CN111876395A

CN111876395A - Application of lentinus edodes manganese superoxide dismutase (LeMn-SOD) in improving stress tolerance of microorganisms

Info

Publication number: CN111876395A
Application number: CN202010808838.9A
Authority: CN
Inventors: 赵妍; 陈明杰; 杨焕玲; 游华芳; 余昌霞; 李治平; 黄波; 常婷婷
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2020-08-12
Filing date: 2020-08-12
Publication date: 2020-11-03
Anticipated expiration: 2040-08-12
Also published as: CN111876395B

Abstract

The invention discloses application of lentinus edodes manganese superoxide dismutase LeMn-SOD in improving the stress tolerance of microorganisms, wherein the amino acid sequence of the lentinus edodes manganese superoxide dismutase LeMn-SOD is shown as SEQ ID No.1, and the nucleotide sequence of a coding gene of the lentinus edodes manganese superoxide dismutase LeMn-SOD is shown as SEQ ID No. 2. According to the invention, the lentinus edodes manganese superoxide dismutase LeMn-SOD gene is transferred into a suitable microbial host, so that the manganese superoxide dismutase is expressed by the host, and the cold stress resistance and salt stress resistance of host cells are improved. The lentinus edodes manganese superoxide dismutase LeMn-SOD is derived from fungi, can be transferred into a suitable microbial host, and improves the stress resistance of the host.

Description

Application of lentinus edodes manganese superoxide dismutase (LeMn-SOD) in improving stress tolerance of microorganisms

Technical Field

The invention belongs to the technical field of antioxidant enzymes, and relates to application of lentinus edodes manganese superoxide dismutase (LeMn-SOD) in improving stress tolerance of microorganisms.

Background

Lentinus edodes (Lentinula edodes (Berk.) Pegler) belongs to the taxonomic group Basidiomycota, class Agaricales, order Agaricales, family Cortinellus, genus Lentinus. The shiitake mushroom belongs to wood rotting fungi, the degradation of lignin is needed for the cultivation production to provide sufficient nutrition for the growth of hyphae and the development of fruiting bodies, the shiitake mushroom belongs to medium-low temperature edible fungi, the growth rate of the hyphae is obviously reduced at the temperature of 30 ℃ (Wangbo, Tang Li Min, bear eagle, shogao, Xianling, shiitake mushroom strain hyphae and fruiting body growth high temperature resistant test research, proceedings of Jilin agriculture university, 2004,26(2): 145-plus 147), and the high temperature directly causes the reduction of the yield and the reduction of the quality of the shiitake mushroom.

When the organism is stressed by adversity, the dynamic balance of active oxygen is destroyed, the ROS in the cell is excessively accumulated and generates toxicity, and the excess ROS in the cell is very necessary to be removed in time. Organisms generally have both enzymatic and non-enzymatic scavenging mechanisms for scavenging ROS. Superoxide dismutase (SOD), Catalase (CAT), Ascorbate Peroxidase (APX), Glutathione Reductase (GR), Glutathione Peroxidase (GPX) and the like belong to enzymatic mechanisms. The enzyme in the antioxidant enzyme system that first scavenges ROS is SOD. SOD can be divided into Cu/Zn-SOD, Mn-SOD and Fe-SOD according to different metal coenzyme factors. Fe-SOD is mainly present in prokaryotic cells and some plants; Cu/Zn-SOD exists mainly in eukaryotic cytoplasm, chloroplast and peroxidase body; while Mn-SOD exists mainly in mitochondria and prokaryotic cells of eukaryotic cells. SOD catalyzes O under the action of adversity stress^2·-Is subject to disproportionationIs H₂O₂And O₂Thereby removing O^2·-The probability of producing OH & is reduced. When an organism is stressed by adversity, Mn-SOD positioned in mitochondria is used as a first defense line for eliminating superoxide anions, and the expression and regulation in the organism play an important role in balancing the steady state of the oxidation reduction of the organism.

In agriculture, researches show that Mn-SOD can improve the stress resistance of crops, such as cold resistance, drought resistance, salt damage resistance and the like. Bowler C et al found that Mn-SOD overexpression in tobacco and corn chloroplasts enhanced the protective effect of transgenic tobacco and corn on plasma membranes and tolerance to herbicide-induced oxygen stress by transgenic methods of Mn-SOD expression in tobacco and corn chloroplasts (Bowler C, Slooten L, Vanderbranden S, et al., Manganie seed superoxide dismutase prepared cellular data medium by oxidative gene irradiation in transgenic plants [ J ]. Embo Journal,1991,10(7): 1723-; studies of Hoolisha and the like show that China fir can rapidly induce the expression of Mn-SOD under adverse conditions of low temperature, drought, aluminum stress, salt stress and the like (China fir Mn-SOD gene expression under different adverse conditions of Hoolisha, Queenbach, Zhang Jiajun, and the like [ J ]. university report of northeast forestry, 2018,46(6): 19-22.). After Dunaliella salina Mn-SOD gene expression vector is used for transfecting SOD deficient escherichia coli and inducing the SOD deficient escherichia coli to express, the fact that the tolerance of the escherichia coli in the aspects of salt tolerance, radiation tolerance and cold resistance is obviously improved is found (Dunaliella salina manganese superoxide dismutase (MnSOD) gene cloning, expression and functional research [ D ] Chengdu university, 2007 ]. The SOD adopted by the method is derived from animals, plants or microalgae. Chinese patent 2019109334585 discloses the application of straw mushroom manganese superoxide dismutase VMn-SOD in improving the stress tolerance of microbes. When the cold stress is carried out for 6d and 8d, the growth rate of the Escherichia coli containing pBAR GPE1/VMn-SOD is respectively increased by 8.13 percent and 8.74 percent compared with the growth rate of the Escherichia coli containing pBAR GPE1 empty vector control group; the growth rate of Escherichia coli containing pBAR GPE1/VMn-SOD during 1% salt stress was 23.90%, 18.18%, 20.29% and 13.05% higher than that of the control group containing pBAR GPE1 empty vector, respectively. Although the heterologous expression of the straw mushroom manganese superoxide dismutase VMn-SOD can improve the cold resistance and the salt resistance of the Escherichia coli, the improvement capability is still limited.

Disclosure of Invention

The invention aims to provide application of lentinus edodes manganese superoxide dismutase (LeMn-SOD) in improving stress tolerance of microorganisms. The nucleotide sequence of the mushroom manganese superoxide dismutase LeMn-SOD is transferred into a host, and the cold stress resistance and salt stress resistance of host cells are improved by enabling the host to express the manganese superoxide dismutase.

The invention provides application of shiitake manganese superoxide dismutase (LeMn-SOD) in improving stress tolerance of microorganisms. The microorganism of the present invention may be a fungus or a bacterium. In a particular embodiment of the invention, the microorganism employed is Escherichia coli. The stress tolerance of the invention comprises cold stress tolerance and salt stress tolerance.

The amino acid sequence of the mushroom manganese superoxide dismutase LeMn-SOD is shown in SEQ ID NO. 1.

Specifically, the stress tolerance of the microorganism is improved by transferring an expression vector containing a lentinan superoxide dismutase (LeMn-SOD) gene into a microorganism host cell.

The coding gene LeMn-SOD of the mushroom manganese superoxide dismutase has a nucleotide sequence shown in SEQ ID No. 2.

In the specific implementation mode of the invention, the expression vector containing lentinan superoxide dismutase LeMn-SOD gene is pBAR GPE1/LeMn-SOD, and the expression vector is constructed by connecting a nucleotide fragment containing the lentinan superoxide dismutase LeMn-SOD gene with pBAR GPE1 plasmid subjected to double enzyme digestion by BamH I and EcoR I.

In the specific implementation mode of the invention, the cold stress resistance and salt stress resistance of escherichia coli are improved by transferring the expression vector pBAR GPE1/LeMn-SOD containing the lentinan superoxide dismutase LeMn-SOD gene into the escherichia coli.

Compared with the prior art, the invention has the following advantages:

according to the invention, the lentinus edodes manganese superoxide dismutase LeMn-SOD gene is transferred into a suitable microbial host, so that the manganese superoxide dismutase is expressed by the host, and the cold stress resistance and salt stress resistance of host cells are improved. Experiments prove that the cold stress resistance and salt stress resistance of escherichia coli with the transferred lentinus edodes manganese superoxide dismutase LeMn-SOD gene are improved after the manganese superoxide dismutase is overexpressed. Under cold stress for 48h, 60h and 72h, the growth rate of the Escherichia coli containing pBARGPE1/LeMn-SOD is respectively increased by 11.22%, 3.45% and 4.78% compared with the growth rate of the Escherichia coli containing pBAR GPE1 empty vector; when 6% NaCl salt is stressed for 2h, 4h, 6h and 8h, the growth rate of the Escherichia coli containing pBARGPE1/LeMn-SOD is respectively increased by 4.95%, 5.55%, 6.39% and 6.67% compared with the growth rate of the Escherichia coli containing pBAR GPE1 empty vector. The lentinus edodes manganese superoxide dismutase LeMn-SOD is derived from fungi, can be transferred into a suitable microbial host, and improves the stress resistance of the host.

Drawings

FIG. 1 is a map of overexpression vector pBAR GPE 1;

FIG. 2 is a diagram of the result of predicting the signal peptide of the champignon manganese superoxide dismutase LeMn-SOD;

FIG. 3 is a diagram of the result of prediction of phosphorylation sites of champignon manganese superoxide dismutase (LeMn-SOD);

FIG. 4 is a diagram showing the result of prediction of the transmembrane structure of the shiitake manganese superoxide dismutase (LeMn-SOD);

FIG. 5 is a map of the mushroom manganese superoxide dismutase over-expression vector pBAR GPE 1/LeMn-SOD;

FIG. 6 is an SDS-PAGE electrophoresis of pBAR GPE1/LeMn-SOD recombinant expression protein product, wherein lane 1 is protein Marker; lane 2 is an electropherogram of the E.coli expression protein product of the control group containing the empty vector pBAR GPE1 without IPTG induction; lane 3 is an electropherogram of the control E.coli expression protein product after IPTG induction with pBAR GPE1 empty vector; lane 4 is an electropherogram of E.coli proteins containing pBARGPE1/LeMn-SOD recombinant plasmid after IPTG induction; lane 5 is an E.coli protein expression electropherogram containing pBAR GPE1/LeMn-SOD recombinant plasmid without IPTG induction;

FIG. 7 shows the comparison of the growth rate of Escherichia coli before and after the LeMn-SOD gene of Lentinus edodes was transformed under cold stress (4 ℃ C.) (Note: P < 0.05;. P < 0.01;. P < 0.001; N.S.: P > 0.05);

FIG. 8 shows the comparison of the growth rate of Escherichia coli before and after the LeMn-SOD gene of Lentinus edodes was transferred under salt stress (6% NaCl) (note: P < 0.05;. P < 0.01;. P < 0.001; N.S.: P > 0.05);

FIG. 9 shows the growth rate of E.coli before and after transferring Volvariella volvacea VMn-SOD gene under salt stress (6% NaCl) (note: P < 0.05;. P < 0.01;. P < 0.001; N.S.: P > 0.05).

Detailed Description

The invention is further illustrated below with reference to specific embodiments and the accompanying drawings. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

According to the invention, mushroom strain 18 is used as a material, a local database is constructed through a mushroom genome, a mushroom manganese superoxide dismutase LeMn-SOD gene conserved sequence is found through local Blast, a CE Design V1.04 is used for designing a primer of a mushroom LeMn-SOD gene, a LeMn-SOD whole gene fragment is amplified from mushroom genome DNA, after PCR identification, a target fragment and a pBAR GPE1 carrier are connected and transformed into escherichia coli, sequencing is carried out by a handed-in bioengineering (Shanghai) limited company, the fragment length is 672bp, 223 encoded amino acids are shown as SEQ ID NO.2, and the 223 encoded amino acids are shown as SEQ ID NO. 1.

The bioinformatics analysis shows that the number of amino acids of the manganese superoxide dismutase (LeMn-SOD) is 223, the molecular weight of the protein is about 24.77kDa, and the isoelectric point (pI) is 5.11; the instability coefficient is 30.68, and the protein belongs to stable protein; the hydrophobicity index (GRAVY) was 0.931, indicating that the protein is hydrophobic. Signal peptide prediction is carried out on lentinus edodes LeMn-SOD by using SignalP 5.0 (figure 2), the result shows that the probability of the protein signal peptide is 0.0082, and the probability of the other protein signal peptides is 0.9918, and the lentinus edodes manganese superoxide dismutase LeMn-SOD is preliminarily judged to have no signal peptide and does not belong to secretory protein. The NetPhos 3.1 software predicts that the Ser phosphorylation sites of the LeMn-SOD protein of the mushroom are 9, the Thr phosphorylation sites are 5 and the Thy phosphorylation sites are 5 (figure 3). According to prediction of an EMBnet Tmpred transmembrane structure (figure 4), the TM helix length is between 17 and 33, the N end is positioned in an inside-out helix, and 2 transmembrane pores are formed, and the prediction result shows that the lentinus edodes LeMn-SOD is a one-way transmembrane protein and possibly related to membrane localization and transmembrane transport.

The invention connects the obtained lentinan superoxide dismutase LeMn-SOD gene sequence, the nucleotide sequence shown as SEQ ID NO.2 and an expression vector pBAR GPE1 to construct a prokaryotic expression vector pBAR GPE1/LeMn-SOD, transfers the prokaryotic expression vector pBAR GPE1/LeMn-SOD into escherichia coli, carries out heterologous expression by IPTG induction, extracts expression protein and analyzes by SDS-PAGE electrophoresis, and the result shows that an obvious protein band appears near 25kDa and is consistent with the expected result.

According to the invention, after escherichia coli which over-expresses lentinus edodes LeMn-SOD is respectively treated by low temperature (4 ℃) and salt stress (6% NaCl), the growth rate of the escherichia coli is measured, and the results show that the cold resistance and salt stress resistance of the escherichia coli can be remarkably improved by the heterologous expression of lentinus edodes manganese superoxide dismutase LeMn-SOD protein, and are respectively shown in fig. 7 and fig. 8.

Test materials

1.1 E.coli strains: stbl3 strain.

1.2 vectors

The expression vector was pBAR GPE1 (purchased from Ghman Biotech Co., Ltd.) having a total length of 5518bp and carrying an ampicillin (Amp) resistance gene.

2. Reagent

TABLE 1 reagents and sources

3. Instrument for measuring the position of a moving object

TABLE 2 instruments and sources

Name of instrument	Origin of origin
		Voltage-stabilizing electrophoresis apparatus	Bio-Rad
Gel imager	Haimen Kylin-Bell Lab Instruments Co.,Ltd.
		Bacteria shaking table	SHANGHAI YIHENG INSTR Co.,Ltd.
Bacteria incubator	SHANGHAI YIHENG INSTR Co.,Ltd.
		PCR instrument	Eppendorf
High-speed centrifugal machine	Thermo
		Disposable plate	Shanghai dust organisms Ltd
50mL polypropylene tube	Corning
		Liquid transfer device	Gilson

4. Preparation of commonly used solutions

4.1 ampicillin stock:

dissolving lg ampicillin in 10mL deionized water to reach a final concentration of 100mg/mL, filtering and sterilizing with a 0.22 μm microporous membrane, subpackaging, and storing at-20 ℃ for later use.

4.2 IPTG：

IPTG was prepared as a 24mg/mL (100mM) aqueous solution, which was sterilized by filtration through a 0.22 μm microporous membrane, aliquoted and stored at-20 ℃ until needed.

4.3 PBS buffer:

NaCl 137mmol/L，KCl 2.7mmol/L，Na₂HPO₄10mmol/L，KH₂PO₄1.76mmol/L, adding distilled water to reach a constant volume of 1000mL, and adjusting the pH value to 7.2-7.4.

4.4 electrode Buffer (Running Buffer):

3.1g of Tris, 18.8g of glycine and 1g of SDS, and adding distilled water to the solution to reach the constant volume of 1L.

Example 1 construction of manganese superoxide dismutase LeMn-SOD overexpression vector pBARGPE1/LeMn-SOD in Lentinus edodes 18

Firstly, designing a primer to amplify a target gene LeMn-SOD fragment from an original plasmid, and recombining the target gene LeMn-SOD fragment to an over-expression vector after enzyme digestion by seamless cloning identification sites contained at two ends of the primer; the ligation product is transferred into a prepared competent cell of escherichia coli Stbl3, the grown monoclonal colony is sent to a company Limited in Biotechnology engineering (Shanghai) for sequencing identification, the over-expression plasmid pBAR GPE1/LeMn-SOD with successful construction is obtained by comparing the correct clone sequence, and the map is shown in figure 5 after the successful construction.

1. Design and Synthesis of primers

(1) Designing PCR amplification fragment primers, and introducing homologous sequences at the tail ends of the linearized cloning vectors into the 5 ' ends of the primers, so that the 5 ' and 3 ' extreme sequences of amplification products are completely consistent with the two tail end sequences of the linearized cloning vectors respectively.

(2) The designed primer sequences (as shown in the following table) were synthesized by Biotechnology engineering (Shanghai) Inc.

The primer sequences 5 'to 3' are as follows:

LeMn-SOD-F(SEQ ID NO.3)：

ACCTCGACTCTAGAGGATCCGCCACCATGTTCTCTCTTGTTCGAACTACTTTACG；

LeMn-SOD-R(SEQ ID NO.4)：

CGATAAGCTTGATATCGAATTCTTACTGGACTTCCACCAAGCG。

2. double digestion of vector pBAR GPE1

(1) Stbl3 bacterial liquid containing pBAR GPE1 vector was cultured overnight, and 3-5mL of fresh bacterial liquid was taken to extract plasmid. The specific method refers to QIAGEN plasmid miniprep.

(2) Mu.g of the plasmid was digested simultaneously with the restriction enzymes BamH I and EcoR I. The enzyme digestion system is as follows:

carrier	1μg
		green Buffer	3μL
BamH I	1.5μL
		EcoR I	1.5μL
ddH₂O	Make up to 30. mu.L

The cleavage was carried out at 37 ℃ for about 3 h.

(3) Carrying out agarose gel electrophoresis on the enzyme digestion product, and after the electrophoresis is finished, carrying out gel recovery, wherein the steps are as follows: the gel strip containing the desired fragment was cut under an ultraviolet lamp. The weight of the gel was calculated by subtracting the weight of the empty tube from the total weight of the balance, the volume of the gel was calculated as 100mg to 100. mu.L, and 1 time the volume of the gel was added to the mixture and the mixture was thoroughly thawed in a 65 ℃ water bath. During which the EP tube was shaken properly to speed up the dissolution of the gel.

(4) The whole amount of the above liquid was transferred to a filter column, and centrifuged at 13000rpm for 30S (repeated once). Then, the liquid in the tube WAs discarded, and 500. mu.L of WA Solution WAs added to the column, followed by centrifugation at 13000rpm for 30S. The liquid in the tube was discarded, and 500. mu.L of Wash Solution was added to the column, centrifuged at 13000rpm for 30S (repeated), and then left to empty for 3 min. The column was placed in a new 1.5mL EP tube and allowed to air dry at room temperature. Finally 35. mu.L of ddH was added to the column₂O, standing for 5min, and centrifuging at 13000rpm for 1.5 min. To increase the recovery rate, the dissolved DNA can be added to the column again and centrifuged for 1 min. The column was discarded, the recovered vector fragment, and the concentration was determined.

3. Amplification of fragments of interest

(1) The synthesized primers were diluted to a stock solution with a final concentration of 10. mu. mol/L.

(2) PCR amplification was performed using diluted primers and template. The system is as follows:

form panel	1-2μg
		Primer-F	2μL
Primer-R	2μL
		PCR mix	25μL
ddH₂O	Make up to 50. mu.L

The materials are added into a thin-wall tube, mixed evenly and placed into a PCR instrument after point separation, and proper annealing temperature and extension temperature are selected, so that PCR amplification can be started.

(3) After the PCR is finished, agarose gel electrophoresis is carried out, and the target gene is recovered. The recovery method is the same as above.

4. Ligation of the overexpression vector to the fragment of interest (seamless cloning)

(1) And (3) determining the concentrations of the recovered pBAR GPE1 vector and the target fragment of the shiitake mushroom manganese superoxide dismutase (LeMn-SOD).

(2)Hieff Clone^TMThe usage amount of the most suitable cloning vector of the recombination reaction system is 0.03 pmol; the optimum molar ratio of cloning vector to insert was 1:2, i.e., the optimum amount of insert used was 0.06 pmol. The DNA mass corresponding to these mole numbers can be calculated by the following formula:

the optimum amount of cloning vector used was [0.02 Xcloning vector base pair ] ng (0.03pmol)

The optimum amount of insert used was [0.04 Xthe number of bases of insert ] ng (0.06pmol)

(3) And the over-expression vector pBAR GPE1 is connected with a target fragment of shiitake manganese superoxide dismutase (LeMn-SOD). The linking system is as follows:

ligation was performed at 50 ℃ for 20 min.

5. Transformation of

(1) The competent cells Stbl3 were placed on ice (4 ℃ C.) and left to thaw spontaneously, and 10. mu.L of the ligation product was added to the competent cells and left on ice (4 ℃ C.) for 30 min.

(2) Then, the mixture was heat-shocked in a water bath at 42 ℃ for 90S. Then quickly placed on ice (4 ℃) for 2-3 min.

(3) 500. mu.L of LB medium containing no antibiotic was added thereto, and shaking culture was carried out at 37 ℃ and 225rpm for 45 min.

(4) Centrifuging at 3000rpm for 2min, discarding 900 μ L of supernatant, blowing the bacterial solution at the bottom of the tube, adding into a culture plate containing 100 μ g/mL Amp, coating with a sterilized applicator (the temperature of the applicator cannot be too high to avoid killing the thallus), and culturing overnight in a 37 deg.C incubator.

6. Sending and testing

Two Send-to-Engineer (Shanghai) Co., Ltd. were selected for sequencing and identification for each clone. The correctly sequenced bacterial solution was added to a sterile EP tube at a ratio of 1:1 with 15% glycerol and bacterial solution, and then stored at-80 ℃.

Example 2 prokaryotic expression of LeMn-SOD Gene of Lentinus edodes

1. A single colony of Escherichia coli Stbl3 containing pBAR GPE1/LeMn-SOD was inoculated into 100mL of LB liquid medium containing 100. mu.g/mLAmp, cultured at 220rpm and 37 ℃ until OD600 reached 0.6-0.8, then added into 100mL of liquid LB using IPTG at a concentration of 1mM, and cultured at 220rpm and 37 ℃ for 4 hours to optimize the induction culture conditions. The empty vector pBAR GPE1 was also transformed into Stbl3 as a control.

2. Extracting prokaryotic expression protein to carry out SDS-PAGE electrophoresis

Preparation of protein sample

(1) Adding 1mL of the bacterial liquid obtained in the step 1 into 100mL of LB liquid culture medium containing 100 mu g/mL Amp, culturing at 37 ℃ for 2.5-3h at 220r/min, and adding IPTG (isopropyl-beta-thiogalactoside) with the concentration of 1mM for induction when OD600 reaches 0.4-0.6 by using an ultraviolet spectrophotometer;

(2) adding IPTG, continuing culturing for 6h, transferring the bacterial liquid into a 50mL sterile centrifuge tube, and centrifuging for 10min at 4 ℃ under the condition of 5000 r/min;

(3) adding 3mL of PBS into a sterile centrifuge tube, sucking and uniformly mixing the thalli by using a gun head, and adding 2.4 mu of LProtease Inhibitor Cocktail to protect protein from being damaged; adding 200 μ L of lysis solution, standing at-4 deg.C for 30 min; centrifuging the crushed thallus at 4 deg.C and 8000r/min for 10 min;

(4) taking 50 μ L of the centrifuged supernatant, putting the supernatant into a sterile centrifuge tube, adding 12.5 μ L of 5 Xprotein LoadingBuffer, boiling in a metal water bath at 100 ℃ for 10min, and storing at-80 ℃.

(SDS-PAGE) gel electrophoresis

(1) Preparing a glass plate, washing an electrophoresis rack, an electrophoresis tank and the like by using clear water, wiping the glass plate clean by using filter paper, and then installing an electrophoresis device;

(2) determining the concentration of gel, preparing gel according to the kit, and preparing 15% separation gel and 3% concentrated gel; after solidification, inserting a comb, placing in a constant temperature incubator at 37 ℃ for 30min, and taking care to avoid generating bubbles during insertion;

(3) after the concentrated gel is fixed, pulling out the comb, cleaning the gel plate by using double distilled water, fixing the gel plate in an electrophoresis tank, injecting the prepared electrophoresis buffer solution into an upper electrophoresis tank and a lower electrophoresis tank, and checking whether the electrophoresis tank leaks or not;

(4) sequentially injecting 20 mu L of protein samples into the loading holes;

(5) when the gel is concentrated, the voltage is 80V; the voltage of the separation gel is 120V;

(6) after electrophoresis, putting the gel into a clean box, adding Coomassie brilliant blue dye solution, and dyeing for 60 min;

(7) after dyeing, placing the Coomassie brilliant blue dye solution in a recovery bottle;

(8) adding a destaining solution, covering the surface of the gel, and changing the destaining solution for 1h until the gel is transparent, so that clear protein bands can be observed;

(9) the protein gel was photographed and then the results were analyzed.

The electrophoresis result is shown in figure 6, an obvious protein band appears at 25kDa, the expression level is obviously higher than that of an empty vector control group, and the result shows that the lentinus edodes LeMn-SOD is successfully expressed heterologously in escherichia coli.

Example 3 study of LeMn-SOD protein Cold-resistant function of Lentinus edodes

1. Sucking 50 mu L of bacterial liquid which is verified to be correct, inoculating the bacterial liquid into 50mL LB liquid culture medium containing 100 mu g/mL Amp, culturing at 37 ℃ for 2.5-3h at 150r/min, detecting by using an ultraviolet spectrophotometer until OD600 reaches 0.4-0.6, and adding 1mM IPTG for induction;

2. placing in an incubator at 4 ℃ and carrying out cold stress for 24h, 36h, 48h, 60h and 72 h;

3. taking 3mL of the bacterial liquid after cold stress treatment, detecting the absorbance at 600nm by using an ultraviolet spectrophotometer, and recording data. Each experimental gradient was set up in 3 replicates.

4. The growth rates of Escherichia coli containing pBAR GPE1/LeMn-SOD and Escherichia coli containing pBAR GPE1 were calculated by comparing the absorbance of the treated 0h bacterial suspension OD600, and a line graph of the growth rate after cold stress was prepared (note: growth rate-cold treated Escherichia coli OD 600/control OD600), as shown in FIG. 7.

As can be seen from FIG. 7, the growth rates of the Escherichia coli containing pBAR GPE1/LeMn-SOD are respectively increased by 11.22%, 3.45% and 4.78% compared with the growth rate of the Escherichia coli containing pBAR GPE1 empty vector under cold stress of 48h, 60h and 72h, and the growth rate difference between the two reaches a significant level (P <0.05), which indicates that the cold tolerance of the Escherichia coli Stbl3 is indeed and significantly improved by the introduction and expression of the LeMn-SOD gene of the lentinan superoxide dismutase. Compared with straw mushroom pBAR GPE1/VMn-SOD disclosed by Chinese patent 2019109334585, when cold stress is carried out for 48h at 4 ℃ (namely 2d), the growth rate of escherichia coli containing the mushroom pBAR GPE1/LeMn-SOD is increased by 11.22% compared with that of escherichia coli containing pBAR GPE1 empty vector, and the two are very significantly different (P is less than 0.001); and the growth rate of the Escherichia coli containing the volvariella volvacea pBAR GPE1/VMn-SOD in 4d cold stress at 4 ℃ (96 h) is basically consistent with that of the Escherichia coli containing the pBAR GPE1 empty vector, and no significant difference occurs between the two. The introduction and expression of the shiitake mushroom manganese superoxide dismutase (LeMn-SOD) gene are proved to obviously shorten the improvement time of the cold stress resistance of escherichia coli.

Example 4 study of salt tolerance of LeMn-SOD protein of Lentinus edodes

1. Sucking 50 μ L of the correct bacteria liquid, inoculating into 50mLLB liquid culture medium containing 100 μ g/mL Amp with NaCl salt concentration of 6%, culturing at 37 deg.C for 2.5-3h at 150r/min, and adding 1mM IPTG for induction when OD600 reaches 0.4-0.6 by UV spectrophotometer;

2. placing in an incubator at 37 deg.C, and culturing for 2h, 4h, 6h, and 8 h;

3. taking 3mL of the bacterial solution subjected to stress treatment by 6% NaCl salt, detecting the absorbance at 600nm by using an ultraviolet spectrophotometer, and recording data. Each experimental gradient was set up in 3 replicates.

4. The growth rates of pBAR GPE 1/LeMn-SOD-containing E.coli and pBAR GPE 1-containing E.coli were calculated using the absorbance of the treated 0d bacterial suspension OD600 as a control, and a line graph of the growth rates after salt stress was prepared as shown in FIG. 8 (note: growth rate: NaCl-treated E.coli OD 600/control OD 600).

As can be seen from FIG. 8, when 6% NaCl salt is stressed for 2h, 4h, 6h and 8h, the growth rate of the Escherichia coli containing pBAR GPE1/LeMn-SOD is respectively increased by 4.95%, 5.55%, 6.39% and 6.67% compared with that of the Escherichia coli containing pBAR GPE1 empty vector, and the growth rate of the Escherichia coli containing pBAR GPE1/LeMn-SOD is significantly higher than that of the Escherichia coli containing pBAR GPE1 (P is less than 0.05), which indicates that the salt tolerance of the Escherichia coli Stbl3 is actually and significantly improved by the introduction and expression of the LeMn-SOD gene.

The salt concentration of the volvariella volvacea pBAR GPE1/VMn-SOD disclosed in Chinese patent 2019109334585 is 1% NaCl, which is far lower than the salt concentration of 6% NaCl in the patent. As shown in figure 9, after the escherichia coli over-expressing the Volvariella volvacea VMn-SOD is stressed for 4 hours by 6% NaCl salt, the growth rate of the escherichia coli over-expressing the Volvariella volvacea VMn-SOD is obviously lower than that of the escherichia coli containing pBAR GPE1 empty vector (P is less than 0.05), which indicates that the salt tolerance of the escherichia coli is not improved by transferring and expressing the Volvariella volvacea VMn-SOD under the stress of 6% NaCl salt, and the salt tolerance improvement effect of the escherichia coli is far less good than that of the escherichia coli after the lentinus edo. Specifically, when 6% NaCl salt is stressed for 8 hours, the growth rate of the Escherichia coli containing pBAR GPE1/VMn-SOD is reduced by 5.67% compared with that of the Escherichia coli containing pBAR GPE1 empty vector; the growth rate of the Escherichia coli containing pBARGPE1/LeMn-SOD is improved by 6.67 percent compared with the growth rate of the Escherichia coli containing pBAR GPE1 empty vector.

Sequence listing

<110> Shanghai city academy of agricultural sciences

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>223

<212>PRT

<213> mushrooms (Lentinula edodes)

<400>1

Met Phe Ser Leu Val Arg Thr Thr Leu Arg Pro Ser Leu Ala Gln Arg

1 5 10 15

Ala Ala Arg Ala Phe Ala Ala Pro Ser Ala Ser Ala Leu Leu His Thr

20 25 30

Leu Pro Glu Leu Pro Tyr Ala Tyr Asn Ala Leu Glu Pro Phe Ile Ser

35 40 45

Glu Glu Ile Met Thr Leu His His Gln Lys His His Gln Thr Tyr Val

50 55 60

Asn Gly Leu Asn Ala Ala Glu Glu Leu Tyr Ala Lys Ser Pro Ser Val

65 70 75 80

Lys Glu Gln Ile Thr Leu His Ala Ala Leu Lys Phe Asn Gly Gly Gly

85 90 95

His Ile Asn His Thr Leu Phe Trp Lys Asn Leu Ala Pro Ala Ser Ala

100 105 110

Asp Gly Gly Lys Leu Thr Asp Gly Pro Leu Lys Thr Ala Ile Glu Ser

115 120 125

Asp Phe Gly Ser Val Asp Asn Phe Lys Lys Val Phe Ser Ala Lys Thr

130 135 140

Ala Ala Ile Gln Gly Ser Gly Trp Gly Trp Leu Gly Tyr Asn Ser Asp

145 150 155 160

Thr Lys Lys Leu Glu Ile Val Thr Thr Ala Asn Gln Asp Pro Leu Leu

165 170 175

Ser His Thr Pro Leu Ile Gly Ile Asp Ile Trp Glu His Ala Phe Tyr

180 185 190

Leu Gln Tyr Lys Asn Val Lys Pro Asp Tyr Leu Asn Ala Ile Trp Asn

195 200 205

Val Ile Asn Phe Lys Glu Ala Glu Lys Arg Leu Val Glu Val Gln

210 215 220

<210>2

<211>672

<212>DNA

<213> mushrooms (Lentinula edodes)

<400>2

atgttctctc ttgttcgaac tactttacga ccctctctgg cgcaacgtgc agcccgtgcc 60

ttcgctgctc ccagtgcttc cgccttgctt catacactcc cggagcttcc ctatgcttat 120

aatgctctcg aacccttcat ctcggaagaa attatgacgc ttcaccacca aaagcatcat 180

caaacttatg tcaacggatt aaacgcagcg gaagaattat acgccaaatc cccttctgtc 240

aaagaacaaa tcactttgca cgcagcactg aaattcaatg gtggaggtca cataaaccac 300

accctgttct ggaaaaacct ggcacctgcg agcgcagacg gaggaaagct caccgacgga 360

cctctaaaaa ccgcgattga gagtgacttt ggttctgtcg ataacttcaa aaaagttttc 420

agtgcaaaaa cggctgctat ccaaggaagt ggttggggct ggcttggtta caattccgat 480

acgaagaagt tggaaattgt caccactgcg aatcaagacc ctctcctctc ccatactcca 540

ctcattggca tcgatatctg ggagcacgcc ttctacttac aatacaagaa cgtgaagcca 600

gactatctca atgccatttg gaatgtaatc aacttcaagg aggctgagaa acgcttggtg 660

gaagtccagt aa 672

<210>3

<211>55

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

acctcgactc tagaggatcc gccaccatgt tctctcttgt tcgaactact ttacg 55

<210>4

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

cgataagctt gatatcgaat tcttactgga cttccaccaa gcg 43

Claims

1. The application of the lentinus edodes manganese superoxide dismutase LeMn-SOD in improving the stress tolerance of microorganisms is characterized in that the amino acid sequence of the lentinus edodes manganese superoxide dismutase LeMn-SOD is shown as SEQ ID No.1, and the nucleotide sequence of the coding gene of the lentinus edodes manganese superoxide dismutase LeMn-SOD is shown as SEQ ID No. 2.

2. Use according to claim 1, wherein the microorganism is a fungus or a bacterium.

3. The use according to claim 1, wherein the microorganism is Escherichia coli.

4. The use according to claim 1, wherein the stress tolerance is cold stress tolerance and salt stress tolerance.

5. The use according to claim 1, wherein the stress tolerance of the microorganism is improved by transferring an expression vector containing lentinan superoxide dismutase (LeMn-SOD) gene into a host cell of the microorganism.

6. The application of claim 5, wherein the expression vector containing lentinus edodes manganese superoxide dismutase LeMn-SOD gene is pBAR GPE1/LeMn-SOD, and is constructed by connecting a nucleotide fragment containing the lentinus edodes manganese superoxide dismutase LeMn-SOD gene with pBAR GPE1 plasmid which is subjected to double enzyme digestion by BamH I and EcoRI.

7. The use as claimed in claim 6, wherein the cold stress resistance and salt stress resistance of Escherichia coli are improved by transferring expression vector pBAR GPE1/LeMn-SOD containing lentinan superoxide dismutase (LeMn-SOD) gene into Escherichia coli.