO: and 6.

The amplification primer is SEQ ID NO: 1 and SEQ ID NO: 3 amplified band sequences are as follows: SEQ ID NO: shown at 7.

Further, the negative control was rnase-free water.

Further, the positive controls are a positive plasmid pMD19-T-Eg containing the Echinococcus granulosus mitochondrial NADH3 gene sequence and a positive plasmid pMD19-T-Em containing the Echinococcus multocida mitochondrial NADH3 gene sequence respectively;

a preparation method of a Taqman Real-Time PCR detection kit for Echinococcus comprises the following steps:

step 1, primer design

Specific primers were designed based on the Eg and Em mitochondrial NADH3 gene conserved sequences registered in GenBank using Primer5.0 and Oligo6.0 software, and BamHI and SalI restriction enzyme recognition sites were inserted into the upstream and downstream primers, respectively, and the synthesis of the primers was performed by Beijing Liuhe Huada Gene science and technology, Inc.

Step 2, extraction of Echinococcus granulosus prototheca (Eg-PSC) and Echinococcus multilocularis prototheca (Em-PSC) total RNA

Eg-PSC and Em-PSC total RNA are extracted according to the instruction of TaKaRa RNAioso Plus RNA extraction reagent, and the specific steps are as follows:

1. grinding and homogenization of the sample: the Eg-PSC and Em-PSC samples stored in liquid nitrogen were each quickly transferred to a mortar precooled with liquid nitrogen, and the tissues were ground with a pestle with liquid nitrogen added continuously until ground to a powder. Then adding a proper amount of RNAioso Plus into the mortar, and repeatedly beating until the mixture is uniform and transparent; then transferring the homogenate liquid into a centrifuge tube, and standing for 5min at room temperature (15-30 ℃); centrifuging at 12000r/min at 4 deg.C for 5 min; carefully aspirate the supernatant and transfer it to a new centrifuge tube.

2. Extraction of total RNA: adding chloroform (1/5 volume of RNAioso Plus) into the homogenate lysate, covering the centrifugal tube, and mixing until the solution is milky white; standing at room temperature for 5 min; centrifuging at 12000r/min at 4 ℃ for 15 min; carefully taking out the centrifuge tube from the centrifuge (at the moment, the homogenate is divided into three layers, namely colorless supernatant containing RNA, a middle white protein layer and a lower organic phase with color), sucking the supernatant and transferring the supernatant into another new centrifuge tube; adding isopropanol 0.5-1 times of the volume of RNAiSoPlus into the supernatant, turning the centrifuge tube upside down, mixing, and standing at room temperature for 10 min; centrifuging at 12000r/min at 4 ℃ for 10 min.

Washing of RNA precipitation: the supernatant was carefully discarded. Adding 75% ethanol with the same amount as RNAioso Plus, slightly turning upside down to wash the tube wall of the centrifuge tube, centrifuging at 12000r/min at 4 ℃ for 5min, and carefully discarding the supernatant.

Lysis of RNA: opening the centrifugal tube cover, and drying the precipitate at room temperature for several minutes; after the precipitate is dried, an appropriate amount of RNase-free water is added to dissolve the precipitate.

Step 3, performing RT-PCR amplification on echinococcus granulosus and echinococcus multilocularis mitochondrial NADH3 gene

Respectively carrying out reverse transcription on the extracted Eg-PSC and Em-PSC total RNA serving as templates to obtain cDNA, then respectively carrying out PCR amplification on the Echinococcus granulosus and Echinococcus multilocularis mitochondrial NADH3 genes by using the cDNA serving as a template and verifying the specificity of the genes. The PCR amplification reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 1min for 25 cycles; further extension was carried out at 72 ℃ for 10 min. After the PCR amplification is finished, 1% agarose gel electrophoresis detection is carried out.

Step 4, PCR product recovery

The echinococcus granulosus and echinococcus multilocularis mitochondrial NADH3 gene PCR products were recovered according to the procedures of the Axygen gel recovery kit.

Step 5, connecting the PCR recovery product with pMD19-T vector

mu.L of pMD19-T Vector, 4. mu.L of PCR recovery product and 5. mu.L of solution I are added into a 200. mu.L centrifuge tube, mixed evenly by centrifugation and connected overnight at 16 ℃.

Step 6, transformation of recombinant plasmid

The ligation products were transformed into E.coli DH 5. alpha. competent cells, plated on solid LB medium containing antibiotics (Amp), and cultured overnight at 37 ℃.

Step 7, PCR identification of recombinant plasmid

A single colony is picked up and inoculated into a liquid LB culture medium containing antibiotics (Amp) for overnight culture, and the culture is used for PCR identification and electrophoresis detection.

Step 8, double enzyme digestion identification of recombinant plasmid

Extracting recombinant clone plasmid according to the operation of the Axygen plasmid DNA extraction kit specification, and carrying out double enzyme digestion and electrophoresis detection on the recombinant plasmid by using restriction enzymes BamHI and SalI.

Step 9, sequencing of recombinant clone bacteria

The recombinant clone plasmid which is positive through PCR identification and plasmid double enzyme digestion identification is sent to Beijing Liuhe Huada Gene science and technology Limited company for sequencing. The recombinant plasmids with correct sequencing results were named pMD19-T-Eg and pMD19-T-Em, respectively.

The kit is applied to the preparation process of the kit for detecting the echinococcus granulosus by using Taqman Real-Time PCR (polymerase chain reaction) in the intermediate host and the final host.

The Taqman Real-Time PCR detection kit for the echinococcus is applied to the preparation process of the kit for detecting the echinococcus multilocularis by the intermediate host and the terminal host.

Compared with the prior art, the invention has the beneficial effects that:

the invention screens a section of sequence with good conservation in the larval stage and the adult stage by comparing and analyzing the Echinococcus granulosus and Echinococcus multilocularis mitochondrial NADH3 genes, designs a primer, amplifies a specific gene from the Echinococcus granulosus and the Echinococcus multilocularis by an RT-PCR method, obtains recombinant plasmids pMD19-T-Eg and pMD19-T-Em after cloning and sequencing, is used as a positive standard of a kit, designs a specific Taqman probe for the Echinococcus granulosus and the Echinococcus multilocularis, and distinguishes and detects the Echinococcus granulosus and the Echinococcus multilocularis by a Real-Time PCR method. The Taqman Real Time PCR kit for the echinococcus granulosus and/or echinococcus multocida can be used for identifying and detecting the infection of the echinococcus granulosus and/or echinococcus multocida in intermediate hosts (livestock such as cattle and sheep, wild animals such as mice) and terminal hosts (dogs, wolfs, foxes and the like), and has high specificity, sensitivity and repeatability.

Drawings

FIG. 1 shows the result of PCR identification of recombinant plasmid pMD 19-T-Eg; m: DNA molecular mass standard (DL 2000); 1: PCR products of the recombinant plasmids; 2: and (5) negative control.

FIG. 2 shows the alignment of the recombinant plasmid pMD 19-T-Eg.

FIG. 3 shows the result of PCR identification of recombinant plasmid pMD 19-T-Em; m: DNA molecular mass standard (DL 2000); 1: PCR products of the recombinant plasmids; 2: and (5) negative control.

FIG. 4 shows the alignment of the recombinant plasmid pMD 19-T-Em.

FIG. 5 is a standard curve for Eg real-time fluorescent quantitative PCR.

FIG. 6 is an amplification kinetics curve of Eg real-time fluorescent quantitative PCR; 1-10: 10⁹Copy/. mu.L-10⁰Copy/. mu.L; 11: and (5) negative control.

FIG. 7 is Eg real-time fluorescence quantitation of PResults of CR specificity tests; 1: echinococcus granulosus; 2: eg Standard plasmid (10)⁷Copy/. mu.L); 3: echinococcus granulosus; 4: echinococcus multilocularis; 5: echinococcus multilocularis; 6: coenurus cerebri; 7: taenia multiceps; 8: cercaria tenuipili; 9: a bubbly tapeworm; 10: toxocara canis; 11: and (5) negative control.

FIG. 8 shows the results of real-time fluorescent quantitative PCR assay of clinical specimens suspected of being infected with echinococcus granulosus (bovine/ovine liver, lung cyst); 1. 3-7: clinical samples with positive detection results; 2: eg standard plasmid; 8-51: clinical samples with negative detection results; 52: and (5) negative control.

FIG. 9 shows the results of real-time fluorescent quantitative PCR detection of clinical specimens suspected of being infected with Echinococcus granulosus (canine feces); 1: eg standard plasmid; 2: clinical samples with positive detection results; 3-51: clinical samples with negative detection results; 52: and (5) negative control.

FIG. 10 is a standard curve for Em real-time fluorescent quantitative PCR.

FIG. 11 is an amplification kinetics curve for Em real-time fluorescent quantitative PCR; 1-10: 10⁹Copy/. mu.L-10⁰Copy/. mu.L; 11: and (5) negative control.

FIG. 12 shows the results of Em real-time fluorescence quantitative PCR specificity assay; 1: echinococcus multilocularis; 2; em Standard plasmid (10)⁷Copy/. mu.L); 3: echinococcus multilocularis; 4: echinococcus granulosus; 5: echinococcus granulosus; 6: coenurus cerebri; 7: taenia multiceps; 8: cercaria tenuipili; 9: a bubbly tapeworm; 10: toxocara canis; 11: and (5) negative control.

FIG. 13 is the real-time fluorescent quantitative PCR assay of a clinical specimen suspected of infecting Echinococcus multocida (murine liver/lung cysts); 1-12: clinical samples with positive detection results; 13: em standard plasmid; 14-51: clinical samples with negative detection results; 52: and (5) negative control.

FIG. 14 is the real-time fluorescent quantitative PCR assay of a clinical specimen suspected of infecting Echinococcus multilocularis (canine feces); 1: em standard plasmid; 2-51: clinical samples with negative detection results; 52: and (5) negative control.

Detailed Description

The technical solution of the present invention will be described in further detail with reference to the accompanying drawings and specific embodiments.

The invention firstly provides a Taqman Real-time PCR kit for detecting Echinococcus granulosus and Echinococcus multilocularis mitochondrial NADH3 genes, which comprises an amplification premix, a negative control, a positive control, and a nucleotide sequence shown in SEQ ID NO: 1 to SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the probe of SEQ ID NO: 6 and SEQ ID NO: 7.

The amplification primer sequence is SEQ ID NO: 1 to SEQ ID NO: 3 is as follows:

SEQ ID NO: 1: upstream primer GCAGGTTACTTTGATATAGTAAATTGTG

SEQ ID NO: 2: downstream primer CCACAATTAAAAAAATAAATAAC

SEQ ID NO: 3: downstream primer CCAGAATTAAAAAAATAAATAAC

The probe sequence is SEQ ID NO: 4 and SEQ ID NO: 5 is as follows:

SEQ ID NO：4：ATACTATGGTCCATATATCTATATTAAGAGCTGAG

SEQ ID NO：5：ATTTTGACTCATATATCTAATGTTGCGAAGAGCT

the probe sequence is SEQ ID NO: 4, the 5 'end marker is FAM reporter fluorophore, and the 3' end marker is TAMRA quenching fluorophore.

The probe sequence is SEQ ID NO: 5 'end marker is VIC report fluorescent group, 3' end marker is TAMRA quenching fluorescent group.

The amplification primer is SEQ ID NO: 1 and SEQ ID NO: 2 the sequence of the amplified band is: SEQ ID NO: 6(187 bp):

the amplification primer is SEQ ID NO: 1 and SEQ ID NO: 3, the sequence of the amplified band is as follows: SEQ ID NO: 7(189 bp):

the negative control was rnase-free water.

The positive controls are respectively a positive plasmid pMD19-T-Eg containing Echinococcus granulosus mitochondrial NADH3 gene sequence and a positive plasmid pMD19-T-Em containing Echinococcus multilocularis mitochondrial NADH3 gene sequence; the construction method comprises the following steps:

a. Eg-PSC and Em-PSC total RNA were extracted separately according to TaKaRa RNAioso Plus RNA extraction reagent instructions and reverse transcribed to cDNA, Echinococcus granulosus cDNA as template, SEQ ID NO: 1 and SEQ ID NO: 2 as a primer, taking Echinococcus multilocularis cDNA as a template, and taking SEQ ID NO: 1 and SEQ ID NO: 3 is a primer, and conventional PCR amplification is respectively carried out, wherein the reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 1min for 25 cycles; extending for 10min at 72 ℃, and identifying the PCR products by 1% agarose gel electrophoresis respectively;

cloning and sequence analysis of PCR products:

and recovering the PCR product by using an Axygen gel recovery kit, respectively connecting the PCR product with a pMD19-T cloning vector, transforming an escherichia coli competent cell DH5 alpha, coating the escherichia coli competent cell DH5 alpha on an LB culture medium plate containing 100mg/L ampicillin, and culturing for 12-16 h at 37 ℃. After blue white screening, plasmid is extracted by using an Axygen plasmid DNA extraction kit, and the extracted plasmid is subjected to double enzyme digestion and electrophoresis detection by using restriction enzymes BamHI and SalI. The recombinant clone plasmid which is positive through PCR identification and plasmid double enzyme digestion identification is sent to Beijing Liuhe Huada Gene science and technology Limited company for sequencing. The recombinant plasmids with correct sequencing results were named pMD19-T-Eg and pMD19-T-Em, respectively.

The standard curve was prepared as follows:

pMD19-T-Eg and pMD19-T-Em positive plasmids were each diluted 10-fold in gradient to: 10⁹Copy/. mu.L-10⁰Copy/. mu.L, each gradient was repeated three times for fluorescent quantitative PCR detection.

And matching the positive plasmid of each concentration gradient with the Ct value obtained by detection according to the amplification result, and establishing a standard curve. As shown in fig. 5 and 10.

The invention also provides a using method of the Taqman Real-time PCR kit for detecting the Echinococcus granulosus and the Echinococcus multilocularis, which comprises the following steps:

a. PCR amplification using the detection kit of claim 1, under the following conditions: pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 3s, annealing/extension/fluorescence data at 60 ℃ for 30s, 40 cycles.

b. And (4) analyzing results:

and (4) judging according to the amplification result: if NTC (negative control) has no Ct (cycle number) value, the result is positive if the Ct value is less than 35; the Ct value is between 35 and 40 and is suspicious, and repeated detection is needed. When the sample is measured again, the Ct value of the sample is positive when the Ct value is less than 35, and the Ct value is negative when the Ct value is more than or equal to 35.

According to the invention, based on the stability of the echinococcus granulosus and echinococcus multilocularis mitochondrial DNA, primers and probes for the echinococcus granulosus and echinococcus multilocularis mitochondrial NADH3 genes are respectively designed, and after a reaction system and reaction conditions are optimized, real-time fluorescence quantitative PCR amplification and analysis are carried out, so that the level of the echinococcus granulosus and/or echinococcus multilocularis DNA can be accurately judged.

EXAMPLE 1 preparation of Positive recombinant plasmid Standard

The conserved regions in the gene of the Eg and Em mitochondria NADH3 are respectively found out by analyzing the gene sequences of the Eg and Em mitochondria NADH3 registered in GenBank, specific primers are designed, the gene is respectively amplified from the Eg and Em samples by an RT-PCR method and is constructed into a cloning vector pMD19-T, after escherichia coli DH5 alpha competent cells are transformed, amplification culture is carried out, and whether the constructed plasmid is successful or not is determined by PCR identification and sequencing.

1.1 test methods

1.1.1 primer design

Specific primers were designed according to the Eg and Em mitochondrial NADH3 gene conserved sequences registered in GenBank using Primer5.0 and Oligo6.0 software, and BamHI and SalI restriction enzyme recognition sites were inserted into the upstream and downstream primers, respectively, and the synthesis of the primers was performed by Beijing Liuhe Huada Gene science and technology, Inc., and the sequences of the primers are shown in Table 1.

TABLE 1 primer library column

1.1.2 extraction of Total RNA from Echinococcus granulosus (Eg-PSC) and Echinococcus multilocularis (Em-PSC)

The method is the same as the total RNA extraction method described above, according to the TaKaRa RNAiSo Plus RNA extraction reagent instructions.

1.1.3 Echinococcus granulosus and Echinococcus multilocularis mitochondrial NADH3 Gene RT-PCR amplification

1.1.4PCR product recovery

1.1.5 ligation of PCR-recovered product with pMD19-T vector

1.1.6 transformation of recombinant plasmids

1.1.7 PCR identification of recombinant plasmids

1.1.8 double restriction enzyme identification of recombinant plasmids

1.1.9 sequencing of recombinant clonal bacteria

1.2 test results

1.2.1Eg recombinant cloned plasmid PCR identification

The target fragment is connected with a pMD19-T vector and then transferred into a competent cell, the competent cell is cultured on a solid culture medium for 12-16 h, 3 single colonies are selected and inoculated to an LB liquid culture medium, the culture is carried out for 12-16 h, recombinant clone plasmids are extracted according to the specification of an Axygen plasmid DNA extraction kit, the extracted plasmids are subjected to PCR amplification by using an Eg-F/Eg-R primer, and the product is subjected to 1% agarose gel electrophoresis to obtain the target fragment with the length of about 187bp, which is consistent with the expected size, and the result is shown in figure 1.

1.2.2Eg recombinant cloned plasmid sequencing identification

After sequencing and NCB/Blast comparison, the homology of the extracted plasmid and the gene NADH3 of the Eg mitochondria is 100 percent, and the result is shown in figure 2, which shows that the construction of the Eg recombinant clone plasmid is successful.

1.2.3Em recombinant clone plasmid PCR identification

The target fragment is connected with a pMD19-T vector and then transferred into a competent cell, the competent cell is cultured on a solid culture medium for 12-16 h, 3 single colonies are selected and inoculated to an LB liquid culture medium, the culture is carried out for 12-16 h, recombinant clone plasmids are extracted according to the specification of an Axygen plasmid DNA extraction kit, the extracted plasmids are subjected to PCR amplification by using an Em-F/Em-R primer, and the product is subjected to 1% agarose gel electrophoresis to obtain the target fragment with the length of about 189bp, which is consistent with the expected size, and the result is shown in figure 3.

1.2.4Em recombinant clone plasmid sequencing identification

After sequencing and NCB/Blast comparison, the homology of the extracted plasmid and the Em mitochondrial NADH3 gene is 100%, and the result is shown in figure 4, which shows that the Em recombinant clone plasmid is successfully constructed.

Example 2 preparation of Echinococcus granulosus Taqman Real-Time PCR detection kit

2.1 test methods

2.1.1 primer and Probe design

Conserved regions were selected based on the Eg mitochondrial genome (accession numbers: NC-044548, respectively) registered in GenBank, and specific primers and probes were designed using Primer5.0 and Oligo6.0 software, respectively, with the following sequences:

the sequence of the amplification primer is as follows:

SEQ ID NO: 1: upstream primer GCAGGTTACTTTGATATAGTAAATTGTG

SEQ ID NO: 2: downstream primer CCACAATTAAAAAAATAAATAAC

The Eg probe sequence is:

SEQ ID NO：4：(FAM)ATACTATGGTCCATATATCTATATTAAGAGCTGAG(TAM)

the above primers and probes were synthesized and labeled by Beijing Liuhe Hua Dagenescience and technology Co

Positive control: the Eg-positive recombinant plasmid pMD19-T-Eg constructed in example 1.

2.1.2 preparation of the kit

The kit consists of the following components:

a.2×SuperReal PreMix：10μL；

b. the concentration of the primer and the probe is 10 pmoL/muL, the total volume of the mixed solution is 1.6 muL, wherein the upstream primer is 0.6 muL, the downstream primer is 0.6 muL, and the probe primer is 0.4 muL;

c. RNase free water 6.4. mu.L;

d. positive control pMD19-T-Eg positive plasmid 2 uL;

e. negative control RNase-free water 2. mu.L;

2.1.3 Standard Curve construction and sensitivity test

After 10-fold gradient dilution of Echinococcus granulosus positive plasmid (10)⁹Copy/. mu.L-10⁰Copies/. mu.L) as template, respectively, with SEQ ID NO: 1 and SEQ ID NO: 2 is a primer, SEQ ID NO: 4 is a probe, and real-time fluorescent quantitative PCR amplification is carried out.

The total reaction system for PCR is 20 μ L: respectively mixing a.2 XSuperReal PreMix10 μ L in the kit; b. the total volume of the primer and probe mixed solution is 1.6 mu L; c. 6.4. mu.L of RNase-free water was added to a 0.2mL amplification tube;

will 10⁹Copy/. mu.L-10⁰Respectively adding the copied/mu L positive plasmid templates into the amplification tubes, putting the amplification tubes into a fluorescent quantitative PCR instrument, and amplifying under the following set program: pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 3s, annealing/extension/fluorescence data at 60 ℃ for 30s, 40 cycles; and detecting an Eg probe amplification curve by using the FAM channel, and observing a real-time fluorescent quantitative PCR detection result.

2.1.4 analysis of results

2.2 test results

2.2.1 creation of Standard Curve

And performing fluorescent quantitative PCR amplification by using the positive recombinant plasmid which is diluted by 10 times in a gradient manner as a template to obtain a standard curve. The results show that: standard curve at 10⁹Copy/. mu.L-10²The linear relationship is better in the range of copy/. mu.L (correlation coefficient R)²0.998), the results are shown in fig. 5.

2.2.2 sensitivity analysis

And performing fluorescent quantitative PCR amplification by using the positive recombinant plasmid which is diluted by 10 times in a gradient manner as a template to obtain an amplification kinetic curve. The lowest detectable concentration was 100 copies/. mu.L, and the results are shown in FIG. 6, indicating that the established method has better sensitivity.

Example 3 specificity analysis of Echinococcus granulosus Taqman Real-Time PCR detection kit

3.1 test methods

3.1.1 sample sources

Echinococcus granulosus (Echinococcus), Echinococcus granulosus (Eg), Echinococcus multilocularis (alveolaris Echinococcus), Echinococcus multilocularis (Em), Echinococcus cerealis (Coenus cerealis, Cc), Taenia Multiceps (Multiceps, Mm), Echinococcus cervi (Cystictus tenuicolis, Ct), Taenia vesiculosus (Taenia datigana, Th) and Tocarxoa canis (Tocarxoa multilocularis, Tc) strains isolated and stored in the laboratory were each extracted according to the instructions of the blood/cell/tissue genome DNA extraction kit (centrifugal column type) (Tiangen Biochemical science, Beijing) Co., Ltd.).

3.1.2PCR reaction System and Process

According to the total reaction system of 20 muL, a.2 XSuperReal PreMix10 muL in the kit; b. the total volume of the primer and probe mixed solution is 1.6 mu L; c. 6.4 mu L of RNase-free water is mixed and subpackaged according to the quantity of 11 samples, the mixture is added into a 0.2mL amplification tube, and then 2 mu L of positive control, negative control and different insect strain DNA templates are respectively added into the amplification tube.

Putting the amplification tube into a fluorescent quantitative PCR instrument, and amplifying under the following set program: pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 3s, annealing/extension/fluorescence data at 60 ℃ for 30s, 40 cycles; and detecting an Eg probe amplification curve by using the FAM channel, and observing a real-time fluorescent quantitative PCR detection result.

3.1.3 analysis of results

3.2 test results

3.2.1 specificity test

Fluorescent quantitative PCR detection is performed by using Eg, Em, C.cerebris, M.multiceps, C.tenuicolis, T.hydatigen and T.canis positive sample DNA as templates. The results show that: only Eg shows a specific amplification curve, and other samples and negative controls have no obvious amplification curve, and the result is shown in figure 7, which indicates that the established method has better specificity.

Example 4 application of Echinococcus granulosus Taqman Real-Time PCR detection kit in detection of intermediate host infection

4.1 test methods

4.1.1 sample sources

50 clinical samples (bovine/sheep liver, lung cyst) of suspected echinococcus granulosus infected with the sample were obtained from the laboratory in Shosu county, Ili, according to the instruction of the blood/cell/tissue genome DNA extraction kit (centrifugal column type) (Tiangen Biochemical technology, Beijing) Co., Ltd.).

4.1.2PCR reaction System and Process

According to the total reaction system of 20 muL, a.2 XSuperReal PreMix10 muL in the kit; b. the total volume of the primer and probe mixed solution is 1.6 mu L; c. mixing 6.4 mu L of RNase-free water according to the quantity of 52 samples, subpackaging, adding into 0.2mL of amplification tubes, and then respectively adding 2 mu L of positive control, negative control and different sample DNA templates into the amplification tubes;

4.1.3 analysis of results

4.2 test results

4.2.1 detection of Echinococcus granulosus infection in intermediate host clinical specimens

The established fluorescent quantitative PCR method is used for detecting 50 clinical samples suspected to be infected with echinococcus granulosus (bovine/ovine liver and lung cyst), the positive detection rate is 12% (6/50), and the result is shown in figure 8.

Example 5 application of Echinococcus granulosus Taqman Real-Time PCR detection kit in detection of terminal host infection

5.1 test methods

5.1.1 sample sources

50 parts of DNA of a clinical specimen (canine feces) suspected to infect Echinococcus granulosus collected in Shosu county of Ili, from this laboratory was extracted according to the instructions of a blood/cell/tissue genomic DNA extraction kit (centrifugal column type) (Tiangen Biochemical technology, Beijing, Ltd.).

5.1.2PCR reaction System and Process

5.1.3 analysis of results

5.2 test results

5.2.1 detection of clinical specimens suspected of infecting Echinococcus granulosus by end hosts

The established fluorescence quantitative PCR method is applied to 50 clinical samples (dog feces) suspected to be infected with echinococcus granulosus for detection, the positive detection rate is 2% (1/50), and the result is shown in figure 9.

Example 6 preparation of Echinococcus multilocularis Taqman Real-Time PCR detection kit

6.1 test methods

6.1.1 primer and Probe design

Conserved regions were selected based on the Em mitochondrial genome (accession NC-000928) registered in GenBank, and specific primers and probes were designed using Primer5.0 and Oligo6.0 software, respectively, with the following sequences:

the sequence of the amplification primer is as follows:

SEQ ID NO: 1: upstream primer GCAGGTTACTTTGATATAGTAAATTGTG

SEQ ID NO: 3: downstream primer CCAGAATTAAAAAAATAAATAAC

The Em probe sequence was:

SEQ ID NO：5：(VIC)ATTTTGACTCATATATCTAATGTTGCGAAGAGCT(TAM)

Positive control: the Em-positive recombinant plasmid pMD19-T-Em constructed in example 1.

6.1.2 preparation of the kit

The kit consists of the following components:

a.2×SuperReal PreMix：10μL；

c. RNase free water 6.4. mu.L;

d. 2 μ L of positive control pMD19-T-Em positive plasmid;

e. negative control RNase-free water 2. mu.L;

6.1.3 Standard Curve construction and sensitivity test

After 10-fold gradient dilution of Echinococcus multilocularis positive plasmid (10)⁹Copy/. mu.L-10⁰Copies/. mu.L) as template, respectively, with SEQ ID NO: 1 and SEQ ID NO: 3 is a primer, SEQ ID NO: 5 is a probe, and real-time fluorescent quantitative PCR amplification is carried out.

will 10⁹Copy/. mu.L-10⁰Respectively adding the copied/mu L positive plasmid templates into the amplification tubes, putting the amplification tubes into a fluorescent quantitative PCR instrument, and amplifying under the following set program: pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 3s, annealing/extension/fluorescence data at 60 ℃ for 30s, 40 cycles; and detecting an Em probe amplification curve by the VIC channel, and observing a real-time fluorescent quantitative PCR detection result.

6.1.4 analysis of results

6.2 test results

6.2.1 creation of Standard Curve

And performing fluorescent quantitative PCR amplification by using the positive recombinant plasmid which is diluted by 10 times in a gradient manner as a template to obtain a standard curve. The results show that: standard curve at 10⁹Copy/. mu.L-10¹The linear relationship is better in the range of copy/. mu.L (correlation coefficient R)²0.998), the results are shown in fig. 10.

6.2.2 sensitivity assays

And performing fluorescent quantitative PCR amplification by using the positive recombinant plasmid which is diluted by 10 times in a gradient manner as a template to obtain an amplification kinetic curve. The lowest detectable concentration was 10 copies/. mu.L, and the results are shown in FIG. 11, indicating that the established method has better sensitivity.

Example 7 specificity analysis of Echinococcus multilocularis Taqman Real-Time PCR detection kit

7.1 test methods

7.1.1 sample sources

The DNA of Echinococcus multilocularis (alveolaris echinococcus), Echinococcus multilocularis (Em), Echinococcus granulosus (cytic echinococcus), Echinococcus granulosus (Eg), Echinococcus cerealis (Coenus cerealis, Cc), Taenia multiceps (multiceps, Mm), Echinococcus tenuis (Ct), Taenia vesiculosus (Th), and ascaris canis (Tocarxoa multilocularis, Tc) strains isolated and stored in the laboratory were extracted according to the blood/cell/tissue genome DNA extraction kit (centrifugal column type) (Tiangen Biochemical science, Beijing) instructions.

7.1.2PCR reaction System and Process

Putting the amplification tube into a fluorescent quantitative PCR instrument, and amplifying under the following set program: pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 3s, annealing/extension/fluorescence data at 60 ℃ for 30s, 40 cycles; and detecting an Em probe amplification curve by the VIC channel, and observing a real-time fluorescent quantitative PCR detection result.

7.1.3 analysis of results

7.2 test results

7.2.1 specificity test

Fluorescent quantitative PCR detection is performed by using Em, Eg, C.cerebris, M.multiceps, C.tenuicolis, T.hydatigen and T.canis positive sample DNA as templates. The results show that: only Em shows a specific amplification curve, other samples and negative controls have no obvious amplification curve, and the result is shown in figure 12, which indicates that the established method has better specificity.

Example 8 application of Echinococcus multilocularis Taqman Real-Time PCR detection kit in detection of intermediate host infection

8.1 test methods

8.1.1 sample sources

50 clinical samples (rat liver/lung cyst) of suspected echinococcus multocida infection collected from the laboratory in Shosu county, Ili were extracted according to the blood/cell/tissue genome DNA extraction kit (centrifugal column type) (Tiangen Biochemical technology (Beijing) Co., Ltd.).

8.1.2PCR reaction System and Process

8.1.3 analysis of results

8.2 test results

8.2.1 detection of clinical specimens suspected of infecting Echinococcus multocida with intermediate hosts

The established fluorescent quantitative PCR method was used to detect 50 clinical samples suspected to be infected with echinococcus multilocularis (rat liver/lung cysts), and the positive detection rate was 24% (12/50), and the results are shown in FIG. 13.

Example 9 application of Echinococcus multilocularis Taqman Real-Time PCR detection kit in detection of infection of terminal host

9.1 test methods

9.1.1 sample sources

50 clinical samples (canine feces) of suspected echinococcus multicavicularis infection collected in Shosu county, Ili, were extracted according to the blood/cell/tissue genomic DNA extraction kit (centrifugal column type) (Tiangen Biochemical technology, Beijing) Co., Ltd.).

9.1.2PCR reaction System and Process

9.1.3 analysis of results

9.2 test results

9.2.1 detection of clinical specimens of Echinococcus multilocularis suspected of infection by end hosts

The established fluorescence quantitative PCR method was applied to 50 clinical samples (dog feces) suspected to be infected with Echinococcus multilocularis for detection, and the positive detection rate was 0(0/50), and the results are shown in FIG. 14.

The above description is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited thereto, and any person skilled in the art can obviously obtain simple changes or equivalent substitutions of the technical solutions within the technical scope of the present invention.

Sequence listing

<110> veterinary institute of the department of veterinary sciences, Sinkiang (animal clinical medicine research center of the department of veterinary sciences, Sinkiang)

<120> Taqman Real-Time PCR detection kit for echinococcus and application thereof

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gcaggttact ttgatatagt aaattgtg 28

<210>2

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ccacaattaa aaaaataaat aac 23

<210>3

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ccagaattaa aaaaataaat aac 23

<210>4

<211>35

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atactatggt ccatatatct atattaagag ctgag 35

<210>5

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

attttgactc atatatctaa tgttgcgaag agct 34

<210>6

<211>187

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gcaggttact ttgatatagt aaattgtgaa tttattttcc gttaatacta tggtccatat 60

atctatatta agagctgagt tcttacctca gtaatgtggt tttcactgtg ggtttgatgg 120

ttgttttgtt ttttgttttt tttgtttttt ttttgtttgg ttttgttatt tattttttta 180

attgtgg 187

<210>7

<211>189

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gcaggttact ttgatatagt aaattgtgaa tttattttcc gttaatattt tgactcatat 60

atctaatgtt gcgaagagct gagttcttac ctcagtaatg tggttatcac tgtgggttat 120

ggttgttttg ttttttgttt tttttgtttt ttttttgttg ggttttgtta tttatttttt 180

taattctgg 189

Claims

1. A Taqman Real-Time PCR detection kit for Echinococcus spp is characterized by comprising an amplification premix, a negative control, a positive control, and a kit of SEQ ID NO: 1 to SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the probe of SEQ ID NO: 6 and SEQ ID NO: 7.

2. The Taqman Real-Time PCR detection kit of echinococcus of claim 1, wherein said probe sequence SEQ ID NO: 4, the 5 'end marker is FAM reporter fluorophore, and the 3' end marker is TAMRA quenching fluorophore.

3. The Taqman Real-Time PCR detection kit of echinococcus of claim 1, wherein said probe sequence SEQ ID NO: 5 'end marker is VIC report fluorescent group, 3' end marker is TAMRA quenching fluorescent group.

4. The Taqman Real-Time PCR detection kit for echinococcus of claim 1, wherein said amplification primer SEQ ID NO: 1 and SEQ ID NO: 2 amplified band sequences are as follows: SEQ ID NO: and 6.

5. The Taqman Real-Time PCR detection kit for echinococcus of claim 1, wherein said amplification primer SEQ ID NO: 1 and SEQ ID NO: 3 amplified band sequences are as follows: SEQ ID NO: shown at 7.

6. The Taqman Real-Time PCR assay kit of echinococcus of claim 1, wherein said negative control is rnase-free water.

7. The Taqman Real-Time PCR assay kit of echinococcus according to claim 1, wherein said positive controls are the positive plasmid pMD19-T-Eg containing the echinococcus granulosus mitochondrial NADH3 gene sequence and the positive plasmid pMD19-T-Em containing the echinococcus multilocularis mitochondrial NADH3 gene sequence, respectively.

8. The method for preparing the Taqman Real-Time PCR detection kit for the echinococcus of claim 1, which comprises the following steps:

step 1, primer design

Respectively designing specific primers by using Primer5.0 and Oligo6.0 software according to Eg and Em mitochondrial NADH3 gene conserved sequences registered in GenBank, respectively inserting BamHI and SalI restriction enzyme recognition sites into an upstream Primer and a downstream Primer, and completing the synthesis of the primers by Beijing Liuhe Huada Gene science and technology Limited;

step 2, extraction of Echinococcus granulosus Eg-PSC and Echinococcus multilocularis Em-PSC total RNA

1) grinding and homogenization of the sample: respectively and rapidly transferring the Eg-PSC and Em-PSC samples stored in the liquid nitrogen into a mortar precooled by the liquid nitrogen, and grinding the tissues by using a pestle, wherein the liquid nitrogen is continuously added until the tissues are ground into powder; then adding a proper amount of RNAioso Plus into the mortar, and repeatedly beating until the mixture is uniform and transparent; then transferring the homogenate liquid into a centrifugal tube, and standing for 5min at the room temperature of 15-30 ℃; centrifuging at 12000r/min at 4 deg.C for 5 min; carefully sucking the supernatant, and transferring into a new centrifuge tube;

2) extraction of total RNA: adding chloroform and 1/5 volume of RNAioso Plus into the homogenate lysate, covering the centrifugal tube cover tightly, and mixing until the solution is emulsified to be milk white; standing at room temperature for 5 min; centrifuging at 12000r/min at 4 ℃ for 15 min; the centrifuge tube was carefully removed from the centrifuge, and the homogenate was divided into three layers at this time, i.e.: colorless supernatant containing RNA, a middle white protein layer and a lower organic phase with color, sucking the supernatant and transferring the supernatant into another new centrifuge tube; adding isopropanol with volume of 0.5-1 time of RNAioso Plus into the supernatant, turning the centrifuge tube upside down, mixing, and standing at room temperature for 10 min; centrifuging at 12000r/min at 4 ℃ for 10 min;

3) washing of RNA precipitate: the supernatant was carefully discarded; adding 75% ethanol with the same amount as RNAioso Plus, slightly reversing the direction to wash the tube wall of the centrifuge tube, centrifuging at 12000r/min at 4 ℃ for 5min, and carefully discarding the supernatant;

4) and (3) RNA dissolution: opening the centrifugal tube cover, and drying the precipitate at room temperature for several minutes; after the precipitate is dried, adding a proper amount of RNase-free water to dissolve the precipitate;

Respectively carrying out reverse transcription on the extracted Eg-PSC and Em-PSC total RNA serving as templates to obtain cDNA, then respectively carrying out PCR amplification on Echinococcus granulosus and Echinococcus multilocularis mitochondrial NADH3 genes by using the cDNA serving as a template and using the designed specific primers, and verifying the uniqueness of the Echinococcus granulosus and Echinococcus multilocularis mitochondrial NADH3 genes; the PCR amplification reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 1min for 25 cycles; further extension for 10min at 72 ℃; after PCR amplification is finished, carrying out 1% agarose gel electrophoresis detection;

step 4, PCR product recovery

Recovering Echinococcus granulosus and Echinococcus multilocularis mitochondrial NADH3 gene PCR products according to the operation of the Axygen gel recovery kit instruction;

step 5, connecting the PCR recovery product with pMD19-T vector

Adding 1 mu L of pMD19-T Vector, 4 mu L of PCR recovery product and 5 mu L of solution I into a 200 mu L centrifuge tube, centrifuging, mixing uniformly, and connecting at 16 ℃ overnight;

step 6, transformation of recombinant plasmid

Transforming the ligation product into escherichia coli DH5 alpha competent cells, coating the cells on a solid LB culture medium containing antibiotic Amp, and culturing overnight at 37 ℃;

step 7, PCR identification of recombinant plasmid

Selecting a single colony, inoculating the single colony to a liquid LB culture medium containing antibiotic Amp, culturing overnight, and performing PCR identification and electrophoresis detection on a culture;

step 8, double enzyme digestion identification of recombinant plasmid

Extracting recombinant clone plasmid, carrying out double enzyme digestion and electrophoresis detection on the recombinant plasmid by using restriction enzymes BamHI and SalI;

step 9, sequencing of recombinant clone bacteria

The recombinant clone plasmid which is positive through PCR identification and plasmid double enzyme digestion identification is sent to Beijing Liuhe Huada Gene science and technology Limited company for sequencing; the recombinant plasmids with correct sequencing results were named pMD19-T-Eg and pMD19-T-Em, respectively.

9. The use of the taqmreal-Time PCR assay kit of echinococcus granulosus of claim 1 in the preparation of reagents for detecting echinococcus granulosus in intermediate and final hosts.

10. The use of the Taqman Real-Time PCR assay kit of echinococcus of claim 1 in the preparation of a reagent for detecting echinococcus multilocularis in both intermediate and final hosts.