CN111867625A - Novel EHVs with deactivated UL18 and/or UL8 - Google Patents

Novel EHVs with deactivated UL18 and/or UL8 Download PDF

Info

Publication number
CN111867625A
CN111867625A CN201980019028.0A CN201980019028A CN111867625A CN 111867625 A CN111867625 A CN 111867625A CN 201980019028 A CN201980019028 A CN 201980019028A CN 111867625 A CN111867625 A CN 111867625A
Authority
CN
China
Prior art keywords
nucleotides
ehv
sequence
vector
virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201980019028.0A
Other languages
Chinese (zh)
Inventor
R·库昆特拉
J·M·拉森
R·B·曼德尔
L·N·佩尔茨
E·M·沃恩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boehringer Ingelheim Vetmedica GmbH
Original Assignee
Boehringer Ingelheim Vetmedica GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boehringer Ingelheim Vetmedica GmbH filed Critical Boehringer Ingelheim Vetmedica GmbH
Publication of CN111867625A publication Critical patent/CN111867625A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16051—Methods of production or purification of viral material
    • C12N2710/16052—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16061—Methods of inactivation or attenuation
    • C12N2710/16062—Methods of inactivation or attenuation by genetic engineering
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16734—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16741—Use of virus, viral particle or viral elements as a vector
    • C12N2710/16743—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16761—Methods of inactivation or attenuation
    • C12N2710/16762—Methods of inactivation or attenuation by genetic engineering
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16071—Demonstrated in vivo effect

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Pulmonology (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention relates to the field of (vector) vaccines, and in particular to novel EHVs with inactivated UL18 and/or UL 8. The invention further relates to related expression cassettes and vectors suitable for expressing a gene of interest, particularly an antigen-encoding sequence. The viral vectors of the invention can be used to produce immunogenic compositions or vaccines.

Description

Novel EHVs with deactivated UL18 and/or UL8
Sequence listing
The present invention comprises a sequence listing according to 37 c.f.r.1.821-1.825. This sequence listing is incorporated by reference into this application.
Technical Field
The present invention relates to the field of (vector) vaccines, and in particular to the inactivation of UL18 and/or UL8 in EHV. The invention further relates to replication deficient EHVs having inactivation of UL18 and/or UL 8. The invention further relates to related expression cassettes and vectors suitable for expression of genes of interest, particularly antigen coding sequences. The viral vectors of the invention can be used to produce immunogenic compositions or vaccines.
Background
Equine pathogen equine alphaherpesvirus 1 (equine abortion virus, EHV-1) belongs to the genus varicella virus of the subfamily alphaherpesviridae of the order herpesviridae. Large enveloped viruses with a double-stranded DNA genome of about 150,000 base pairs. Other important members of the subgenus varicella are human alphaherpesvirus 3 (varicella zoster Virus), porcine alphaherpesvirus 1 (pseudorabies Virus), bovine alphaherpesvirus 1 (infectious bronchitis Virus) and equine alphaherpesvirus 4 (equine rhinopneumovirus, EHV-4) (Virus Taxinomy: 2015 Release EC 47, London, UK, 7 months 2015; Emailration 2016(MSL number 30)). EHV-1 and EHV-4 are endemic and affect horses throughout the world. While EHV-4 causes a majority of mild infections of the upper respiratory tract, EHV-1 can cause systemic infections ranging from respiratory symptoms to abortion and fatal encephalomyelitis, depending on the host strain and immune status. There are currently two licensed Modified Live Vaccines (MLV) against EHV-1 in the United states and Europe, respectively
Figure BDA0002679943200000011
(Boehringer Ingelheim) and
Figure BDA0002679943200000012
(MSD). Both contain a classical attenuated EHV-1RacH strain, which was passaged 256 times in porcine epithelial cells for attenuation (Ma et al 2013). The mechanism of attenuation has been studied on a molecular level. Osterrieder et al (1996) showed that RacH lacks two genomic copies of orf67(IR6) and that recovery of one copy is sufficient to restore virulence. In addition, RacH carries a 1283bp deletion, thereby removing more than 90% of the coding sequence encoding orf1(UL56) of the immunosuppressive viral proteins. Other mutations may also affect attenuation, but have not been studied in detail so far. This all makes RacH an extremely safe vaccine strain since reversion to virulence by passage in vaccinated animals is largely impossible (if possible).
Two variants of the Bacterial Artificial Chromosome (BAC) of escherichia coli, pRacH and pRacH-SE, possessing the entire genome of the equine alpha herpes virus 1(EHV-1) vaccine strain RacH, are known as platforms for vector vaccine development. BAC pRach-SE line was generated based on pRach, a BAC originally cloned in the laboratory of Klaus Osterioder, FU Berlin. pRach has a deletion of orf71(US5) encoding glycoprotein II (gpII; Wellington et al, 1996). The BAC-vector sequence and GFP expression cassette were introduced at their location. In order to rescue unmodified EHV-1RacH from pRacH, it must be co-transfected with a plasmid containing the entire orf71(US5) plus flanking region, such that during viral replication, the BAC-vector sequence portion and GFP expression cassette are replaced via homologous recombination with orf71(US5) such that the original RacH genome will be restored. pRach is modified in the present invention so that the BAC-vector sequence/GFP expression cassette is self-excisable (SE) when transfected in cell culture (Tischer et al, 2007). This modified BAC was named pRach-SE. Both pRach and pRach-SE can be used as a platform for vector vaccine development, the only difference being that pRach-SE favours significant rescue of orf71(US5) repaired virus.
It has been shown that EHV-1RacH based vector vaccines are able to elicit immunity in several mammalian species, including pigs, cattle and dogs (Rosas et al, 2007, Rosas et al 2008, Trapp et al 2005, Said et al 2013). The gene encoding the antigenic protein of the pathogen may be expressed by recombinant EHV-1 RacH. The EHV-1-RacH genome is manipulated in escherichia coli in its BAC form, and is typically tailored to express additional proteins by insertion of a transgenic expression cassette (Tischer et al, 2010). When pRacH-SE DNA is transfected in permissive cells in culture, EHV-1 replication is initiated by cellular transcription factors. The activity of the viral DNA polymerase results in the deletion of all BAC-vector-associated sequences and the restoration of the EHV-1RacH genome to its original state. The infectious virus produced was indistinguishable from RacH.
When pRacH-SE is manipulated in e.coli, e.g. by inserting a transgenic expression cassette, the reconstituted virus will be modified after transfection in permissive cells and will express additional genes. The recombinant EHV-1RacH can be used as a vector vaccine.
The wild-type EHV-1 strain had three open reading frames (orf) at one end of a long unique segment of its genome, designated orf1(UL56), orf2 and orf3 (sequence coordinates 1298-3614; FIG. 1). Orf1(UL56) and Orf3 were contiguously disposed on one strand of DNA, while Orf2 was encoded by the complementary strand. Vaccine strain RacH has a 1283bp deletion in this region affecting orfs 1 and 2, indicating that these genes are not essential for viral replication. For this purpose, this site serves as a transgene insertion site. This insertion site is designated ORF1/3(UL 56).
However, the size and number of transgenes that can be inserted into the insertion site of ORF1/3(UL56) is generally limited. Thus, there is an unmet need for novel and alternative methods of inserting and expressing transgenes from EHV vectors, particularly recombinant EHV-1RacH vectors, in order to enhance the capacity of EHV vectors.
It may be beneficial to have a replication-defective EHV vector vaccine. The replication deficient EHV vector vaccines are incapable of replication in a host animal and are not transmitted from one animal to another, and therefore, are advantageous for safety or regulatory reasons.
Barnard et al 1997 (Virology; 237,97-106) demonstrated that some UL8 mutants in herpes simplex virus type 1 show some replication inhibition. Furthermore, Muylaert et al, 2012(Journal of biological chemistry; Vol.287, No. 40, p.33142-33152) describes some UL8 mutants of herpes simplex virus type 1 that are deficient in DNA synthesis. In addition, some mutations were introduced into EHV, and similar phenotypes were observed when the corresponding mutations were introduced into EHV-1UL 8.
CN 105641692A describes the complete deletion (knock-out) of UL18 in herpes simplex virus type 1 (HSV-1). However, CN 105641692 a demonstrated that plaque inhibition was reduced by about 80% for this HSV-1UL18 knockout, but replication was not completely eliminated. In addition, CN 105535959 also studied the phenotype of the HSV-1UL18 knockout, and demonstrated significantly lower replication and infection and little to no infection was observed. Thus, with respect to replication, CN 105535959 sets forth a phenotype similar to CN 105641692A (replication reduced but not completely eliminated). In addition, CN 105535959 states that there is little infection with the HSV-1UL18 knockout, which is problematic for vector vaccines (e.g., recombinant EHV vaccines) because they must infect host cells to provide an adequate immune response. In particular, infectivity and transgenesis in infected cells are essential for the effectiveness of vector vaccines expressing foreign antigens. Thus, there is an unmet need for replication-defective (but infectious) EHV vector systems.
Disclosure of Invention
To enhance the ability of EHV vectors, the present invention provides means to generate replication-defective EHVs and to insert and express transgenes from EHV vector backbones.
The present invention relates to replication-deficient EHVs comprising inactivation of UL18 and/or UL8 and novel alternative transgene insertion sites UL18 and/or UL8, which can be used for insertion of transgene sequences and expression of transgene proteins from EHV vectors.
Inactivation of UL8 and/or UL18 is complete or partial deletion, complete or partial truncation, complete or partial substitution, complete or partial inversion, insertion.
The invention further relates to a mammalian host cell comprising the replication deficient EHV vector of the invention.
The invention further relates to cell lines expressing UL8 and/or UL18 of EHV or a functional part thereof for use in culturing replication deficient EHV vectors of the invention.
The invention further relates to a cell line comprising a plasmid comprising an expression cassette comprising UL8 and/or UL18 of EHV or a functional part thereof, wherein the cell line expresses UL8 and/or UL18 or a functional part thereof.
The invention further relates to a method for producing replication-defective equine alpha herpesvirus (EHV) comprising inactivating UL18 and/or UL8 according to the invention.
The present invention further relates to a method of producing a replication-deficient equine alpha herpes virus (EHV), comprising the steps of:
a) providing a wild-type EHV or an attenuated EHV;
b) inactivating UL18 and/or UL8 of the EHV of step a) and selecting an EHV clone without the full or functional portion of UL18 and/or UL 8;
c) providing a complementing cell line expressing UL18 and/or UL8 or a functional part thereof;
d) obtaining a replication deficient equine alpha herpes virus (EHV) by culturing the EHV of step b) with the complementing cell line of step c).
The invention further relates to immunogenic compositions comprising one or more EHV vectors of the invention.
The invention further relates to a method of immunizing an individual comprising administering to the individual the immunogenic composition of the invention.
The invention further relates to a method of treating or preventing clinical signs caused by a pathogen in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of an immunogenic composition of the invention.
The technical problem is therefore solved by the description and the embodiments characterized in the claims, and the different aspects of the invention are realized according to the claims.
These properties allow for the generation of recombinant vector vaccines based on making EHVs replication-deficient by inactivation of UL18 and/or UL 8. Furthermore, an antigen may be inserted into the EHV vector. At least one antigen from another insertion site ORF1/3(UL56) and/or US4(ORF70) or at least two different antigens with similar efficiency at the same time can be expressed from ORF1/3(UL56) and/or US4(ORF 70). Furthermore, at least one antigen from the newly elucidated insertion site of UL18 and/or UL8 or at least two different antigens with similar efficiency simultaneously as from the newly described UL18 and/or UL8 may be expressed. Furthermore, antigens from the newly described UL18 and/or UL8 insertion site and the further insertion site ORF1/3(UL56) and/or US4(ORF70) may be expressed. Replication-defective EHV vector vaccines are advantageous for safety and regulatory reasons. Furthermore, if the vaccine target is composed of two or more different pathogens/antigens, the use of novel UL18 and/or UL8 insertion sites in parallel with having established insertion sites, such as ORF1/3(UL56) and/or US4(ORF70), can significantly reduce the cost of goods and represent a distinct advantage over vectors expressing only one antigenic component.
Drawings
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
FIG. 1: plasmid map of expression plasmid pCEP-ORF43 (CO). This vector expresses the codon optimized EHV-1ORF43 gene via the CMV promoter and is used to generate one of the stable cell lines.
FIG. 2: plasmid map of expression plasmid pCEP-ORF54 (CO). This vector expresses the codon optimized EHV-1ORF54 gene via the CMV promoter and is used to generate one of the stable cell lines.
FIG. 3: schematic of cloning of mCMV-driven RFP in the ORF43 site in EHV-1BAC DNA, with the ORF42-ORF45 region enlarged.
UL is a long unique segment
US is a short unique segment
IR-internal inverted repeat sequence
TR-terminal inverted repeat sequence
orf-open reading frame
bp ═ base pair
FIG. 4: schematic of RFP cloning in the ORF43 site in EHV-1BAC DNA, wherein the ORF42-ORF45 region is amplified.
UL is a long unique segment
US is a short unique segment
IR-internal inverted repeat sequence
TR-terminal inverted repeat sequence
orf-open reading frame
bp ═ base pair
FIG. 5: modified RED recombination for cloning RFP in the ORF43 region. The upper diagram: the plasmids are not to scale. The SceI/Kan plasmid was digested with I-CeuI restriction endonucleases. The SceI/Kan fragment (flanking ORF43 sequence) was transformed into GS183 cells carrying EHV-/RacH BAC DNA. Chloramphenicol (Chloramphenicol) and Kanamycin (Kanamycin) were selected for EHV-1/RacH clones in which ORF43 was replaced by SceI/Kan. The intermediate clone was named EHV-1/SceI-Kan. The following figures: the plasmids are not to scale. RFP (flanking ORF43 sequence) g-segment DNA was transformed into GS1783 cells harboring EHV-1/SceI-Kan, incubated with arabinose and selected with chloramphenicol/arabinose. The SceI/Kan fragment was replaced with RFP DNA at ORF43 in the EHV-1/Sce-Kan clone to generate EHV-1-43-RFP.
FIG. 6: schematic of cloning of mCMV-RFP-pA in EHV-1BAC DNA in EHV-1ORF 54 site, with the ORF53-ORF55 region enlarged.
UL is a long unique segment
US is a short unique segment
IR-internal inverted repeat sequence
TR-terminal inverted repeat sequence
orf-open reading frame
bp ═ base pair
FIG. 7: ST (upper panel), ST-43-CO and (middle panel) ST-54-CO cells were infected with EHV-1/RacH virus showing similar CPE. Infected cells expressed GFP (right panel), but not RFP (data not shown)
FIG. 8: ST (upper panel) and ST-43-CO and (lower panel) rEHV-1-43-RFP virus. Infected cells expressed GFP (middle panel) and RFP right panel), but viral transmission and CPE was only observed in rhelv-1-43-RFP virus infected ST-43-CO cells.
FIG. 9: ST (upper panel) and ST-43-CO and (lower panel) rEHV-1-43-mCMV-RFP virus. Infected cells expressed GFP (middle panel) and RFP right panel), but viral transmission and CPE was only observed in rhelv-1-43-mCMV-RFP virus infected ST-43-CO cells.
FIG. 10: ST (upper panel) and ST-54-CO and (lower panel) rEHV-1-54-mCMV-RFP virus. Infected cells expressed GFP (middle panel) and RFP (right panel), but viral transmission and CPE were only observed in rhelv-1-54-mCMV-RFP virus infected ST-54-CO cells.
FIG. 11: plasmid map of transfer vector pU70-p455-71K71
FIG. 12: plasmid map of a transfer plasmid for inserting the expression cassette p455-H3-71 into ORF70 of EHV-1RacH
FIG. 13: schematic representation of the genome of rEHV-1RacH-SE-70-p455-H3 with the orf70 insertion region magnified. orf 69: open reading frame No. 69 upstream of the insertion site in orf 70; p 455: novel promoters described herein, see, e.g., example 1; h3: transgenic influenza virus hemagglutinin; 71 pA: novel polyadenylation sequences; Δ orf 70: the remainder of orf70, which contains the promoter of orf71, encodes the structural viral glycoprotein ii (gpii).
FIG. 14: indirect immunofluorescence analysis: indirect immunofluorescence assay of VERO cells infected with rEHV-1RacH-SE-70-p455-H3
At 24h post infection (p.i.), cells were fixed with ethanol and air dried. H3 was shown by fluorescence microscopy in cells infected with recombinant EHV-1RacHSE-70-p455-H3 using a commercially available monoclonal antibody against H3 as the primary antibody and FITC-conjugated rabbit anti-mouse IgG as the secondary antibody.
FIG. 15: mean body temperature of each group before challenge and 1, 2 and 3 days after challenge. Error bars, standard deviation. Each study day was from left to right: negative control group (neg. ctrl.), challenge control group (chall. ctrl.), animals vaccinated once with RacH-SE-70-p455-H3 (1 EHV-1), animals vaccinated twice with RacH-SE-70-p455-H3 (2 EHV-1) or animals vaccinated twice with inactivated porcine IAV (2X kill).
FIG. 16: mean lung scores for each group at 1 and 3 days post challenge. Error bars, standard deviation. Negative control group (negative control), challenge control group (challenge control), animals vaccinated once with RacH-SE-70-p455-H3 (1 XHV-1), animals vaccinated twice with RacH-SE-70-p455-H3 (2 EHV-1) or animals vaccinated twice with inactivated porcine IAV (2X killed).
FIG. 17: virus titer: graph showing viral load of lung samples from vaccinated or unvaccinated pigs after challenge. Inactivated (Inact) is a commercially available inactivated vaccine. EHV-1RacH-SE-70-p455-H3
FIG. 18: reciprocal Serum Neutralization (SN) titers of animal sera collected on the day of challenge against porcine IAV H3 challenge strain R452-14. 20, detection limit. Negative control group (negative control), challenge control group (challenge control), animals vaccinated once with RacH-SE-70-p455-H3 (1 XHV-1), animals vaccinated twice with RacH-SE-70-p455-H3 (2 EHV-1) or animals vaccinated twice with inactivated porcine IAV (2X killed).
FIG. 19: IFA analysis of ST-43-CO infected with rEHV-1- Δ ORF43-HA virus (upper panel) and non-supplemented ST cells (lower panel). Infected cells expressed EHV-1 (left panel) and HA protein (right panel), but viral spread and CPE were only observed in rEHV-1-. DELTA.ORF 43-HA virus-infected ST-43-CO cells.
FIG. 20: HI analysis of sera from control and rEHV-1-. DELTA.ORF 43-HA virus-vaccinated pigs (5 pigs per group).
Detailed Description
The present invention solves the problems inherent in the prior art and provides the most advanced and significant advances.
The invention further relates to inactivated Equine Herpesvirus (EHV), in particular equine alpha herpesvirus, such as EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9, more in particular equine alpha herpesvirus 1(EHV-1) vectors, most in particular strain RacH, comprising UL18 and/or UL 8.
In general, the present invention provides an inactivated replication deficient equine alpha herpes virus (EHV) vector, preferably strain RacH, comprising UL18 and/or UL 8.
Advantageously, the EHV vector as described herein has a replication-deficient phenotype. The replication deficient EHV vector vaccines do not replicate in the host animal and are not transmitted from one animal to another, and therefore, are advantageous for safety or regulatory reasons.
In one aspect of the vectors of the present invention, UL18 is inactivated.
In another aspect of the vectors of the present invention, UL8 is inactivated.
In another aspect of the vectors of the present invention, UL18 and UL8 are inactivated.
Deactivated UL18 and UL8
In another aspect of the vectors of the present invention, the inactivation of UL18 is a complete or partial deletion, a complete or partial truncation, a complete or partial substitution, a complete or partial inversion, an insertion.
In another aspect of the vectors of the present invention, the inactivation of UL8 is a complete or partial deletion, a complete or partial truncation, a complete or partial substitution, a complete or partial inversion, an insertion.
In another aspect of the vectors of the present invention, the start codon of UL18 (ATG, nucleotides 1-3 of SEQ ID NO: 1) is inactivated.
In another aspect of the vector of the present invention, the inactivation of the start codon (ATG) of UL18 is a deletion, substitution, inversion or insertion.
In another aspect of the vectors of the present invention, the start codon of UL8 (ATG, nucleotides 1-3 of SEQ ID NO: 1) is inactivated.
In another aspect of the vector of the present invention, the inactivation of the start codon (ATG) of UL8 is a deletion, substitution, inversion or insertion.
Deactivated UL18
In another aspect of the vector of the invention, at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50, nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 925 nucleotides, at least 940 nucleotides are deleted, substituted or inverted from the 5' -end of the start codon of UL18 (ATG, nucleotides 1-3 of SEQ ID NO: 1).
In another aspect of the vector of the invention, at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 925 nucleotides, at least 940 nucleotides are deleted, substituted or inverted from A, T of the start codon (ATG, nucleotides 1-3 of SEQ ID NO: 1) of UL 18.
In another aspect of the vector of the invention, at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 925 nucleotides, at least 940 nucleotides are deleted, substituted, or inverted within UL 18.
In another aspect of the vector of the present invention, a DNA sequence within UL18 that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the DNA sequence set forth in SEQ ID No. 1 is deleted, substituted, or inverted.
In another aspect of the vector of the invention, at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 800 nucleotides, at least 1000 nucleotides are inserted within UL 18.
Deactivated UL8
In another aspect of the vector of the present invention, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 1000 nucleotides, at least 1250 nucleotides, at least 1500 nucleotides, at least 1750 nucleotides, at least 2000 nucleotides, at least 2225 nucleotides are deleted, substituted or inverted from the 5' -end of the start codon of UL8 (ATG, nucleotides 1-3 of SEQ ID NO: 2).
In another aspect of the vector of the invention, a deletion, substitution or inversion of at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 1000 nucleotides, at least 1250 nucleotides, at least 1500 nucleotides, at least 1750 nucleotides, at least 2000 nucleotides, at least 2225 nucleotides from A, T or G of the start codon (ATG, nucleotides 1-3 of SEQ ID NO: 2) of UL 8.
In another aspect of the vector of the present invention, at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 1000 nucleotides, at least 1250 nucleotides, at least 1500 nucleotides, at least 1750 nucleotides, at least 2000 nucleotides, at least 2225 nucleotides are deleted, substituted, or inverted within UL 8.
In another aspect of the vector of the present invention, a DNA sequence within UL8 that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the DNA sequence set forth in SEQ ID No. 2 is deleted, substituted, or inverted.
In another aspect of the vector of the invention, at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 800 nucleotides, at least 1000 nucleotides are inserted within UL 8.
Expression cassette
In another aspect of the vector of the present invention, the EHV vector comprises an expression cassette comprising:
(i) at least one foreign nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-coding sequence, wherein the nucleotide sequence of interest, preferably the gene of interest, more preferably the antigen-coding sequence, is operably linked to a promoter sequence, and
(ii) at least one upstream UL18 flanking region selected from the group consisting of: 5 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof; SEQ ID NO 9 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof, and
(iii) At least one downstream UL18 flanking region selected from the group consisting of: 6 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof; SEQ ID NO 10 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof.
In another aspect of the vector of the present invention, the EHV vector comprises an expression cassette comprising:
(i) at least one foreign nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-coding sequence, wherein the nucleotide sequence of interest, preferably the gene of interest, more preferably the antigen-coding sequence, and
(ii) at least one upstream UL18 flanking region selected from the group consisting of: 5 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof; SEQ ID NO 9 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof, and
(iii) at least one downstream UL18 flanking region selected from the group consisting of: 6 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof; SEQ ID NO 10 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof.
In another aspect of the vector of the present invention, the EHV vector comprises an expression cassette comprising:
(i) at least one foreign nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-coding sequence, wherein the nucleotide sequence of interest, preferably the gene of interest, more preferably the antigen-coding sequence, is operably linked to a promoter sequence, and
(ii) at least one upstream UL8 flanking region selected from the group consisting of: 11 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof, and
(iii) at least one downstream UL8 flanking region selected from the group consisting of: 12 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof.
In another aspect of the vector of the present invention, the EHV vector comprises an expression cassette comprising:
(i) at least one foreign nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-coding sequence, wherein the nucleotide sequence of interest, preferably the gene of interest, more preferably the antigen-coding sequence, and
(ii) at least one upstream UL8 flanking region selected from the group consisting of: 11 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof, and
(iii) At least one downstream UL8 flanking region selected from the group consisting of: 12 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof.
In another aspect of the vectors of the invention, insertion of the expression cassette inactivates UL18 and/or UL 8.
Deletion by insertion of the expression cassette into UL18
In another aspect of the vectors of the invention, the insertion of the expression cassette into UL18 is characterized by a portion of about 945bp within UL18 of RacH (SEQ ID NO:1) or a deletion of 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology and/or the same sequence.
Deletion by insertion of the expression cassette into UL8
In another aspect of the vectors of the invention, the insertion of the expression cassette into UL8 is characterized by an approximately 2256bp portion (SEQ ID NO:2) within UL8 of RacH or a deletion of 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof.
Flanking region of UL18
In another aspect of the vector of the present invention, the EHV comprises at least one flanking region selected from the group consisting of: 5, 6, 9, 10 and sequences 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical to any of these sequences.
In another aspect of the vectors of the present invention, the EHV comprises (i) at least one upstream UL18 flanking region selected from the group consisting of: 5 and 9, and (ii) at least one downstream UL18 flanking region selected from the group consisting of: SEQ ID NO 6 and SEQ ID NO 10.
Flanking region of UL8
In another aspect of the vector of the present invention, the EHV comprises at least one flanking region selected from the group consisting of: 11 and 12 and sequences 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical to any of these sequences.
In another aspect of the vectors of the present invention, the EHV comprises (i) at least one upstream UL8 flanking region selected from the group consisting of: 11, and (ii) at least one downstream UL8 flanking region selected from the group consisting of: 12 in SEQ ID NO.
The present invention further relates to plasmids comprising flanking regions for homologous recombination or RED-mediated recombination (see both above) into specific target sites in the genome of a viral vector, preferably into the UL18 and/or UL8 sites of an EHV vector, in particular EHV-1, more in particular a RacH vector.
Recombinant EHV
In another aspect of the vectors of the present invention, the EHV vector is a non-native and/or recombinant EHV.
Functional definition of copy defects
In another aspect of the vector of the invention, replication deficient means that the replication rate is reduced by at least 90%.
In another aspect of the vector of the invention, replication deficient means that the replication rate is reduced by at least 95%.
In another aspect of the vector of the invention, replication deficient means that the replication rate is reduced by at least 99%.
In another aspect of the vector of the present invention, replication deficient means that the replication rate is reduced by at least 99.5%.
In another aspect of the vector of the present invention, replication deficient means that the replication rate is reduced by at least 99.75%.
In another aspect of the vector of the present invention, replication-defective means that the replication rate is completely abolished.
In another aspect of the vectors of the present invention, replication rates are measured by TCID50 analysis.
In another aspect of the vectors of the invention, the replication-defective EHV vector remains infectious.
Advantageously, an EHV vector as described herein has a replication-deficient phenotype, but is still infectious. An infectious line is necessary because the viral vaccine must infect the host cell in order to provide an adequate immune response. In particular, viral vector vaccines expressing foreign antigens require infectivity.
In another aspect of the vectors of the invention, the EHV is still infectious and can replicate in infected eukaryotic cell lines, but is only packaged as a replication competent virus in complementing cell lines. Advantageously, viral DNA and viral proteins are still produced in the host, and thus, the replication deficient EHVs of the invention still induce an immune response and/or protect immunity. Advantageously, the data of the present invention show that protein expression (marker protein expression) still occurs in the replication deficient EHV viruses of the present invention.
Insertion into UL56 or US4
In yet another particular aspect of the vector of the invention, the EHV vector further comprises at least one other nucleotide sequence of interest, preferably another gene of interest, more preferably an antigen encoding sequence. In one aspect, at least one other nucleotide sequence of interest, preferably another gene of interest, more preferably an antigen coding sequence, is inserted into the same insertion site UL18 and/or UL8, e.g., via an IRES/2a peptide. In another aspect, the vector or expression cassette comprises at least one further nucleotide sequence of interest, preferably a further gene of interest, more preferably an antigen coding sequence, inserted into a further insertion site, preferably into UL56 and/or US 4.
In another aspect of the vector of the present invention, the EHV vector comprises at least one nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-encoding sequence, inserted into the insertion site, preferably UL56 and/or US 4.
In another aspect of the vector of the present invention, the EHV vector comprises inactivation of UL18 and/or UL8 and insertion of at least one nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-encoding sequence, in UL56 and/or US 4.
In another aspect of the vectors of the invention, the EHV vector comprises inactivated UL18 and at least one nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, inserted into UL56 (monovalent vaccine).
In another aspect of the vector of the invention, the EHV vector comprises inactivated UL18 and at least one nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, inserted into US4 (monovalent vaccine).
In another aspect of the vectors of the invention, the EHV vector comprises inactivated UL8 and at least one nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, inserted into UL56 (monovalent vaccine).
In another aspect of the vector of the invention, the EHV vector comprises inactivated UL8 and at least one nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, inserted into US4 (monovalent vaccine).
In another aspect of the vector of the invention, the EHV vector comprises inactivated UL18 and at least one nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, inserted in UL56 and US4 (bivalent vaccine).
In another aspect of the vector of the invention, the EHV vector comprises inactivated UL8 and at least one nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, inserted in UL56 and US4 (bivalent vaccine).
The invention further relates to Equine Herpes Viruses (EHV), in particular equine alpha herpes viruses, such as EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9, more in particular equine alpha herpes virus 1(EHV-1) vectors, most in particular strain RacH, comprising a first nucleotide sequence or gene of interest, preferably an antigen-coding sequence, inserted into UL18 and/or UL8, and at least one other nucleotide sequence or gene of interest, preferably another antigen-coding sequence, inserted into at least one other insertion site, preferably UL56(ORF1/3) and/or US4(ORF 70). In a particular aspect of this EHV vector of the invention, at least two genes of interest are operably linked to a regulatory sequence, preferably a promoter sequence.
In another aspect of the vector of the present invention, the EHV vector comprises two or more nucleotide sequences of interest, preferably genes of interest, more preferably antigen-encoding sequences, inserted into two or more insertion sites.
In another aspect of the vector of the present invention, the EHV vector comprises UL18 and/or UL8 inactivated by insertion of at least one inserted nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence (or an expression cassette comprising the same), and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, inserted in UL56 and/or US 4.
In another aspect of the vector of the present invention, the EHV vector comprises UL18 inactivated by insertion of at least one inserted nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence (or an expression cassette comprising the same), and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, inserted in UL 56.
In another aspect of the vector of the present invention, the EHV vector comprises UL18 inactivated by insertion of at least one inserted nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence (or an expression cassette comprising the same), and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, inserted in US 4.
In another aspect of the vector of the present invention, the EHV vector comprises UL18 inactivated by insertion of at least one inserted nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence (or an expression cassette comprising the same) and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, inserted in UL56 and US 4.
In another aspect of the vector of the present invention, the EHV vector comprises UL8 inactivated by insertion of at least one inserted nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence (or an expression cassette comprising the same), and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, inserted in UL 56.
In another aspect of the vector of the present invention, the EHV vector comprises UL8 inactivated by insertion of at least one inserted nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence (or an expression cassette comprising the same), and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, inserted in US 4.
In another aspect of the vector of the present invention, the EHV vector comprises UL8 inactivated by insertion of at least one inserted nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence (or an expression cassette comprising the same) and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, inserted in UL56 and US 4.
In another aspect of the vector of the present invention, the EHV vector comprises UL18 and UL8 inactivated by insertion of at least one inserted nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence (or an expression cassette comprising the same), and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, inserted in UL 56.
In another aspect of the vector of the present invention, the EHV vector comprises UL18 and UL8 inactivated by insertion of at least one inserted nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence (or an expression cassette comprising the same), and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen coding sequence, inserted in US 4.
In another aspect of the vector of the present invention, the EHV vector comprises UL18 and UL8 inactivated by insertion of at least one inserted nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-encoding sequence, and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-encoding sequence (or an expression cassette comprising the same), and at least one other nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-encoding sequence, inserted in UL56 and US 4.
US4(ORF70)
In another aspect of the vector of the invention, the insertion into US4 is characterized by a partial deletion, truncation, substitution, modification or the like as in US4, wherein US5 retains function.
In another aspect of the vector of the invention, the insertion into US4 is characterized by the deletion of the approximately 801bp portion (SEQ ID NO:24) within US4 of RacH or a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof.
In a particular aspect of the vector of the invention, the insertion into US4(ORF70) is characterized by a partial deletion, truncation, substitution, modification or the like of US4(ORF70), wherein US5(ORF71) remains functional.
In another aspect of the vectors of the present invention, the EHV vector comprises at least one flanking region selected from the group consisting of: 17, 18, 19, 20, 21 and 22 and sequences 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical to any of these sequences.
In another aspect of the vector of the present invention, the EHV vector comprises (i) at least one left US4 flanking region selected from the group consisting of: 17, 19 and 21, and (ii) at least one right US4 flanking region selected from the group consisting of SEQ ID NOs: 18, 20 and 22.
Nucleotide sequences and pathogens
In another aspect of the vector of the present invention, the nucleotide sequence of interest is recombinant and/or heterologous and/or exogenous.
In another aspect of the vector of the invention, the antigen-encoding sequence is for a pathogen that infects a food-producing animal (e.g., pig, cow, or poultry) or a companion animal (e.g., cat, horse, or dog).
In another aspect of the vector of the present invention, the antigen-encoding sequence is from a pathogen selected from, but not limited to, the following list: schmallenberg virus (Schmallenberg virus), influenza a virus, porcine respiratory and reproductive syndrome virus, porcine circovirus, classical swine fever virus, african swine fever virus, hepatitis E virus, bovine viral diarrhea virus, rabies virus, feline measles virus, Clostridium tetani (Clostridium tetani), mycobacterium tuberculosis (mycobacterium tuberculosis), Actinobacillus Pleuropneumoniae (Actinobacillus Pleuropneumoniae).
In particular aspects of the vectors or expression cassettes of the invention, the antigen-encoding sequence is of interest to a pathogen that infects swine. In yet another specific aspect, the pathogenic system is porcine type a influenza virus (IAV). In yet another particular aspect, the antigen is a Hemagglutinin (HA) antigen, in particular the hemagglutinin antigen is derived from influenza a virus. For example, influenza a virus is influenza a virus (a/pig/italy/116114/2010 (H1N2)), influenza a virus (a/pig/italy/7680/2001 (H3N2)), influenza a virus (a/pig/Gent/132/2005 (H1N1)) and/or influenza a virus (a/pig/italy/4675/2003 (H1N 2)). In yet another particular aspect, the antigen comprises or consists of the sequence encoded by SEQ ID NO 14. In another specific aspect, the antigen comprises or consists of a sequence encoding an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence as set forth in SEQ ID No. 14.
Regulatory sequences and promoters
In another aspect of the vector of the present invention, the gene of interest is operably linked to a regulatory sequence, preferably a promoter sequence.
In another aspect of the vector of the present invention, the promoter sequence operably linked to the sequence or gene of interest is selected from, but is not limited to, the group consisting of: SV 40T, HCMV and MCMV immediate early gene 1, human elongation factor alpha promoter, baculovirus polyhedrin promoter, polymerase II promoter and functional fragment.
In another aspect of the vector of the present invention, the promoter sequence operably linked to the at least one gene of interest is MCMV or a functional fragment thereof or a nucleotide sequence complementary thereto.
In another aspect of the vector of the present invention, the promoter sequence operably linked to the at least one gene of interest is an endogenous promoter of UL8 or UL 18.
In another aspect of the vector of the present invention, the EHV vector is selected from the group consisting of: EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9.
In another aspect of the vehicle of the present invention, the EHV vehicle is EHV-1, preferably RacH.
The present invention further relates to an EHV vector of the present invention comprising:
a. a first nucleotide sequence of interest, preferably a gene of interest, e.g. an antigen-encoding sequence, inserted in UL18 and/or UL8,
b. The first nucleotide sequence of interest is optionally operably linked to a regulatory nucleic acid sequence/promoter sequence,
c. the first nucleotide sequence of interest is optionally operably linked to a (further) regulatory nucleic acid (e.g. a polyadenylation sequence, preferably 71pA or BGHpA).
In certain aspects, the EHV carrier further comprises
a. A second nucleotide sequence of interest, preferably a second gene of interest, e.g.an antigen-coding sequence, inserted into a second insertion site (preferably UL56 and/or US4),
b. the second nucleotide sequence of interest is optionally operably linked to a regulatory nucleic acid sequence/promoter sequence,
c. the second nucleotide sequence of interest is optionally operably linked to a regulatory nucleic acid (e.g., a polyadenylation sequence, preferably 71pA or BGHpA).
The present invention further relates to an EHV vector of the present invention comprising:
a. deactivation of UL18 and/or UL 8;
b. a first nucleotide sequence of interest, preferably a gene of interest, e.g. an antigen-encoding sequence, inserted in UL56 and/or US4,
c. the first nucleotide sequence of interest is optionally operably linked to a regulatory nucleic acid sequence/promoter sequence,
d. the first nucleotide sequence of interest is optionally operably linked to a (further) regulatory nucleic acid (e.g. a polyadenylation sequence, preferably 71pA or BGHpA).
Host cell
Furthermore, the invention provides a mammalian host cell characterized in that it comprises a replication deficient EHV vector as described herein.
The invention also relates to a mammalian host cell characterized in that it comprises a vector of the invention.
The invention further relates to a method for producing a host cell, characterized by the following steps:
a. infecting a mammalian host cell of the invention with a vector of the invention,
b. culturing the infected cells under suitable conditions,
c. optionally harvesting the host cell.
The invention further relates to the use of a vector of the invention or a mammalian host cell of the invention for the manufacture of an immunogenic composition or a vaccine.
Complementing cell lines
Furthermore, the present invention provides cell lines expressing UL8 and/or UL18 of EHV or a functional part thereof for use in culturing replication deficient EHV vectors as described herein.
Furthermore, the present invention provides a cell line comprising a plasmid comprising an expression cassette comprising UL8 and/or UL18 of EHV or a functional part thereof, wherein the cell line expresses UL8 and/or UL18 or a functional part thereof.
In another aspect of the cell line of the invention, the cell line is selected from, but not limited to, the group of: vero cells, RK-13 (rabbit kidney), ST (pig testis), MDCK (Madin-Darby canine kidney), MDBK (Madin-Darby bovine kidney) and horse skin cells (NBL-6).
In another aspect of the cell line of the invention, the cell line is a ST cell line.
Generation method
Furthermore, the present invention provides a method of producing a replication-deficient equine alpha herpes virus (EHV), comprising inactivating UL18 and/or UL8 as described herein.
Further, the present invention provides a method of producing a replication-deficient equine alpha herpes virus (EHV), comprising the steps of:
a) providing a wild-type EHV or an attenuated EHV;
b) inactivating UL18 and/or UL8 of the EHV of step a) and selecting an EHV clone without the full or functional portion of UL18 and/or UL 8;
c) providing a complementing cell line expressing UL18 and/or UL8 or a functional part thereof;
d) obtaining a replication deficient equine alpha herpes virus (EHV) by culturing the EHV of step b) with the complementing cell line of step c).
The invention further relates to a method for producing a vector of the invention, comprising:
a. inserting a first nucleotide sequence of interest, preferably a gene of interest, e.g.an antigen-coding sequence, into UL18 and/or UL8,
b. optionally operably linking the first nucleotide sequence of interest to a regulatory nucleic acid sequence/promoter sequence,
c. optionally operably linking the first nucleotide sequence of interest to a (further) regulatory nucleic acid (e.g. a polyadenylation sequence, preferably 71pA or BGHpA).
In a particular aspect, the method further comprises
Inserting a second nucleotide sequence of interest, preferably a second gene of interest, e.g. an antigen coding sequence, into a second insertion site (preferably UL56 and/or US4),
b. optionally operably linking the second nucleotide sequence of interest to a regulatory nucleic acid sequence/promoter sequence,
c. optionally operably linking the second nucleotide sequence of interest to a regulatory nucleic acid (e.g., a polyadenylation sequence, preferably 71pA or BGHpA).
The invention further relates to a method for producing a vector of the invention, comprising:
a. deactivating UL18 and/or UL8 of the EHV;
b. inserting a first nucleotide sequence of interest, preferably a gene of interest, e.g. an antigen-coding sequence, into UL56 and/or US4,
c. optionally operably linking the first nucleotide sequence of interest to a regulatory nucleic acid sequence/promoter sequence,
d. optionally operably linking the first nucleotide sequence of interest to a (further) regulatory nucleic acid (e.g. a polyadenylation sequence, preferably 71pA or BGHpA).
The present invention further relates to a method of preparing an immunogenic composition or vaccine for reducing the incidence or severity of one or more clinical signs associated with or caused by an infection, comprising the steps of:
a. Infection of the complementing cell lines of the invention with the vector of the invention,
b. culturing the infected cells under suitable conditions,
c. the infected cell culture is collected and,
d. optionally purifying the collected infected cell cultures of step c)
e. Optionally mixing the collected infected cell culture with a pharmaceutically acceptable carrier.
Vaccine
Furthermore, the present invention provides immunogenic compositions comprising one or more EHV vectors as described herein.
In another aspect of the immunogenic composition of the invention, the immunogenic composition further comprises a pharmaceutically acceptable carrier.
In another aspect of the immunogenic composition of the invention, the immunogenic composition is a vaccine.
Accordingly, the present invention further relates to an immunogenic composition comprising:
a. the vector of the invention, and/or
b. A polypeptide expressed by a vector of the invention (e.g., a virus, a modified live virus, a virus-like particle (VLP), or the like), and
c. optionally a pharmaceutically or veterinarily acceptable carrier or excipient, preferably suitable for oral, intradermal, intramuscular or intranasal administration,
preferably the immunogenic composition comprises a virus. In a particular aspect, the virus is an infectious virus.
The invention further relates to a vaccine or pharmaceutical composition comprising:
a. the vector of the invention, and/or
b. A polypeptide expressed by a vector of the invention (e.g., a virus, a modified live virus, a virus-like particle (VLP), or the like), and
c. a pharmaceutically or veterinarily acceptable carrier or excipient, preferably suitable for oral, intradermal, intramuscular or intranasal administration,
d. optionally the vaccine further comprises an adjuvant.
Treatment and methods of use
In addition, the present invention provides a method of immunizing an individual comprising administering to the individual an immunogenic composition as described herein.
In addition, the present invention provides a method of treating or preventing a clinical sign caused by a pathogen in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of an immunogenic composition as described herein.
The present invention provides an immunogenic composition as described herein for use in a method of immunizing an individual, the method comprising administering the immunogenic composition to the individual.
The present invention provides an immunogenic composition as described herein for use in a method of treating or preventing clinical signs caused by a pathogen in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of the immunogenic composition.
In another aspect of the method or use of the invention, the individual is selected from the list consisting of swine, cattle, poultry, cats, horses and dogs.
In another aspect of the methods or uses of the invention, the immunogenic composition is administered once.
In another aspect of the methods or uses of the invention, the immunogenic composition is administered in two or more doses.
The invention also relates to a kit for vaccinating an animal, preferably a food producing animal (e.g. a pig or a cow) or a companion animal (e.g. a cat, a horse or a dog), against a disease associated with a pathogen in the animal and/or reducing the incidence or severity of one or more clinical signs associated with or caused by the pathogen, the kit comprising:
a) a dispenser capable of administering the vaccine to the animal; and
b) the immunogenic composition or vaccine of the invention, and
c) optionally an instruction manual.
The invention further relates to a kit consisting of the vector of the invention, optionally a transfection reagent and an instruction manual.
Definition of
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs at the time of filing. The meaning and scope of the terms should be clear; however, in the case of any potential ambiguity, the definitions provided herein precede any dictionary or extrinsic definitions. Furthermore, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. Herein, the use of "or" means and/or "unless otherwise indicated. Furthermore, the use of the term "including" as well as other forms (e.g., "include" and "included") is not limiting. All patents and publications mentioned herein are incorporated herein by reference.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of virology, molecular biology, microbiology, recombinant DNA technology, protein chemistry and immunology, which are well known to those skilled in the art. Such techniques are fully explained in the literature. See, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, Vol. I, II and III, 2 nd edition (1989); DNA Cloning, volumes I and II (d.n. glover editors, 1985); oligonucleotide Synthesis (m.j. gait editors, 1984); nucleic Acid Hybridization (edited by b.d. hames and s.j. higgins, 1984); animal Cell Culture (r.k. freshney, eds., 1986); immobilized Cells and Enzymes (IRL press, 1986); perbal, B., A Practical Guide to molecular Cloning (1984); the series, Methods In Enzymology (edited by S.Colowick and N.Kaplan, Academic Press, Inc.); protein purification methods-a practical proproach (edited by e.l.v.harris and s.angal, IRL Press at Oxford University Press); and handbook of Experimental Immunology, volumes I-IV (D.M.Weir and C.C.Blackwell, ed., 1986, Blackwell Scientific Publications).
Before describing the present invention in detail, it is to be understood that this invention is not limited to particular DNA, polypeptide sequences, or process parameters, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. It must be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "an antigen" includes mixtures of two or more antigens, reference to "an excipient" includes mixtures of two or more excipients, and the like.
Definition of molecular biology
As known in the art, the term "vector" refers to a polynucleotide construct, typically a plasmid or bacterial artificial chromosome, used to deliver genetic material to a host cell. The vector may be, for example, a bacterium, a virus, a bacteriophage, a bacterial artificial chromosome, a cosmid (cosmid), or a plasmid. The carrier system used herein consists of or contains DNA or RNA. In some embodiments, the vector is comprised of DNA. In some embodiments, the vector is an infectious virus. The viral vector contains a viral genome that operates in a manner to carry a foreign gene that is not functional in replication of the viral vector, whether in cell culture or in a host animal. According to particular aspects of the invention, the vector may be used in various aspects, such as for the delivery of genetic material only, for the transfection of host cells or organisms, as a vaccine (e.g. a DNA vaccine) or for gene expression purposes. Gene expression is a term describing the biosynthesis of proteins in cells as being guided by specific polynucleotide sequences called genes. In particular aspects, a vector may be an "expression vector", which, when present in an appropriate environment, is a vector capable of directing the expression of a protein encoded by one or more genes carried by the vector.
Vectors and methods of making and/or using vectors (recombinants) for expression can be performed by or similar to the methods disclosed in: U.S. Pat. nos. 4,603,112, 4,769,330, 5,174,993, 5,505,941, 5,338,683, 5,494,807, 4,722,848, 5,942,235, 5,364,773, 5,762,938, 5,770,212, 5,942,235, 382,425, PCT publications WO 94/16716, WO 96/39491, WO 95/30018; paoletti, "Applications of pox virus vectors to maintenance: An update", PNAS USA93: 11349-; moss, "genetic expressed tissues for recombinant gene expression, vaccination, andsafety", PNAS USA93: 11341-; smith et al, U.S. patent No. 4,745,051 (recombinant baculovirus); richardson, C.D. (eds.), Methods in Molecular Biology 39, "Baculovirus Expression Protocols" (1995Humana Press Inc.); smith et al, "Production of Human Beta interference in instruments Cells fed with a bacterial Expression Vector", Molecular and Cellular Biology, 12 months 1983, Vol.3, No. 12, p.2156 and 2165; pennock et al, "Strong and Regulated Expression of Escherichia coli B-Galactosidase in infection Cells with a Baculoviral vector", Molecular and Cellular Biology, 3/1984, Vol.4, No. 3, page 406; EPA 0370573; U.S. application No. 920,197, filed on 16/10 1986; EP patent publication No. 265785; U.S. patent No. 4,769,331 (recombinant herpes virus); roizman, "The function of The genetic genes of peptides for genetic engineering of novel vectors", PNAS USA93: 11307-11312, 1996, month 10; andreansky et al, "The application of genetic engineered viral vectors to The treatment of experimental blue tumors", PNAS USA93: 11313-; robertson et al, "Epstein-Barr virus vectors for genetic to B lymphocytes," PNAS USA93: 11334-11340, 1996 month 10; frolov et al, "Alphavirus-based expression vectors: Strategies and applications", PNAS USA93:11371-11377, month 10 1996; kitson et al, J.Virol.65,3068-3075,1991; U.S. patent nos. 5,591,439, 5,552,143; WO 98/00166; granted U.S. application nos. 08/675,556 and 08/675,566, both filed on 3.7.1996 (recombinant adenovirus); grunhaus et al, 1992, "Adenoviral as cloning vectors," semi in Virology (Vol.3), pages 237-52, 1993; ballay et al, EMBO Journal, Vol.4, pp.3861-65, Graham, Tibtech 8,85-87, 4 months 1990; prevec et al, j.gen virol.70, 42434; PCT WO 91/11525; felgner et al (1994), J.biol.chem.269,2550-2561, Science,259:1745-49, 1993; and McClements et al, "ionization with DNA vaccines encoding glucoproteins D or glucoproteins B, acetone or in combination, indeces protective immunity in animal models of simple viruses-2 disease", PNAS USA93: 11414-; and U.S. Pat. Nos. 5,591,639, 5,589,466 and 5,580,859, and WO 90/11092, WO93/19183, WO94/21797, WO95/11307, WO 95/20660; tang et al, Nature, and in particular Furth et al, analytical biochemistry, relating to DNA expression vectors. See also WO 98/33510; ju et al, Diabetologia,41:736-739,1998 (lentivirus expression system); sanford et al, U.S. patent No. 4,945,050; fischbach et al (Intracel); WO 90/01543; robinson et al, sensines in Immunology, Vol.9, p.271-283 (1997), (DNA vector cells); szoka et al, U.S. Pat. No. 4,394,448 (method of inserting DNA into living cells); McCormick et al, U.S. Pat. No. 5,677,178 (use of cytopathic viruses); and U.S. Pat. No. 5,928,913 (vector for gene delivery); and other documents cited herein.
The term "viral vector" describes a genetically modified virus that is manipulated by recombinant DNA techniques such that its entry into a host cell results in a specific biological activity, such as expression of a transgene carried by the vector. In particular aspects, the transgenic line antigen. Viral vectors may or may not be replication competent in the target cell, tissue or organism.
The production of viral vectors can be accomplished using any suitable genetic engineering technique well known in the art, including but not limited to standard techniques for restricted nuclease digestion, ligation, transformation, plasmid purification, DNA sequencing, cell culture transfection, for example as described in: sambrook et al (Molecular Cloning: A Laboratory Manual, Cold spring harbor Laboratory Press, N.Y. (1989)) or K.Maramorosch and H.Koproxski (Methods in virology Volume VIII, Academic Press Inc. London, UK 2014).
The viral vector may incorporate sequences from a genome of any known organism. The sequence may be incorporated in its native form or may be modified in any way to obtain the desired activity. For example, the sequence may comprise insertions, deletions or substitutions.
The viral vector may comprise coding regions for two or more proteins of interest. For example, a viral vector may include a coding region for a first protein of interest and a coding region for a second protein of interest. The target first protein and the target second protein may be the same or different. In some embodiments, the viral vector may include a coding region for a third or fourth protein of interest. The third and fourth proteins of interest may be the same or different. The total length of two or more proteins of interest encoded by one viral vector may vary. For example, the total length of the two or more proteins can be at least about 200 amino acids. At least about 250 amino acids, at least about 300 amino acids, at least about 350 amino acids, at least about 400 amino acids, at least about 450 amino acids, at least about 500 amino acids, at least about 550 amino acids, at least about 600 amino acids, at least about 650 amino acids, at least about 700 amino acids, at least about 750 amino acids, at least about 800 amino acids, or longer.
Preferred viral vectors include, for example, herpes viral vectors derived from EHV-1 or EHV-4 or other varicella viruses such as PrV (pseudorabies virus) or BHV-1 (bovine herpes virus 1).
According to a particular aspect of the invention, the term "viral vector" or "viral construct" refers to a recombinant viral construct derived from a virus selected from the family herpesviridae, e.g. EHV-1, EHV-4. Preferred viral vectors include, for example, herpes viral vectors derived from EHV-1 or EHV-4.
The terms "viral vector" and "viral construct" are used interchangeably.
The term "construct" as used herein refers to an artificially produced recombinant nucleic acid, such as a plasmid, BAC or recombinant virus.
The term "plasmid" refers to cytoplasmic DNA that replicates independently of the bacterial chromosome within a bacterial host cell. In a particular aspect of the invention, the terms "plasmid" and/or "transfer plasmid" refer to a component of recombinant DNA technology used to construct, for example, an expression cassette for insertion into a viral vector. In another particular aspect, the term "plasmid" can be used to designate a plasmid that can be used for DNA vaccination purposes.
The terms "nucleic acid" and "polynucleotide" as used herein are used interchangeably and refer to any nucleic acid.
The terms "nucleic acid", "nucleic acid sequence", "nucleotide sequence", "polynucleotide sequence", "RNA sequence" or "DNA sequence" as used herein refer to oligonucleotides, nucleotides or polynucleotides and fragments and portions thereof, and to DNA or RNA of genomic or synthetic origin, which may be single-stranded or double-stranded and represents the sense strand or the antisense strand. The sequence may be a non-coding sequence, a coding sequence, or a mixture of both. The nucleic acid sequences of the invention can be prepared using standard techniques well known to those skilled in the art.
The terms "nucleic acid" and "polynucleotide" also specifically include nucleic acids composed of bases other than 5 biological bases (adenine, guanine, thymine, cytosine, and uracil).
The terms "regulatory nucleic acid", "regulatory module" and "expression control module" are used interchangeably and refer to a nucleic acid molecule that can affect the expression of an operably linked coding sequence in a particular host organism. The terms are used broadly and encompass all components that promote or regulate transcription, including core, upstream, enhancer and response components required for basic interaction of promoters, promoter sequences, RNA polymerases and transcription factors. Exemplary regulatory components in prokaryotes include promoters, operator sequences, and ribosome binding sites. Regulatory components used in eukaryotic cells can include, but are not limited to, transcriptional and translational control sequences, such as promoters, enhancers, splicing signals, polyadenylation signals, terminators, protein degradation signals, Internal Ribosome Entry Sites (IRES), picornavirus 2A sequences, and the like, which provide and/or regulate expression of a coding sequence and/or production of an encoded polypeptide in a host cell.
An "internal ribosome entry site" or "IRES" describes a sequence that is 5' of a gene independent of the IRES, functionally facilitates translation initiation and allows translation of two cistrons (open reading frames) from a single transcript in an animal cell. The IRES provides an independent ribosome entry site for translation of the open reading frame immediately downstream thereof. Unlike bacterial mrnas, which can be polycistronic, i.e., encoding several different polypeptides that are translated sequentially from an mRNA, most mRNA of animal cells is monocistronic and encodes the synthesis of only one polypeptide. In eukaryotic cells with polycistronic transcripts, translation will start from the most 5' translation start site, terminate at the first stop codon, and the transcript will be released from the ribosome, resulting in translation of only the first encoded polypeptide in the mRNA. In eukaryotic cells, polycistronic transcripts having an IRES operably linked to a second or subsequent open reading frame in the transcript allow for sequential translation of this downstream open reading frame to produce two or more polypeptides encoded by the same transcript. IRES can be of varying lengths and from a variety of sources, for example, encephalomyocarditis virus (EMCV), picornavirus (e.g., foot and mouth disease virus, FMDV, or myelogenous ashbyite virus (PV)), or Hepatitis C Virus (HCV). Various IRES sequences and their use in vector construction have been described and are well known in the art. The downstream coding sequence may be operably linked to the 3' end of the IRES at any distance that does not negatively affect the expression of the downstream gene. The optimal or allowable distance between the IRES and the downstream gene start can be readily determined by varying the distance and measuring expression as a function of distance.
The term "2 a" or "2 a peptide" refers to short oligopeptide sequences, described as 2a and "2 a-like", which serve as linkers capable of mediating co-translational cleavage between proteins through a process defined as ribosome skipping. These 2a and "2 a-like" sequences (from picornaviridae and other viral or cellular sequences) can be used to concentrate multiple gene sequences into a single gene, ensuring that they are co-expressed within the same cell (see Luke and Ryan, 2013).
The term "promoter" or "promoter sequence" as used herein refers to a nucleotide sequence that allows RNA polymerase to bind and direct transcription of a gene. Typically, a promoter is located in the 5' non-coding region of a gene, near the transcription start site of the gene. The sequence components within a promoter that are used to initiate transcription are generally characterized as having a consensus nucleotide sequence. Examples of promoters include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and animals, such as mammals (including horses, pigs, cows, and humans), birds, or insects. Promoters may be inducible, repressible and/or constitutive. Inducible promoters initiate an increased degree of transcription from DNA under their control in response to some change in culture conditions (e.g., temperature change) (Ptashne, 2014). Examples of promoters well known to those skilled in the art are, for example, SV40 large T, HCMV and MCMV immediate early gene 1, the human elongation factor alpha promoter, the baculovirus polyhedrin promoter, the polymerase II promoter.
The term "enhancer" refers to a polynucleotide sequence that acts in a cis position on the activity of a promoter and thus stimulates transcription of a gene or coding sequence functionally linked to the promoter. Unlike promoters, enhancers are not position and orientation dependent and thus may be located before or after a transcriptional unit, within an intron, or even within a coding region. Enhancers can be located in the vicinity of the transcription unit and at considerable distance from the promoter. It may also overlap physically and functionally with the promoter. Those skilled in the art will appreciate that a variety of enhancers from a variety of sources (and deposited in databases such as gene banks, e.g., the SV40 enhancer, CMV enhancer, polyoma enhancer, adenovirus enhancer) are used as independent components or as components cloned within a polynucleotide sequence (e.g., deposited in the ATCC or from commercial and personal sources). Various promoter sequences also contain enhancer sequences, such as the frequently used CMV promoter. Human CMV enhancer is one of the strongest enhancers identified to date. One example of an inducible enhancer is the metallothionein enhancer, which can be stimulated by glucocorticoids or heavy metals.
The term "complementary nucleotide sequence" describes one strand of two paired strands of a polynucleotide, such as DNA or RNA. The nucleotide sequence of the complementary strand mirrors that of its counterpart strand, such that for each adenosine it contains a thymine (or uracil for RNA), a cytosine for each guanine, and vice versa. For example, the complementary nucleotide sequence of 5 '-GCATAC-3' is 3 '-CGTATG-5' or 3 '-CGUAUG-5' for RNA.
The terms "gene", "gene of interest" as used herein have the same meaning and refer to a polynucleotide sequence of any length that encodes a product of interest. A gene may further comprise regulatory sequences preceding the coding sequence (5 'non-coding or non-translated sequences) and subsequent regulatory sequences (3' non-coding or non-translated sequences). The selected sequence may be a full-length or truncated, fused or tagged gene, and may be cDNA, genomic DNA, or a fragment of DNA. It is generally understood that genomic DNA encoding a polypeptide or RNA may include a non-coding region (i.e., intron) that is spliced from mature messenger RNA (mrna) and thus not present in cDNA encoding the same polypeptide or RNA. It may be a native sequence, i.e. in its native form, or may be mutated, or comprise a sequence derived from a different source or be otherwise modified as required. Such modifications include codon optimization to optimize codon usage or markers in the host cell of choice. Furthermore, it may comprise the removal or addition of cis-acting sites, such as (cryptic) splice donors, acceptor sites and branch points, polyadenylation signals, TATA-boxes, chi sites, ribosome entry sites, repeats, secondary structures (e.g. stem loops), binding sites for transcription factors or other regulatory factors, restriction endonuclease sites, etc., to name a few but not limiting examples. The selected sequence may encode a secreted, cytoplasmic, nuclear, membrane-bound or cell surface polypeptide.
The term "target nucleotide sequence" as used herein is a more general term than the target gene, as it does not necessarily encompass a gene, but may encompass components or portions of a gene or other genetic information (e.g., ori (origin of replication)). The nucleotide sequence of interest may be any DNA or RNA sequence, regardless of whether it comprises a coding sequence.
An "open reading frame" or "ORF" refers to a length of a nucleic acid sequence (DNA or RNA) that includes a translation initiation signal or start codon (e.g., ATG or AUG) and a stop codon, and that can potentially be translated into a polypeptide sequence.
The term "UL (uniquely long)" is an abbreviation used to describe a uniquely long segment of the EHV genome, preferably the EHV-1 genome.
The term "US (uniquely short)" is used to describe the abbreviation for the uniquely short segment of the EHV gene body, preferably the EHV-1 gene body.
The term "transcription" describes the biosynthesis of mRNA in a cell.
The term "expression" as used herein refers to the transcription and/or translation of an internal nucleic acid sequence in a host cell. According to a particular aspect of the invention, the term "expression" refers to the transcription and/or translation of a heterologous and/or exogenous nucleic acid sequence within a host cell. The degree of expression of the desired product in the host cell can be determined based on the amount of the corresponding RNA or mRNA present in the cell or the amount of the desired polypeptide encoded by the selected sequence. For example, mRNA transcribed from a selected sequence can be quantified by northern blot hybridization, rnase RNA protection, in situ hybridization to cellular RNA, or by RT qPCR (reverse transcription followed by quantitative PCR). The protein expressed from the selected sequence can be quantified by various methods, for example by ELISA, immunoblotting, by radioimmunoassay, by immunoprecipitation, by assaying for the biological activity of the protein or by immunostaining of the protein, followed by FACS analysis.
The term "expression cassette" or "transcription unit" or "expression unit" defines a region within a vector, construct or polynucleotide sequence containing one or more genes to be transcribed, wherein the nucleotide sequence encoding the transcribed gene and the polynucleotide sequence containing the regulatory elements comprised within the expression cassette are operably linked to each other. It is transcribed from an activator and transcription is terminated by at least one polyadenylation signal. In a particular aspect, it is transcribed from a single promoter. Thus, the different genes are at least transcriptionally related. More than one protein or product may be transcribed and expressed from each transcriptional unit (polycistronic transcriptional unit). Each transcriptional unit will contain the regulatory components necessary for transcription and translation of any selected sequence contained within the unit. And each transcription unit may contain the same or different regulatory components. For example, each transcriptional unit may contain the same terminator, and IRES elements or introns may be used for functional linkage of genes within the transcriptional unit. The vector or polynucleotide sequence may contain more than one transcriptional unit.
The terms "increased expression", "increased titer or productivity" or "improved expression or productivity" mean an increase in the expression, synthesis or secretion of a heterologous and/or exogenous sequence introduced into a host cell by comparison to a suitable control (e.g., protein encoded by cDNA versus protein encoded by an intron-containing gene), e.g., a gene encoding a therapeutic protein. If the cell line of the invention is cultured according to the method of the invention as described herein and if the specific productivity or titer of this cell is increased by at least 1.2-fold, 1.5-fold, 2-fold, 3-fold, 4-fold or 5-fold, the titer or productivity is increased. If the cell line of the invention is cultured according to the method of the invention as described herein and if the specific productivity or titer of this cell is increased by at least 1.2-fold or at least 1.5-fold or at least 2-fold or at least 3-fold, the titer or productivity is also increased. If the cell line of the invention is cultured according to the process of the invention as described herein and if the specific productivity or titer of this cell is increased by at least 1.2-fold to 5-fold, preferably 1.5-fold to 5-fold, more preferably 2-fold to 5-fold, the titer or productivity is also increased in particular. "increased expression" may also mean that more cells actually express the gene/sequence of interest. For example, increased expression may mean that the novel promoters of the invention are active for longer periods of time during the viral replication cycle relative to other promoters.
Increased expression, titer or productivity can be obtained by using the heterologous vector of the invention. This can be combined with other methods such as FACS assisted selection of recombinant host cells containing one or more fluorescent proteins (e.g., GFP) or cell surface markers as additional selectable markers. Other methods and combinations of different methods of obtaining increased expression may also be used, e.g. based on the use of cis-active components to manipulate chromatin structure (e.g. LCR, UCOE, ase, spacers, S/MAR, STAR components), the use of (artificial) transcription factors, treatment of cells with natural or synthetic reagents to upregulate endogenous or heterologous and/or foreign gene expression, to improve stability (half-life) of mRNA or protein, to improve initiation of mRNA translation, to increase gene dosage by using episomal plasmids (based on the use of viral sequences as replication origins, e.g. SV40, polyoma, adenovirus, EBV or BPV), to use amplification promoting sequences or in vitro amplification systems based on DNA concatemers.
The term "obtaining" may comprise separation and/or purification steps known to the person skilled in the art, preferably using precipitation, column etc.
The assays used to measure "increased expression" are based on protein measurements of LC-MS/MS, such as Multiple Reaction Monitoring (MRM); antibody-based detection methods such as immunoblotting, dot blotting, or immunodiffusion and flow cytometry; and measuring the biological activity by hemagglutination analysis.
"promoter activity" is indirectly measured by quantifying the mRNA transcribed under the control of the respective promoter. mRNA was quantified by RTqPCR relative to endogenous standards.
The term "viral titer" is a measure of infectious units per volume of viral preparation. Viral titers were endpoints in the biological program and defined as the dilution at which a proportion of the tests performed in parallel showed an effect (Reed and Muench, 1938). Specifically, the tissue culture infectious dose 50 per ml (TCID50/ml) gives a dilution of the virus preparation, where 50% of the number of cell cultures inoculated in parallel with this dilution are infected.
"transcriptional regulatory components" typically comprise a promoter upstream of the gene sequence to be expressed, transcriptional initiation and termination sites, and polyadenylation signals.
The term "transcription initiation site" refers to the nucleic acid in the construct corresponding to the first nucleic acid incorporated into the primary transcript (i.e., the pre-mRNA). The transcription initiation site may overlap with the promoter sequence.
A "termination signal" or "terminator" or "polyadenylation signal" or "poly A" or "transcription termination site" or "transcription termination component" causes cleavage of a specific site at the 3 'end of the eukaryotic mRNA and incorporation of a sequence of about 100-200 adenine nucleotides (poly A tail) after transcription at the cleaved 3' end and thus causes the RNA polymerase to terminate transcription. The polyadenylation signal comprises a sequence AATAAA about 10 to 30 nucleotides upstream of the cleavage site and a sequence located downstream. Various polyadenylation elements are known, such as tk polya, SV40 late and early polya, BGH polya (described, for example, in U.S. patent No. 5,122,458), or hamster growth hormone polya (WO 2010010107).
"translational regulatory elements" include the translation initiation site (AUG), stop codon and poly A signal for each individual polypeptide to be expressed. An Internal Ribosome Entry Site (IRES) may be included in some constructs. To optimize expression, it may be advisable to remove, add or alter the 5 'and/or 3' untranslated regions of the nucleic acid sequence to be expressed, to eliminate any potentially additional inappropriate alternative translation initiation codons or other sequences that may interfere with or reduce expression to the extent of transcription or translation. A consensus ribosome binding site (Kozak sequence) can be inserted immediately upstream of the start codon to enhance translation and thus expression. Increased A/U content near this ribosome binding site promotes more efficient ribosome binding.
By definition, each polynucleotide sequence or each gene inserted into a host cell, and the individual proteins or RNAs encoded thereby, when they are from different (viral) species, are referred to as "exogenous", "exogenous sequence", "exogenous gene", "exogenous coding sequence" with respect to the host cell. Thus, EHV-4 based promoters are exogenous in view of the EHV-1 viral vector. The term "exogenous" as used herein with respect to a sequence or gene of interest (e.g., an antigen) means that the sequence or gene of interest, and in particular the antigen, is expressed outside of the context of its native material. Thus, the HA antigen from porcine IAV is an example of an exogenous antigen relative to EHV-1 carrier line. Thus, any sequence derived from a different pathogen other than EHV-1 is a foreign sequence or gene of interest or an antigen of a particular aspect of the invention.
By definition, each polynucleotide sequence or each gene inserted into a host cell, and the respective protein or RNA encoded thereby, is referred to as "heterologous", "heterologous sequence", "heterologous gene", "heterologous coding sequence", "transgene" or "heterologous protein" with respect to the host cell. This applies even if the sequence to be introduced or the gene to be introduced is identical to the endogenous sequence or endogenous gene of the host cell. For example, by definition, the EHV-4 promoter sequence is heterologous with respect to the EHV-4 promoter sequence introduced at a different site in the EHV-4 wild-type virus or in a modified form into an EHV-4 viral vector. The term "heterologous" as used herein with respect to a sequence or gene of interest (e.g., an antigen) means that the sequence or gene of interest, and in particular the antigen, is expressed outside of the context of its native subunit. Thus, any non-EHV-1 specific sequence or gene of interest, e.g. an antigen of any equine alphaherpesvirus other than EHV-1 (e.g. EHV-3, EHV-8) is therefore a heterologous sequence or gene of interest or an antigen of a particular aspect of the invention.
The term "non-native" means any sequence or gene of interest (e.g., antigen) that naturally occurs in this context, such as a hybrid sequence or gene of interest (e.g., antigen) from a different species, or a sequence or gene of interest (e.g., antigen) that is not a natural product due to a man-made mutation, insertion, deletion, or the like.
Throughout the description of the present invention, the term "recombinant" is used interchangeably with the terms "non-native", "heterologous" and "exogenous". Thus, a "recombinant" protein is a protein expressed from a heterologous or exogenous polynucleotide sequence. The term recombinant as used with respect to a virus means a virus produced by the manual manipulation of viral genomes. A virus-based recombinant virus comprising a heterologous or foreign sequence (e.g., a foreign antigen-encoding sequence). The term recombinant virus is used interchangeably with the term non-native virus.
Thus, the term "heterologous vector" means a vector comprising a heterologous or exogenous polynucleotide sequence. The term "recombinant vector" means a vector comprising a heterologous or recombinant polynucleotide sequence.
The term "operably linked" as used herein is used to describe a linkage of a regulatory component to a gene or an interval encoding it. Typically, gene expression is under the control of one or more regulatory elements (such as, but not limited to, constitutive or inducible promoters, tissue-specific regulatory elements, and enhancers). The statement that a gene or coding region is "operably linked to" or "operably associated with" a regulatory component means that the gene or coding region is controlled or affected by the regulatory component. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
Furthermore, within the scope of this specification, the terms "functional linking", or "operably linked" mean that two or more nucleic acid sequences or sequence elements are positioned in a manner that allows them to function in the intended manner. For example, a promoter/enhancer or terminator is functionally linked to the coding gene sequence if it is capable of controlling or regulating the transcription of the gene sequence linked in an cis-position. Typically, but not necessarily, functionally linked DNA sequences are contiguous and, if necessary to join two polypeptide coding regions or, in the case of a secretory signal peptide, contiguous and in reading frame. However, while an operably linked promoter is typically located upstream, or an operably linked terminator is typically located downstream of a coding sequence, it is not necessarily contiguous therewith. Enhancers need not be contiguous, so long as they increase transcription of the coding sequence. For this purpose, it can be located upstream or downstream of the coding sequence and even at a distance. If the polyadenylation site is located 3' to the coding sequence, the polyadenylation site is operably linked to the coding sequence such that transcription proceeds through the coding sequence into the polyadenylation signal. Ligation is achieved by recombinant methods known in the art, for example by ligation at appropriate restriction sites or blunt ends or by using fusion PCR methods. If suitable restriction sites are not present, synthetic oligonucleotide linkers or adaptors can be used in accordance with conventional practice.
Thus, the term "functional fragment" or "functional derivative" of a promoter sequence means that the fragment or derivative still affects promoter activity. Functional tests on how to evaluate promoter activity are well known to those skilled in the art (Bustin 2000, Nolan et al 2006). Exemplary embodiments of this functional assay include, for example, promoter kinetics experiments. Cells infected with the vector virus carrying the expression cassette, in which the promoter or fragment thereof directs transcription of the reporter transgene, are incubated for various periods of time. Total RNA was prepared from samples collected at different times post infection. After destruction of the contaminating DNA by DNAse I digestion, the RNA is reverse transcribed. One replicate was treated with Reverse Transcriptase (RT) addition and the second replicate was treated without RT addition to demonstrate successful removal of contaminating DNA from RNA preparations. The resulting cDNA was purified and used as a template in conventional PCR. Only samples treated at the addition of RT will produce PCR products. These cdnas can then be used in qPCR using primers for reporter gene transgenes and in parallel using essential genes (internal standard genes) of viral vectors, whose transcription provides an internal standard for infection and replication efficiency. qPCR values for the internal standard genes were used to normalize qPCR values for the reporter genes between each other for different constructs and time post infection. This may explain the promoter activity of different promoters and fragments thereof.
"sequence homology" as used herein refers to a method of determining the relatedness of two sequences. To determine sequence homology, two or more sequences are optimally aligned and, if necessary, gaps are introduced. However, in contrast to "sequence identity", conservative amino acid substitutions are counted as matches when sequence homology is determined.
In other words, in order to obtain a comparable polypeptide or polynucleotide having 95% sequence homology to the reference sequence, 85%, preferably 90%, 91%, 92%, 93%, 94%, even more preferably 95%, 96%, 97%, 98%, 99%, 99.9% of the amino acid residues or nucleotides in the reference sequence must match or contain a conservative substitution with another amino acid or nucleotide. Alternatively, amino acids or nucleotides may be inserted into the reference sequence in a number of up to 15%, preferably up to 10%, 9%, 8%, 7%, 6%, even more preferably up to 5%, 4%, 3%, 2%, 1%, 0.1% of the total amino acid residues or nucleotides in the reference sequence (excluding conservative substitutions). Preferably, the homologous sequence comprises at least a stretch of 50, even more preferably 100, even more preferably 250, even more preferably 500 nucleotides.
The term "sequence identity" is known in the art and refers to the relationship of two or more polypeptide sequences or two or more polynucleotide sequences, i.e., a reference sequence, to a given sequence to be compared to the reference sequence. Sequence identity is determined by comparing a given sequence to a reference sequence after the sequences are optimally aligned to produce the highest degree of sequence similarity, as determined by matching the sequence strings to each other. After this alignment, sequence identity is determined on a position-by-position basis, e.g., if nucleotides or amino acid residues are identical at a position, the sequences are "identical" at that position. The total number of such positional identities is then divided by the total number of nucleotides or residues in the reference sequence to give the% sequence identity. Sequence identity can be readily calculated by known methods including, but not limited to, those described in: comparative Molecular Biology, Lesk, A.N. editor, Oxford University Press, New York (1988), Biocomputing: information and Genome Projects, Smith, D.W. editor, Academic Press, New York (1993); computer Analysis of Sequence Data, part I, Griffin, A.M. and Griffin, H.G. eds, Humana Press, New Jersey (1994); sequence analysis in Molecular Biology, von Heinge, G., Academic Press (1987); sequence analysis Primer, Gribskov, m. and Devereux, j. editors, m.stockton Press, New York (1991); and Carillo, h, and Lipman, d., SIAM j. applied math, 48:1073(1988), the teachings of which are incorporated herein by reference. Preferred methods for determining sequence identity are designed to obtain the greatest match between the sequences tested. Methods for determining sequence identity are compiled as publicly available computer programs for determining sequence identity between given sequences. Examples of such programs include, but are not limited to, the GCG program package (Devereux, J. et al, Nucleic Acids Research,12(1):387(1984)), BLASTP, BLASTN and FASTA (Altschul, S.F. et al, J.Molec.biol.,215: 403. 410 (1990). the BLASTX program is publicly available from NCBI and other sources (BLAST Man, Altschul, S. et al, NCVI NLM NIH Bethesda, MD 20894, Altschul, S.F. et al, J.Molec.biol.,215: 403. 410(1990) which teaches to be incorporated herein by reference.) the programs optimally use gap weights to align sequences to produce the highest degree of sequence identity between a given sequence and a reference sequence for a polynucleotide having a nucleotide sequence identity of at least (e.g. 92%, 91%, 85%, 93%, 99%, or even more preferably at least 91% to the nucleotide sequence of the given sequence of the reference, it is contemplated that the nucleotide sequence of a given polynucleotide is identical to a reference sequence, except that the given polynucleotide sequence may include up to 15, preferably up to 10, even more preferably up to 5 point mutations per 100 nucleotides of the reference nucleotide sequence. In other words, up to 15%, preferably 10%, 9%, 8%, 7%, 6%, even more preferably 5%, 4%, 3%, 2%, 1%, 0.1% of the nucleotides in a reference sequence may be deleted or substituted with another nucleotide, or up to 15%, preferably 10%, 9%, 8%, 7%, 6%, even more preferably 5%, 6%, even more preferably 5%, 4%, 3%, 2%, 1%, 0.1% of the total nucleotides in the reference sequence may be inserted into the reference sequence as many nucleotides as 15%, preferably 10%, 9%, 8%, 7%, 6%, even more preferably 5%, 4%, 3%, 2%, 1%, 0.1% of the total nucleotides in the reference sequence. Such mutations of the reference sequence can occur at the 5 'or 3' terminal positions of the reference nucleotide sequence or at any position between those terminal positions, interspersed individually between each nucleotide in the reference sequence or in the form of one or more contiguous groups within the reference sequence. Similarly, for a given amino acid sequence for which the polypeptide has at least (e.g.) 85%, preferably 90%, 91%, 92%, 93%, 94%, even more preferably 95%, 96%, 97%, 98%, 99% sequence identity to the reference amino acid sequence, the given amino acid sequence for the polypeptide is expected to be identical to the reference sequence, except that the given polypeptide sequence may include up to 15, preferably up to 10, 9, 8, 7, 6, even more preferably up to 5, 4, 3, 2, 1 amino acid alteration per 100 amino acids of the reference amino acid sequence. In other words, in order to obtain a given polypeptide sequence having at least 85%, preferably 90%, 91%, 92%, 93%, 94%, even more preferably 95%, 96%, 97%, 98%, 99% sequence identity to a reference amino acid sequence, up to 15%, preferably up to 10%, 9%, 8%, 7%, even more preferably up to 5%, 4%, 3%, 2%, 1% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or up to 15%, preferably up to 10%, 9%, 8%, 7%, even more preferably up to 5%, 4%, 3%, 2%, 1% of the number of amino acids of the total number of amino acid residues in the reference sequence may be inserted into the reference sequence. Such alterations of the reference sequence can occur at the amino-or carboxy-terminal positions of the reference amino acid sequence or at any position between those terminal positions, interspersed individually among residues in the reference sequence or as one or more contiguous groups within the reference sequence. Preferably, the different residue positions differ by conservative amino acid substitutions. However, conservative substitutions are not included as a match when determining sequence identity.
The terms "sequence identity" or "% identity" are used interchangeably herein. For the purposes of the present invention, it is defined herein that in order to determine the identity% of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid for optimal alignment with a second amino acid or nucleic acid sequence). The amino acid or nucleotide residues at the corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid or nucleotide residue as the corresponding position in the second sequence, then the molecules are identical at that position. The% identity of two sequences to each other varies with the number of identical positions shared by the sequences (i.e.,% identity is the number of identical positions/total positions (i.e., overlapping positions) × 100). Preferably, the two sequences are the same length.
Sequence comparison may be performed over the entire length of the two sequences being compared, or over a fragment of the two sequences. Typically, the comparison will be performed over the entire length of the two sequences being compared. However, sequence identity may be effected over, for example, 20, 50, 100 or more regions of contiguous amino acid residues.
The skilled person will be aware of the fact that: several different computer programs are available for determining the homology of two sequences with respect to each other. For example, sequence comparison of two sequences to each other and determination of% identity can be accomplished using a mathematical algorithm. In a preferred embodiment, the identity of two amino acid or nucleic acid sequences to each other is determined using the Needleman and Wunsch (J.mol.biol. (48):444-453(1970)) algorithm, which is incorporated into the GAP program in the Accelrys GCG package, using either the Blosum 62 matrix or the PAM250 matrix, and the GAP weights of 16, 14, 12, 10, 8, 6 or 4 and the length weights of 1, 2, 3, 4, 5 or 6. It will be appreciated by those skilled in the art that all of these different parameters will produce slightly different results, but that the overall% identity of two sequences does not change significantly when different algorithms are used.
The protein sequences or nucleic acid sequences of the invention can be used as "query sequences" to perform searches against public databases, for example to identify other family members or related sequences. The searches can be performed using the BLASTN and BLASTP programs (version 2.0) of Altschul et al, (1990) J.mol.biol.215: 403-10. BLAST protein searches can be performed using the BLASTP program, score 50, and word length 3 to obtain amino acid sequences homologous to the protein molecules of the invention. To obtain a gapped alignment for comparison purposes, gapped BLAST can be utilized as described in: altschul et al (1997) Nucleic Acids Res.25(17):3389-3402 when utilizing BLAST and gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See national center for Biotechnology Information homepage
EHV-1 and EHV-4/recombinant vector technology Definitions
The term "equine" or "equine" means or belongs to the family of equine animals, which includes horses, donkeys and zebras, preferably horses. In addition, the term "equine" or "horse" ("equine" or "equin") also encompasses hybrids of members of the equine family (e.g., mule (mules), mule (hinnies), etc.).
"herpesvirus" or "herpesvirus vector" refers to a species within the herpesviridae family of Herpesviridae.
The term "equine herpesvirus vector" or "equine herpesvirus" or "EHV" means a member of the herpesvirus family that affects horses. To date, eight different species of equine herpesviruses have been identified, of which five subfamilies alphaherpesviridae (EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9) and three genera of the subfamily C herpesvirus. (VirusTaxonomy: EC 47 release 2015, London, UK, 7 months 2015; E-mail approval 2016(MSL number 30)
The term "EHV-1" means equine alphaherpesvirus 1, a member of the subfamily varicella of the subfamily alphaherpesviridae. Non-limiting reference sequences for EHV-1 will be, for example, wild-type EHV-1 strain ab4 (GenBank accession AY665713.1) or RacH (Hubert 1996).
The term EHV-4 means equine alphaherpesvirus 4, a member of the subgenus varicella of the subfamily alphaherpesviridae.
The term "inserted into UL 18" or "inserted into ORF 43" means that the DNA fragment is inserted into the genomic DNA at a position encoding the open reading frame 43(UL18) of equine alphaherpesvirus 1. In a particular aspect of the invention, the mentioned insertion results in a complete deletion of ORF43(UL18) (945 bp).
The term "inserted into UL 8" or "inserted into ORF 54" means that the DNA fragment is inserted into the genomic DNA at a position encoding the open reading frame 54(UL8) of equine alphaherpesvirus 1. In a particular aspect of the invention, the insertion referred to results in a (2256bp) deletion of ORF54 (UL 8).
The term "inserted into ORF 70" or "inserted into US 4" means that the DNA fragment is inserted into the genomic DNA at the position encoding the open reading frame 70 of equine alpha herpes virus 1 (US 4). In a particular aspect of the invention, the insertion referred to results in deletion of 801 5 'base pairs of ORF70(US4) leaving the remaining 423bp of the 3' end intact, but abolishing expression of the ORF70(US4) gene product glycoprotein G. It was shown that glycoprotein G of several alphaherpesviruses, including EHV-1, can be secreted from infected cells and used as an immunomodulatory protein by binding proinflammatory interleukins. Elimination of expression in viral vectors should increase the immunogenicity of viral infections compared to wild-type EHV-1 with intact glycoprotein G expression.
The term "inserted in ORF 1/3" or "inserted in UL 56" means that the DNA fragment is inserted into the viral genome at a position where a 1283bp fragment comprising 90% of ORF1 and the entire ORF2 is lost by accidental deletion by passage during the attenuation procedure of vaccine strain EHV-1 RacH. This insertion site was chosen because the likelihood that expression of the transgene from this site would interfere with viral replication would be expected to be very low.
The term "inactivation" refers to a mutation within UL8(ORF54) and/or UL18(ORF 43). The term mutation encompasses modifications in the viral DNA encoding the proteins which result in changes in the encoded proteins. The term mutation relates to, but is not limited to, a substitution (replacing one or several nucleotides/base pairs), a deletion (removing one, several or all nucleotides/base pairs) and/or an insertion (adding one or several nucleotides/base pairs). Thus, the term mutation includes, but is not limited to, the following mutations: point mutations (single nucleotide mutations) or larger mutations, in which, for example, parts of the coding (and/or non-coding) nucleotides/base pairs are deleted (partial deletion) or deleted (complete deletion), all coding (and/or non-coding) nucleotides/base pairs are replaced and/or additional coding (and/or non-coding) nucleotides/base pairs are inserted. It is to be understood that the term mutation encompasses mutations within coding nucleotide/base pairs, mutations within non-coding nucleotide/base pairs, e.g., regulatory nucleotide/base pairs, and mutations within coding nucleotide/base pairs and non-coding nucleotide/base pairs. Furthermore, the term mutation also encompasses inversions of nucleotides/base pairs (coding and/or non-coding), such as inversions of a part or all of coding nucleotides/base pairs or inversions of a part or all of non-coding nucleotides/base pairs or combinations thereof. Furthermore, the term mutation also encompasses the relocation of nucleotides/base pairs (coding and/or non-coding), such as the relocation of a part or all of the coding nucleotides/base pairs or the relocation of a part or all of the non-coding nucleotides/base pairs or a combination thereof. As used herein, a mutation can be a single mutation or several mutations, and thus, the term "mutation" is often used and refers to a single mutation as well as several mutations. Such mutations may result in improved expression of the protein due to changes in the coding sequence. However, the term mutation is well known to those skilled in the art and a mutation can be generated by those skilled in the art without the need for an explicit indication.
Furthermore, the term "inactivation" encompasses reduced (or eliminated) expression of UL18 and/or UL8RNA and/or protein. It is understood that reduced expression encompasses reduced RNA transcription as well as reduced protein expression. Preferably, expression of UL18 and/or UL8RNA and/or protein is reduced by 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, 95-99% or more by RNA and/or protein as compared to expression of a wild-type EHV virus or an EHV virus of the invention cultured in a complementing cell line. More preferably, expression of UL18 and/or UL8RNA and/or protein is reduced by 50-100%, 60-100%, 70-100%, 80-100% or 90-100% by RNA and/or protein compared to expression of wild-type EHV virus or EHV virus of the invention cultured in a complementing cell line. Even more preferably, expression of UL18 and/or UL8RNA and/or protein is reduced by 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% in an EHV of the invention by RNA and/or protein as compared to expression of a wild-type EHV virus or an EHV virus of the invention cultured in a complementing cell line.
The term "complete or partial deletion, substitution or inversion" encompasses complete or partial deletion, complete or partial substitution and complete or partial inversion. The term "complete" means that the stop from the start codon to ORF (UL) affects the entire ORF (UL). Preferably, UL18 and/or UL8 are completely deleted, substituted or inverted. However, the term "part" means that only a part of the entire orf (ul) is affected. Preferably, UL18 and/or UL8 are partially deleted, substituted or inverted.
The term "from the 5 '-end of the initiation codon" refers to deletion, substitution or inversion of ORF (UL) at the 5' -end. The term as used herein is to be understood as meaning that the deletion, substitution or inversion affects (includes) the start codon of the ORF. Thus, a part of the 3 '-end region of the ORF was retained, and a part of the 5' -end region of the ORF was deleted. However, such deletion, substitution or inversion from the 5' -end may cause deletion of one or more amino acids in the corresponding protein, or cause a frame shift in the ORF, which results in a coding region different from the wild-type protein. However, such deletion, substitution or inversion at the 5' -end may not cause expression of the protein at all, since the start codon is truncated.
The term "A, T or G from the start codon" as used herein is to be understood that the deletion, substitution or inversion may start with A or T or G. A is deleted if the deletion starts with A. However, if the deletion from a comprises a deletion of two or more nucleotides, then T is also deleted. Furthermore, if the deletion from a comprises a deletion of three or more nucleotides, A, T and G are deleted. However, it will be appreciated that if the deletion starts with T, then T is deleted while A of the ATG is still retained. Furthermore, if the deletion starts with a G, then G is deleted, while the A and T of the ATG remain.
The term "within UL 18" or "within UL 8" as used herein is to be understood that the deletion, substitution or inversion of a nucleotide can occur anywhere within the orf (UL). Thus, this deletion, substitution or inversion of nucleotides may affect only the 5 '-end of UL8(ORF54) and/or UL18(ORF43), only the 3' -end of UL8(ORF54) and/or UL18(ORF43) or the remaining nucleotides of this ORF (UL) or any combination thereof.
The term "replication defect" is well known to those skilled in the art. Generally, the term means that replication of the virus in a host (e.g., a mammalian cell or cell line) is reduced. Preferably, replication is reduced by at least 90%, preferably 95%, preferably 97.5%, even more preferably 99.5%, even more preferably 99.75% and optimally 100%. If replication is reduced by 100%, replication is completely eliminated. Preferably, the replication is comparable to a non-replication deficient virus of the same species. Preferably, the replication is comparable to that of replication-defective viruses cultured in complement cells or cell lines. Preferably, the replication-deficient EHVs of the invention are still infectious and replicate, but may be packaged only as replication-competent viruses in complement cells or cell lines. Preferably, viral DNA and viral proteins are still produced in the host, and thus, the replication deficient EHVs of the invention still induce an immune response and/or protect immunity.
The term "complementing cell line" or "complementing cell" is well known to the person skilled in the art. In the present invention, the complementing cell line cell is a cell line expressing UL8 and/or UL18 (or a functional part thereof) of EHV (preferably EHV-1). Since the replication-deficient EHV vector comprises inactivated UL8 and/or UL18, the replication-deficient EHV does not replicate in a host cell (e.g., a mammalian cell or cell line), but replicates in a corresponding complementing cell line expressing UL8 and/or UL 18.
The term "TCID 50" is well known to those skilled in the art. Generally, this endpoint dilution assay quantifies the amount of virus required to kill 50% of infected cells or produce cytopathic effects in 50% of seeded tissue culture cells. Assays for measuring TCID50 are well known to those skilled in the art, such as the Spearman-Karber or Reed-Muench methods (Reed and Muench, 1938).
The term "infectivity" means the introduction of a virus into a host or host cell.
Vaccine definition
An "immunogenic or immunological composition" refers to a composition of matter comprising at least one antigen or immunogenic portion thereof, which elicits a cellular or antibody-mediated immune response in a host to the composition.
The term "antigen" as used herein is well known in the art and includes substances that are immunogenic (i.e., immunogens) as well as substances that induce immune unresponsiveness or anergy (i.e., the body's defense mechanisms are unresponsive to foreign substances). The term "antigen" as used herein is intended to refer to full-length proteins containing or comprising epitopes, as well as peptide fragments thereof.
The term "food producing animal" means an animal for human consumption, such as pigs, cattle, poultry, fish and the like, preferably food producing animals means pigs and cattle, most preferably pigs.
As used herein, "immunogenic composition" may refer to a polypeptide or protein, such as a viral surface protein that elicits an immune response as described herein. The term "immunogenic fragment" or "immunogenic portion" refers to a fragment or truncated and/or substituted form of a protein or polypeptide that includes one or more epitopes and thereby elicits the immune response described herein. Generally, such truncated and/or substituted forms or fragments will comprise at least six contiguous amino acids from the full-length protein. Such fragments can be identified using any number of epitope mapping techniques well known in the art. See, for example, Epitope Mappingprotocols in Methods in Molecular Biology, Vol.66 (Glenn E. Morris, eds., 1996) Humana Press, Totowa, N.J.. For example, linear epitopes can be determined by simultaneously synthesizing a large number of peptides (which correspond to portions of a protein molecule) on a solid support, and reacting the peptides with an antibody while the peptides are still attached to the support. Such techniques are known and described in the art, see, for example, U.S. Pat. nos. 4,708,871; geysen et al (1984) Proc.Natl.Acad.Sci.USA 81: 3998-; and Geysen et al (1986) molecular. Immunol.23: 709-715. Similarly, conformational epitopes are readily identified by determining the spatial conformation of amino acids, for example by x-ray crystallography and two-dimensional nuclear magnetic resonance. See Epitope Mapping Protocols, supra. Also included within this definition are synthetic antigens, such as polyepitopes, flanking epitopes, and other recombinant or synthetically derived antigens. See, e.g., Bergmann et al (1993) Eur.J.Immunol.23: 2777-2781; bergmann et al (1996), J.Immunol.157: 3242-3249; suhrbier, A. (1997), immunol. and Cell biol.75: 402-; and Gardner et al, (1998)12th world AIDS Conference, Geneva, Switzerland, 6 months 28 to 7 months 3 days 1998. (the teachings and content thereof are incorporated herein by reference in their entirety.)
The term "immunization" relates to active immunization by: the immunogenic composition is administered to a food producing animal to be immunized, thereby eliciting an immunological response against the antigen included in the immunogenic composition.
The term "in need or of need" as used herein means that administration/treatment involves strengthening or improving health or clinical signs or any other positive medical effect on the health of an animal receiving the immunogenic composition of the invention.
The term "vaccine" as used herein refers to a pharmaceutical composition comprising at least one immunologically active component that induces an immune response in an animal and may, but need not, comprise one or more additional components that enhance the immunological activity of the active component. The vaccine may additionally comprise other components typical of pharmaceutical compositions. By distinction, the immunologically active component of the vaccine may comprise intact virus particles in their original form or attenuated particles in a so-called Modified Live Vaccine (MLV) or particles inactivated by a suitable method in a so-called Killed Vaccine (KV). In another form, the immunologically active components of the vaccine may comprise appropriate components of the organism (subunit vaccine), wherein the components are generated by: the desired structures are produced by disruption of the whole particles or the growing culture containing them and optionally subsequent purification steps, or by synthetic methods, including appropriate manipulations with suitable systems based on, for example, bacteria, insects, mammals or other species, plus optionally subsequent isolation and purification procedures, or by inducing synthetic processes in animals in need of a vaccine (polynucleotide vaccination) by direct incorporation of genetic material using suitable pharmaceutical compositions. The vaccine may comprise one or more of the above components simultaneously. As used in particular aspects of the invention, "vaccine" refers to a live vaccine or live virus, also known as a recombinant vaccine. In another particular aspect of the invention, a "vaccine" refers to an inactivated or killed virus comprising a virus-like particle (VLP). Thus, the vaccine may be a subunit vaccine or a Killed (KV) or inactivated vaccine.
The term "multiplicity of infection (m.o.i.)" describes how many infectious units, e.g., TCID50 of a viral preparation is used per cell to infect cultured cells. For example, an m.o.i. of 0.01 means that for every 100 cells in the culture vessel, one infectious unit is inoculated.
The term "DNA vaccination" or "polynucleotide vaccination" means the direct inoculation of genetic material with a suitable pharmaceutical composition.
Various physical and chemical methods of inactivation are known in the art. The term "inactivation" refers to the prior inactivation or killing of a virus or bacterium that is virulent or avirulent by irradiation (ultraviolet (UV), X-ray, electron beam, or gamma radiation), heating, or chemical treatment, while retaining its immunogenicity. Suitable inactivators include beta-propiolactone, binary or beta-or acetyl-ethylidene, glutaraldehyde, ozone, and formalin (formaldehyde).
For inactivation by formalin or formaldehyde, formaldehyde is typically mixed with water and methanol to produce formalin. The addition of methanol prevents degradation or cross-reaction during the inactivation process. One embodiment uses about 0.1% to 1% 37% formaldehyde solution to inactivate viruses or bacteria. It is essential that the amount of formalin is adjusted to ensure material inactivation, but not so much that high dose side effects occur.
More specifically, the term "inactivated" in a virus means that the virus cannot replicate in vivo or in vitro, and the term "inactivated" in a bacterium means that the bacterium cannot replicate in vivo or in vitro, respectively. For example, the term "inactivated" may refer to a virus that has been propagated in vitro and then inactivated using chemical or physical means such that it is no longer able to replicate. In another example, the term "inactivated" may refer to a bacterium that has been propagated and then chemically or physically inactivated, thereby producing a suspension of the bacterium, fragments or components of the bacterium, e.g., producing a vaccine that can be used as a component of a vaccine.
The terms "inactivate", "kill" or "KV" as used herein are used interchangeably.
The term "live vaccine" refers to a vaccine comprising a living organism or a replication competent virus or viral vector.
A "pharmaceutical composition" consists essentially of one or more components capable of altering the physiological (e.g., immunological) function of the organism to which it is administered or of an organism that survives or survives in or on the organism. The term includes, but is not limited to, antibiotics or antiparasitic agents, as well as other ingredients commonly used to achieve some other purpose, such as, but not limited to, processing characteristics, sterility, stability, feasibility of administering compositions via enteral or parenteral routes (e.g., oral, intranasal, intravenous, intramuscular, subcutaneous, intradermal, or other suitable routes), tolerance after administration, or controlled release properties. One non-limiting example of such a pharmaceutical composition (for illustrative purposes only) may be prepared as follows: cell culture supernatants of infected cell cultures are mixed with stabilizers, such as spermidine (speramine) and/or Bovine Serum Albumin (BSA), and the mixture is then lyophilized or otherwise dehydrated. The mixture is then rehydrated in an aqueous solution (e.g., saline, Phosphate Buffered Saline (PBS)) or a non-aqueous solution (e.g., oil emulsion, aluminum-based adjuvant) prior to vaccination.
As used herein, "pharmaceutically or veterinarily acceptable carrier" includes any and all solvents, dispersion media, coating agents, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. In some preferred embodiments, and in particular those immunogenic compositions, which include lyophilization, the stabilizers used in the present invention include stabilizers used for lyophilization or freeze drying.
In some embodiments, the immunogenic compositions of the invention contain an adjuvant. As used herein, "adjuvants" may include aluminum hydroxide and aluminum phosphate, saponins such as Quil a, QS-21(Cambridge Biotech inc., Cambridge ma), GPI-0100 (galenical Pharmaceuticals, inc., Birmingham, AL), water-in-oil emulsions, oil-in-water emulsions, water-in-oil-in-water emulsions. In particular, the emulsion may be based on light liquid paraffin oil (typical of european medicines); isoprenoid oils such as squalane or squalene; oils resulting from the oligomerization of olefins (specifically isobutylene or decene); esters of acids or alcohols containing straight chain alkyl groups, more particularly vegetable oils, ethyl oleate, propylene glycol di- (caprylate/caprate), tri- (glyceryl caprylate/caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearate. The oil is used in combination with an emulsifier to form an emulsion. The emulsifier is preferably a nonionic surfactant, specifically: esters of sorbitan, of mannide (e.g. anhydrous mannitol oleate), of glycols, of polyglycerol, of propylene glycol, and of oleic acid, isostearic acid, ricinoleic acid or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular the Pluronic products, in particular L121. See Hunter et al, The Theory and practical application of Adjuvants (eds. Stewart-Tull, D.E.S.), John Wiley and Sons, NY, pp 51-94 (1995) and Todd et al, Vaccine 15:564-570 (1997). Examples of adjuvants are The SPT emulsion described on page 147 of "Vaccine Design, The Subunit and Adjuvant Approach", edited by M.Powell and M.Newman, Plenum Press,1995, and The emulsion MF59 described on page 183 of The same book.
Another example of an adjuvant is a compound selected from the group consisting of polymers of acrylic acid or methacrylic acid and copolymers of maleic anhydride and alkenyl derivatives. Advantageous adjuvant compounds are polymers of acrylic acid or methacrylic acid, in particular crosslinked with polyalkenyl ethers of sugars or polyols. These compounds are known under the term carbomer (carbomer) (Phameuropa, volume 8, phase 2, 6 months 1996). Those skilled in the art can also refer to U.S. Pat. No. 2,909,462, which describes such acrylic polymers crosslinked with polyhydroxylated compounds having at least 3, preferably not more than 8, hydroxyl groups, the hydrogen atoms of at least three of which are replaced by unsaturated aliphatic groups having at least 2 carbon atoms. Preferred groups are those containing 2 to 4 carbon atoms, such as vinyl, allyl and other ethylenically unsaturated groups. The unsaturated groups may themselves contain other substituents, for example methyl groups. By name
Figure BDA0002679943200000401
Products sold (BF Goodrich, Ohio, USA) are particularly suitable. Which is crosslinked with allyl sucrose or allyl pentaerythritol. Among these, Carbopol 974P, 934P and 971P may be mentioned. Most preferably using
Figure BDA0002679943200000402
971P. Among the copolymers of maleic anhydride and alkenyl derivatives, in particular the copolymers ema (monsanto), which are copolymers of maleic anhydride and ethylene. Dissolution of such polymers in water produces an acid solution which will be neutralized, preferably to physiological pH, to produce an adjuvant solution which will be incorporated into the immunogenic, immunogenic or vaccine composition itself.
Other suitable adjuvants include, but are not limited to, RIBI adjuvant system (Ribi Inc.), block copolymers (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine (Avridine) lipid-amine adjuvants, heat labile enterotoxin from E.coli (recombinant or otherwise), cholera toxin, IMS 1314 or muramyl dipeptide, or natural or recombinant interleukins or analogs thereof or stimulators of endogenous cytokine release, and the like, among others.
It is contemplated that the adjuvant may be added in an amount of about 100 μ g to about 10mg per dose, preferably in an amount of about 100 μ g to about 10mg per dose, more preferably in an amount of about 500 μ g to about 5mg per dose, even more preferably in a dose of about 750 μ g to about 2.5mg per dose, and most preferably in an amount of about 1mg per dose. Alternatively, the adjuvant may be at a concentration of about 0.01% to 50%, preferably at a concentration of about 2% to 30%, more preferably at a concentration of about 5% to 25%, still more preferably at a concentration of about 7% to 22%, and most preferably at a concentration of 10% to 20%, by volume of the final product.
"diluents" may include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents may include, inter alia, sodium chloride, dextrose, mannitol, sorbitol and lactose. Stabilizers include, inter alia, albumin and alkali metal salts of ethylenediaminetetraacetic acid.
"isolated" means "altered by the human hand" from its natural state, i.e., if it occurs in nature, it has been altered or removed from its original environment, or both. For example, a polynucleotide or polypeptide naturally present in a living organism is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated," as the term is used herein.
By "attenuated" is meant reducing the virulence of the pathogen. In the present invention, "attenuated" is synonymous with "avirulent". In the present invention, an attenuated virus line has reduced virulence so as not to cause clinical signs of infection but is capable of inducing an immune response in the target mammal, but may also mean a reduced incidence or severity of clinical signs in animals infected with an attenuated virus, particularly the claimed EHV-1RacH viral vector, as compared to a "control group" of animals infected with a non-attenuated virus or pathogen and not receiving the attenuated virus. In this context, the term "reduced" means a reduction of at least 10%, preferably 25%, even more preferably 50%, still more preferably 60%, even more preferably 70%, still more preferably 80%, even more preferably 90% and most preferably 100% compared to a control group as defined above. Thus, attenuated avirulent pathogens, such as the claimed attenuated viral vectors, in particular the claimed EHV-1 (preferably RacH) viral vectors, are suitable for the production of Modified Live Vaccines (MLVs) or modified live immunogenic compositions.
The term "treating and/or preventing" refers to reducing the incidence of infection in a herd or reducing the severity of clinical signs caused by or associated with a particular infection. Thus, the term "treating and/or preventing" also refers to reducing the number of animals infected with a pathogen or reducing the severity of clinical signs typically associated with or caused by infection in a herd compared to a herd in which the animals have not received an effective amount of an immunogenic composition as provided herein.
"treatment and/or prevention" generally relates to the administration of an effective amount of an immunogenic composition of the invention to an animal or animal herd in need of such treatment/prevention or which may benefit therefrom. The term "treatment" refers to the administration of an effective amount of an immunogenic composition after an animal or at least some of the animals of a herd have been infected with the pathogen and wherein the animals have exhibited some clinical sign caused by or associated with infection by the pathogen. The term "preventing" refers to administering to an animal prior to any infection of the animal by a pathogen or at least before none of the animals in the animal or herd of animals exhibits any clinical signs caused by or associated with infection by the pathogen. The terms "prevent" and "preventing" are used interchangeably in this application.
The term "clinical signs" as used herein refers to signs of infection of an animal with a pathogen. The clinical signs of infection depend on the pathogen chosen. Examples of such clinical signs include, but are not limited to, respiratory distress, otitis, gross hair tangles, mild fever, depression, and decreased appetite. However, clinical signs also include, but are not limited to, clinical signs that can be observed directly from a living animal. Examples of clinical signs that can be directly observed from an animal include runny nose and tears, lethargy, cough, wheezing, pounding, high fever, weight loss, dehydration, lameness, wasting, pale skin, frailty, and the like.
As used herein, an "effective dose" means, but is not limited to, an amount of an antigen that causes or is capable of eliciting an immune response, which results in a reduction in clinical symptoms in an animal to which the antigen is administered.
As used herein, the term "effective amount" in a composition means an amount of an immunogenic composition that is capable of inducing an immune response, reducing the incidence of disease in an animal, or reducing the severity of infection or disease event. In particular, an effective amount refers to Colony Forming Units (CFU) per dose. Alternatively, in therapy, the term "effective amount" refers to an amount of therapy sufficient to reduce or ameliorate the severity or duration of a disease or disorder or one or more symptoms thereof, prevent the progression of a disease or disorder, cause regression of a disease or disorder, prevent the recurrence, development, onset, or progression of one or more symptoms associated with a disease or disorder, or enhance or improve the prevention or treatment of another therapy or therapeutic agent.
By "immune response" or "immunological response" is meant, but is not limited to, the development of a cellular and/or antibody-mediated immune response to a target (immunogenic) composition or vaccine. Typically, the immune or immunological reaction includes (but is not limited to) one or more of the following effects: generating or activating antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells specific for one or more antigens included in the composition or vaccine of interest. Preferably, the host will exhibit a therapeutic or protective immune (memory) response such that resistance to new infections will be enhanced and/or the clinical severity of the disease reduced. The protection will be evidenced by a reduction in the number of symptoms, severity of symptoms, or lack of one or more symptoms associated with a pathogen infection, delay in onset of viremia, reduction in viral persistence, reduction in overall viral load, and/or reduction in viral shedding.
"protection against disease," "protective immunity," "functional immunity," "reduction in clinical symptoms," "induction/production of neutralizing antibodies and/or seroconversion," and similar phrases, mean a partial or complete response to a disease or condition produced by administration of one or more therapeutic compositions of the invention, or a combination thereof, that results in fewer deleterious effects than would be expected from exposure of a non-immunized individual to the disease or infection. That is, the severity of the deleterious effects of infection in vaccinated individuals is reduced. Infection may be reduced, slowed, or possibly completely prevented in vaccinated individuals. In this context, it is specifically indicated if complete prevention of infection is intended. If complete prevention is not indicated, the term includes partial prevention.
Herein, "reduction in the incidence and/or severity of clinical signs" or "reduction in clinical symptoms" means, but is not limited to, reducing the number of infected individuals in a group, reducing or eliminating the number of individuals exhibiting clinical signs of infection, or reducing the severity of any clinical signs present in one or more individuals, as compared to a wild-type infection. For example, it shall refer to any reduction in pathogen load, pathogen shedding, reduction in pathogen transmission, or any reduction in clinical signs of symptoms of malaria. Preferably, the clinical signs of one or more subjects receiving the composition are reduced by at least 10% compared to subjects not receiving the therapeutic composition of the invention and infected. More preferably, the clinical signs of the individual receiving the composition of the invention are reduced by at least 20%, preferably by at least 30%, more preferably by at least 40% and even more preferably by at least 50%.
The term "increased protection" means herein, but is not limited to, a statistically significant reduction in one or more clinical symptoms associated with infection by an infectious agent in a group of vaccinated individuals relative to a control group of unvaccinated individuals. The term "statistically significant reduction of clinical symptoms" means, but is not limited to, that the frequency of onset of at least one clinical symptom in a group of vaccinated individuals is at least 10%, preferably 20%, more preferably 30%, even more preferably 50% and even more preferably 70% lower than in a non-vaccinated control group after challenge with an infectious agent.
"permanent protection" shall mean "improved efficacy" for at least 3 weeks, but more preferably at least 3 months, still more preferably at least 6 months. In the case of livestock, most preferably, the permanent protection should last until the average age for the meat is sold by the animal.
The term "reduction of viremia" induced by a virus means, but is not limited to, a reduction of virus entering the bloodstream of an animal, wherein the extent of viremia, i.e. the number of copies of viral DNA or RNA per ml of serum or plaque-forming colonies per pooled serum, is reduced by at least 50% in the serum of an animal receiving the composition compared to an animal not receiving the composition of the invention and which may be infected. More preferably, the level of viremia is reduced by at least 90%, preferably at least 99.9%, more preferably at least 99.99%, and even more preferably at least 99.999% in an animal receiving a composition of the invention.
The term "pathogen" is well known to those skilled in the art. However, the term "pathogen" includes bacteria and viruses. The term "pathogen" encompasses pathogens such as schmallenberg virus, influenza a virus, porcine respiratory and reproductive syndrome virus, porcine circovirus, classical swine fever virus, african swine fever virus, hepatitis E virus, bovine viral diarrhea virus, rabies virus, feline measles virus, clostridium tetani, mycobacterium tuberculosis, actinobacillus pleuropneumoniae.
The term "food producing animal" means an animal for human consumption, such as pigs, cattle, poultry, fish and the like, preferably pigs.
The term "companion animal" encompasses animals such as cats, horses or dogs.
The term "viremia" as used herein shall be understood in particular as a condition in which viral particles replicate and/or circulate in the bloodstream of an animal, in particular a mammal, a bird or an insect.
"safe" means that there are no adverse consequences in the vaccinated animal after vaccination, including but not limited to: virus-based vaccines potentially reverse to virulent, clinically significant side effects, such as persistent, systemic disease, or unacceptable inflammation at the site of vaccine administration.
The term "vaccination" or "vaccinating" or variations thereof as used herein is meant to include, but is not limited to, a process of administering an immunogenic composition of the invention which, when administered to an animal, elicits or is capable of eliciting (directly or indirectly) an immune response in the animal.
In the context of the present invention, "mortality" refers to death caused by infection and includes situations where the infection is so severe that the animal is euthanized to prevent distress and provide a humane fate for its life.
Preparation
The subject to which the composition is administered is preferably an animal, including, but not limited to, cattle, horses, sheep, pigs, poultry (e.g., chickens), goats, cats, dogs, hamsters, mice, and rats, most preferably a mammal-based pig.
The formulations of the invention comprise an effective immunizing amount of one or more immunogenic compositions and a physiologically acceptable vehicle. The vaccine comprises an effective immunizing amount of one or more immunogenic compositions and a physiologically acceptable vehicle. The formulation should be suitable for the mode of administration.
The immunogenic composition may also contain minor amounts of wetting or emulsifying agents or pH buffering agents, if desired. The immunogenic composition can be a liquid solution, suspension, emulsion, lozenge, pill, capsule, sustained release formulation, or powder. Oral formulations may include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like.
Method of treatment
Preferred routes of administration include, but are not limited to, intranasal, oral, intradermal, and intramuscular. Most preferably in a single dose in drinking water. One skilled in the art will recognize that the compositions of the present invention may also be administered in one, two or more doses by other routes of administration. Such other routes include, for example, subcutaneous, intradermal, intraperitoneal, and depending on the desired duration and effectiveness of treatment, the compositions of the invention may be metered, for example, once or several times daily, also intermittently at different doses (e.g., about 10) 3To 108TCID50 (see above for viral titers)) for several days, weeks or months. In a particular aspect of the invention, the dosage is about 103To 108TCID50, particularly for live virus/live vaccine.
If desired, the compositions may be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise a metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration, preferably to a mammal, especially a pig. The container(s) may carry a notice in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice indicates approval by the agency of manufacture, use or sale for human administration.
Definition of antigen
The term "swine influenza virus" is known to the person skilled in the art. The term swine influenza virus refers to influenza virus type a or C from the orthomyxovirus family that causes swine influenza. Although orthomyxoviruses have three groups: influenza types a, B and C, but only influenza types a and C, infect pigs. Preferably, the swine influenza virus is swine influenza a virus. Subtypes of swine influenza virus include H1N1, H1N2, H3N2, and H3N 1. H9N2 and H5N1 may also be found in pigs. Preferably, the swine influenza virus is an influenza virus isolated from swine.
The terms "HA" or "H", "NA" or "N" and "NP" are known to those skilled in the art. However, in general, influenza a virus is subdivided into 17H (hemagglutinin) and 10N (neuraminidase) subtypes, which yield many possible combinations (designated H1N1, H1N2 … H2N1, H2N2 … H5N1, H5N2 …, etc.). H (hemagglutinin) and N (neuraminidase) are surface glycoproteins in influenza a viruses (e.g., SIAV). In addition, N is the primary antigenic target of neutralizing antibodies. In addition, NP (nucleoprotein) forms the nucleocapsid.
Sequence overview:
the following sequences are described in detail and are disclosed in the present invention:
1EHV-1ORF43(UL18) Gene sequence
2EHV-1ORF54(UL8) Gene sequence
3 codon optimized ORF43(UL18) Gene sequence
Codon-optimized ORF54(UL8) gene sequence of SEQ ID NO 4
SEQ ID NO. 5 171 bases upstream of ORF43(UL18) gene
6 265 bases downstream of the ORF43(UL18) gene
SEQ ID NO. 7 has the mCMV gene driven by the BGH poly A promoter of SEQ ID NO. 5 and 6
8 side-connected kanamycin genes of SEQ ID NO 5 and 6
9 161 bases upstream of the ORF43(UL18) gene
10 120 bases downstream of the ORF43(UL18) gene
11 200 nucleotides upstream of the ORF54(UL8) gene
12 200 nucleotides downstream of the ORF54(UL8) gene
SEQ ID NO 13 has the mCMV gene driven by the BGH poly A promoter of SEQ ID NO 5 and 6
HA sequence of SEQ ID NO. 14 cloned at ORF1/3(UL56) site
15 transfer vector pU70-p455-71K71 nucleotide sequence
16 transfer plasmid pU70-p455-H3-71K71 nucleotide sequence
17 left (Up70) flanking region (417bp) of SEQ ID NO
18 Right (Up71) flanking region (431bp) of SEQ ID NO
SEQ ID NO 19 left flanking region (upper orf70) in wild type EHV-1 strain ab4 (Genbank accession number AY665713.1) located at nucleotides 127264-127680
20 wild-type EHV-1 strain ab4 (GenBank accession AY665713.1) located at the right flanking region of nucleotides 128484-128913 (upper orf71)
Truncated flanking region in the SEQ ID NO:21RED system: the left (Up70) flanking region (283bp) is the same as the 3' 283bp of the 417bp "typical" flanking region
Truncated flanking region in the SEQ ID NO:22RED system: the right (Up71) flanking region (144bp) is identical to the 5' 144bp of the 431bp "classical" flanking region
23 wild-type ab4 (GenBank accession AY665713.1) in the genome sequence of the deletion portion of nt 127681-128482
Deletion in the genomic sequence of the 24RacH gene (NO nt numbers available, since the complete genomic sequence is unknown)
25 HA sequence cloned at ORF1/3(UL56) site
Technical scheme
The following technical solutions are described herein:
the invention provides the following technical scheme:
1. a replication-deficient equine alpha herpes virus (EHV) vector comprising an inactivation of UL18 and/or UL 8.
2. The replication deficient EHV vector of claim 1, wherein UL18 is inactivated.
3. The replication deficient EHV vector of claim 1 or 2, wherein UL8 is inactivated.
4. The replication deficient EHV vector according to any one of claims 1 to 3, wherein UL18 and UL8 are inactivated.
5. The replication deficient EHV vector according to any one of claims 1 to 4, wherein the inactivation of UL18 is a complete or partial deletion, a complete or partial truncation, a complete or partial substitution, a complete or partial inversion, an insertion.
6. The replication deficient EHV vector according to any one of claims 1 to 5, wherein the inactivation of UL8 is a complete or partial deletion, a complete or partial truncation, a complete or partial substitution, a complete or partial inversion, an insertion.
7. The replication deficient EHV vector according to any one of claims 1 to 6, wherein the start codon of UL18 (ATG, nucleotides 1 to 3 of SEQ ID NO: 1) is inactivated.
8. The replication deficient EHV vector of claim 7, wherein the inactivation of the initiation codon (ATG) of UL18 is a deletion, substitution, inversion or insertion.
9. The replication deficient EHV vector according to any one of claims 1 to 8, wherein the initiation codon of UL8 (ATG, nucleotides 1 to 3 of SEQ ID NO: 1) is inactivated.
10. The replication deficient EHV vector of claim 9, wherein the inactivation of the initiation codon (ATG) of UL8 is a deletion, substitution, inversion or insertion.
11. The replication deficient EHV vector of any one of claims 1 to 10, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 925 nucleotides, at least 940 nucleotides are deleted, substituted or inverted from the 5' -end of the initiation codon (ATG, nucleotides 1-3 of SEQ ID NO: 1) of UL 18.
12. The replication deficient EHV vector of any one of claims 1 to 11, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 925 nucleotides, at least 940 nucleotides from A, T or G of the initiation codon (ATG, nucleotides 1-3 of SEQ ID NO: 1) of UL18 are deleted, substituted or inverted.
13. The replication deficient EHV vector of any one of claims 1 to 12, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 925 nucleotides, at least 940 nucleotides are deleted, substituted or inverted within the UL 18.
14. The replication deficient EHV vector according to any one of claims 1 to 13, wherein the DNA sequence within UL18 having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the DNA sequence as set forth in SEQ ID No. 1 is deleted, substituted or inverted.
15. The replication deficient EHV vector according to any one of claims 1 to 14, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 800 nucleotides, at least 1000 nucleotides are inserted within the UL 18.
16. A replication deficient EHV vector according to any one of claims 1 to 15, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 1000 nucleotides, at least 1250 nucleotides, at least 1500 nucleotides, at least 1750 nucleotides, at least 2000 nucleotides, at least 2225 nucleotides are deleted, substituted or inverted from the 5' -end of the start codon (ATG, nucleotides 1-3 of SEQ ID NO: 2) of the UL 8.
17. A replication deficient EHV vector according to any one of claims 1 to 16, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 1000 nucleotides, at least 1250 nucleotides, at least 1500 nucleotides, at least 1750 nucleotides, at least 2000 nucleotides, at least 2225 nucleotides are deleted, substituted or inverted from the A, T or G-terminus of the initiation codon (ATG, nucleotides 1-3 of SEQ ID NO: 2) of the UL 8.
18. The replication deficient EHV vector of any one of claims 1 to 17, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 1000 nucleotides, at least 1250 nucleotides, at least 1500 nucleotides, at least 1750 nucleotides, at least 2000 nucleotides, at least 2225 nucleotides are deleted, substituted, or inverted within the UL 8.
19. The replication deficient EHV vector according to any one of claims 1 to 18, wherein the DNA sequence within UL8 having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the DNA sequence as set forth in SEQ ID No. 2 is deleted, substituted or inverted.
20. The replication deficient EHV vector according to any one of claims 1 to 19, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 800 nucleotides, at least 1000 nucleotides are inserted within the UL 8.
21. The replication deficient EHV vector according to any one of claims 1 to 20, wherein the EHV comprises an expression cassette comprising:
(i) at least one foreign nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-coding sequence, wherein the nucleotide sequence of interest, preferably the gene of interest, more preferably the antigen-coding sequence, is optionally operably linked to a promoter sequence, and
(ii) At least one upstream UL18 flanking region selected from the group consisting of: 5 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof; SEQ ID NO 9 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof, and
(iii) at least one downstream UL18 flanking region selected from the group consisting of: 6 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof; SEQ ID NO 10 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof.
22. The replication deficient EHV vector according to any one of claims 1 to 21, wherein the EHV comprises an expression cassette comprising:
(i) at least one foreign nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-coding sequence, wherein the nucleotide sequence of interest, preferably the gene of interest, more preferably the antigen-coding sequence, is optionally operably linked to a promoter sequence, and
(ii) At least one upstream UL8 flanking region selected from the group consisting of: 11 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof, and
(iii) at least one downstream UL8 flanking region selected from the group consisting of: 12 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof.
23. The replication deficient EHV vector of claim 21 or 22, wherein the insertion of the expression cassette inactivates UL18 and/or UL 8.
24. The replication deficient EHV vector of any one of claims 21 to 23, wherein the insertion of the expression cassette into UL18 is characterized by a portion of about 945bp within UL18 of RacH (SEQ ID NO:1) or a deletion of 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology and/or the same sequence.
25. The replication deficient EHV vector according to any one of claims 21 to 24, wherein the insertion of the expression cassette into UL8 is characterized by an approximately 2256bp portion (SEQ ID NO:2) within UL8 of RacH or a deletion of 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology and/or the same sequence thereof.
26. The replication deficient EHV vector according to any one of claims 1 to 25, wherein the EHV vector comprises at least one flanking region selected from the group consisting of: 5, 6, 9, 10 and sequences 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical to any of these sequences.
27. The replication deficient EHV vector according to any one of claims 1 to 26, wherein the EHV vector comprises (i) at least one upstream UL18 flanking region selected from the group consisting of: 5 and 9, and (ii) at least one downstream UL18 flanking region selected from the group consisting of: SEQ ID NO 6 and SEQ ID NO 10.
28. The replication deficient EHV vector according to any one of claims 1 to 27, wherein the EHV vector comprises at least one flanking region selected from the group consisting of: SEQ ID NO 11 and SEQ ID NO 12 and sequences 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical to any of these sequences.
29. The replication deficient EHV vector according to any one of claims 1 to 28, wherein the EHV vector comprises (i) at least one upstream UL8 flanking region selected from the group consisting of: 11 and (ii) at least one downstream UL8 flanking region selected from the group consisting of SEQ ID NOs: 12 in SEQ ID NO.
30. The replication deficient EHV vector according to any one of claims 1 to 29, wherein the EHV vector is a non-native and/or recombinant EHV.
31. A replication deficient EHV vector according to any one of claims 1 to 30, wherein replication deficient means that the replication rate is reduced by at least 90%.
32. A replication deficient EHV vector according to any one of claims 1 to 31, wherein replication deficient means that the replication rate is at least 95% reduced.
33. A replication deficient EHV vector according to any one of claims 1 to 32, wherein replication deficient means that the replication rate is reduced by at least 99%.
34. A replication deficient EHV vector according to any one of claims 1 to 33, wherein replication deficient means that the replication rate is completely eliminated.
35. A replication deficient EHV vector according to any one of claims 1 to 34, wherein the replication rate is measured by TCID50 analysis.
36. The replication deficient EHV vector according to any one of claims 1 to 35, wherein the replication deficient EHV vector is still infectious.
37. A replication deficient EHV vector according to any one of claims 1 to 36, wherein the EHV vector is still infectious and is replicable in infected eukaryotic cell lines but is packaged only as a replication competent virus in complementing cell lines.
38. The replication deficient EHV vector according to any one of claims 1 to 37, wherein the EHV vector comprises at least one nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, inserted into the insertion site, preferably UL56 and/or US 4.
39. The replication deficient EHV vector according to any one of claims 1 to 38, wherein the EHV vector comprises two or more nucleotide sequences of interest, preferably genes of interest, more preferably antigen encoding sequences, inserted into two or more insertion sites.
40. The EHV vector of claim 38 or 39, wherein the insertion in US4 is characterized by a partial deletion, truncation, substitution, modification or the like in US4, wherein US5 retains function.
41. An EHV vector according to any one of claims 38 to 40, wherein the insertion in US4 is characterized by a portion of about 801bp within US4 of RacH (SEQ ID NO:24) or a deletion of 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology and/or the same sequence.
42. The EHV carrier of any one of claims 38 to 41, wherein the EHV carrier comprises at least one flanking region selected from the group consisting of: 17, 18, 19, 20, 21 and 22 and sequences 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical to any of these sequences.
43. The EHV carrier of any one of claims 38 to 42, wherein the EHV carrier comprises (i) at least one left US4 flanking region selected from the group consisting of: 17, 19 and 21, and (ii) at least one right US4 flanking region selected from the group consisting of SEQ ID NOs: 18, 20 and 22.
44. The replication deficient EHV vector according to any one of claims 21 to 43, wherein the nucleotide sequence of interest is recombinant and/or heterologous and/or exogenous.
45. A replication deficient EHV vector according to any one of claims 21 to 44 wherein the antigen coding sequence is for a pathogen that infects a feeding animal (e.g. pig, cow or poultry) or a companion animal (e.g. cat, horse or dog).
46. The replication deficient EHV vector according to any one of claims 21 to 45, wherein the antigen coding sequence is from a pathogen selected from the list consisting of, but not limited to: schmallenberg virus, influenza a virus, porcine respiratory and reproductive syndrome virus, porcine circovirus, classical swine fever virus, african swine fever virus, hepatitis E virus, bovine viral diarrhea virus, rabies virus, feline measles virus, clostridium tetani, mycobacterium tuberculosis, actinobacillus pleuropneumoniae.
47. The replication deficient EHV vector according to any one of claims 21 to 46, further comprising additional regulatory sequences, such as a termination signal or polyadenylation sequence.
48. The replication deficient EHV vector according to any one of claims 21 to 47, wherein the gene of interest is operably linked to a regulatory sequence, preferably a promoter sequence.
49. The replication deficient EHV vector according to any one of claims 21 to 48, wherein the promoter sequence(s) operably linked to the sequence or gene of interest is selected from, but not limited to consisting of: SV 40T, HCMV and MCMV immediate early gene 1, human elongation factor alpha promoter, baculovirus polyhedrin promoter, polymerase II promoter and functional fragment.
50. The replication deficient EHV vector according to any one of claims 21 to 49, wherein the promoter sequence operably linked to at least one gene of interest is MCMV or a functional fragment thereof or a complementary nucleotide sequence thereof.
51. The replication deficient EHV vector according to any one of claims 21 to 50, wherein the promoter sequence operably linked to at least one gene of interest is an endogenous promoter of UL8 or UL 18.
52. The replication deficient EHV vector according to any one of claims 1 to 51, wherein the EHV vector is selected from the group consisting of: EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9.
53. A replication deficient EHV vector according to any one of claims 1 to 52, wherein the EHV vector is EHV-1, preferably RacH.
54. A mammalian host cell, characterized in that it comprises a replication deficient EHV vector according to any one of claims 1 to 53.
55. A cell line expressing UL8 and/or UL18 of EHV or a functional part thereof for use in culturing a replication deficient EHV vector according to any one of claims 1 to 53.
56. A cell line comprising a plasmid comprising an expression cassette comprising UL8 and/or UL18 of EHV or a functional part thereof, wherein the cell line expresses UL8 and/or UL18 or a functional part thereof.
57. The cell line of claim 55 or 56, wherein the cell line is selected from the group consisting of, but not limited to: vero cells, RK-13 (rabbit kidney), ST (pig testis), MDCK (Madin-Darby canine kidney), MDBK (Madin-Darby bovine kidney) and horse skin cells (NBL-6).
58. The cell line of any one of claims 55 to 57, wherein the cell line is an ST cell line.
59. A method of producing a replication-deficient equine alpha herpes virus (EHV) comprising inactivating UL18 and/or UL8 as in any one of claims 1 to 53.
60. A method of producing a replication-defective equine alpha herpes virus (EHV), comprising the steps of:
a) providing a wild-type EHV or an attenuated EHV;
b) inactivating UL18 and/or UL8 of the EHV of step a) and selecting an EHV clone that does not carry a complete or functional portion of UL18 and/or UL 8;
c) providing a complementing cell line expressing UL18 and/or UL8 or a functional part thereof;
d) obtaining the replication deficient equine alpha herpes virus (EHV) by culturing the EHV of step b) with the complementing cell line of step c).
61. An immunogenic composition comprising one or more EHV vectors according to any one of claims 1 to 53.
62. The immunogenic composition of claim 61, wherein the immunogenic composition further comprises a pharmaceutically acceptable carrier.
63. The immunogenic composition of any one of claims 61 or 62, wherein the immunogenic composition is a vaccine.
64. A method of immunizing an individual comprising administering to the individual an immunogenic composition according to any one of claims 61-63.
65. A method of treating or preventing a clinical sign caused by a pathogen in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of an immunogenic composition according to any one of claims 61 to 63.
66. The immunogenic composition of any one of claims 61-63 for use in a method of immunizing an individual comprising administering the immunogenic composition to the individual.
67. The immunogenic composition of any one of claims 61-63 for use in a method of treating or preventing clinical signs caused by a pathogen in an individual in need thereof, the method comprising administering to the individual a therapeutically effective amount of the immunogenic composition.
68. The method or use of any one of claims 64 to 67, wherein the subject is selected from the list consisting of swine, cattle, poultry, cats, horses and dogs.
69. The method or use of any one of claims 64 to 68, wherein the immunogenic composition is administered once.
70. The method of any one of claims 64 to 69, wherein the immunogenic composition is administered in two or more doses.
Examples of the invention
The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, it will be apparent to those of ordinary skill in the art having had the benefit of the present disclosure that many changes can be made to the specific embodiments disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1:
generation of stable cell lines expressing the EHV-1ORF 43(UL18) or ORF54 (UL8) genes
The synthetic, codon optimized ORF43 (ORF 43(co)) gene of SEQ ID NO:3 (based on the nucleotide sequence of the ORF43 gene of the EHV-1RacH strain, SEQ ID NO:1) was digested with XhoI/BamHI and ligated into pCEP vector (Invitrogen, Cat. No. V044-50) digested with the same restriction endonucleases. The resulting plasmid pCEP-ORF43(co) (FIG. 1) was linearized and transfected into pig testis cells (ST). Two weeks after selection with hygromycin, stable cells expressing the ORF43(CO) gene (ST-43-CO cells) were used to rescue replication-defective EHV-1 viruses.
The synthetic, codon optimized ORF54 (ORF 54(co)) gene of SEQ ID NO:4 (based on the nucleotide sequence of the ORF54 gene of the EHV-1RacH strain, SEQ ID NO:2) was digested with XhoI/BamHI and ligated into the pCEP vector (Invitrogen, Cat. No. V044-50) digested with the same restriction endonucleases. The resulting plasmid pCEP-ORF54(co) (FIG. 2) was linearized and transfected into pig testis cells (ST). Two weeks after selection with hygromycin, stable cells expressing the ORF54(CO) gene (ST-54-CO cells) were used to rescue replication-defective EHV-1 viruses.
Example 2:
vector construction and replication-defective EHV virus rescue
EHV-1. delta. ORF43 virus, mCMV promoter-driven RFP replacement ORF43
A synthetic DNA having Multiple Cloning Sites (MCS) flanked by 171 nucleotides upstream (SEQ ID NO:5) and 265 nucleotides downstream (SEQ ID NO:6) of the ORF43 gene was designed. The mCMV (murine CMV promoter) driven red fluorescent protein (RFP/mCherry) (Shaner et al, 2004) was used as a reporter. As a transcription termination signal and mRNA stabilization function, bovine growth hormone polyadenylation sequence (BGHpA, Goodwin & Rottman,1992) was used directly downstream of the 3' end of the reporter gene (RFP) gene. The RFP gene digested with MluI/SalI restriction endonucleases was cloned into MCS to generate plasmid pUC 43-mCMV-RFP. From this plasmid, a DNA fragment with mCMV-RFP-BGH polyadenylation flanked by ORF43 (SEQ ID NO:7) was digested and cloned into EHV-1RacH BAC DNA using the RED recombination system to generate EHV-1-43-mCMV. ORF43 was knocked out by Red recombination and replaced with mCMV-RFP-BGH polya (fig. 3). Following kanamycin selection, EHV-1-43-mCMV RFP BAC DNA was later transfected into ST-43-CO cells to rescue the recombinant virus, rEHV-1-43-mCMV-RFP.
Example 3:
EHV-1. DELTA. ORF43 virus, replacement of ORF43 by endogenous EHV-1 promoter-driven RFP
In another version of the replacement replication-deficient EHV-1 virus, a modified RED recombination protocol was used to replace ORF43 with the ORFP gene in frame (fig. 5). First, a synthetic DNA SceI/kanamycin DNA flanked by 171 nucleotides (SEQ ID NO:5) upstream and 265 nucleotides (SEQ ID NO:6) downstream of the ORF43 gene was designed. This DNA fragment (SEQ ID NO:8) was transformed into E.coli K12 GS1783 harboring EHV-1BAC DNA. Selection with kanamycin yielded an intermediate EHV-1 clone in which ORF43 was replaced with a SceI/kanamycin fragment. Next, an RFP gene flanked by 161 nucleotides upstream (SEQ ID NO 9) and 120 nucleotides downstream (SEQ ID NO:10) of the ORF43 gene was transformed into the above clones to select EHV-1BAC DNA clones in which the ORF43 gene was replaced with RFP in frame (EHV-1-43-RFP) (FIG. 4). EHV-1-43RFP BAC DNA was transfected into ST-43-CO cells to rescue the recombinant virus, rEHV-1-43-RFP. Since we did not include an external promoter, in this case RFP expression was dependent on intrinsic EHV-1 gene expression of the endogenous ORF43 promoter.
Example 4:
EHV-1. delta. ORF 54 virus, mCMV promoter-driven RFP replacement of ORF 54
A synthetic DNA having MCS flanked by 200 nucleotides upstream (SEQ ID NO:11) and 200 nucleotides downstream (SEQ ID NO:12) of the ORF54 gene was designed. The mCMV driven RFP gene digested with MluI/SalI restriction endonucleases was cloned into MCS to generate plasmid pUC 54-mCMV-RFP. From this plasmid, a DNA fragment with mCMV-RFP-BGH polyadenylation flanked by ORF54 (SEQ ID NO:13) was digested with I-CeuI and cloned into EHV-1RacH BAC DNA using the RED recombination system to generate EHV-1-54-mCMV RFP. ORF54 was knocked out by Red recombination and the inserted mCMV-RFP-BGH polyadenylation was in the same region (fig. 6). Following kanamycin selection, EHV-1-54-mCMV RFP BAC DNA was later transfected into ST-54-CO cells to rescue the recombinant virus, rEHV-1-54-mCMV-RFP.
Example 5:
replication-deficient EHV-1 viruses having a transgene in ORF43 or ORF54
Conventional ST cells, ST-43-CO cells and ST-54-CO cells were infected with EHV-1/RacH, rEHV-1-43-mCMV-RFP, rEHV-1-43-RFP and rEHV-1-54-mCMV-RFP viruses of different multiplicity of infection (MOI). The gene expression and plaque formation of the infected cells were observed every 24h by fluorescence microscopy. Monitoring cytopathic effect (CPE) by light microscopy; the virus was harvested at 70% CPE and titrated by TCID 50.
As seen in FIG. 7, EHV-1/RacH virus caused significant CPE in all three cell lines. The specific plaques observed in all cells infected with EHV-1/RacH virus established that the stable cells generated in examples 1 and 2 support EHV-1 replication as well as conventional ST cells.
Conventional ST cells and ST-43-CO cells were infected with rEHV-1-43-RFP virus (FIG. 8). Although both cells were infected with rEHV-1-43-RFP virus (as seen from GFP expression), CPE and virus production were only observed in ST-43-CO cells. Transgene (RFP) expression was observed in all infected cells, but only visible CPE or plaques in ST-43-CO cells.
Next, conventional ST cells and ST-43-CO cells were infected with rEHV-1-43-mCMV-RFP virus (FIG. 9). Although both cells were infected with rEHV-1-43-mCMV-RFP virus (as seen from GFP expression), CPE and virus production were only observed in ST-43-CO cells. Transgene (RFP) expression was observed in all infected cells, but only visible CPE or plaques in ST-43-CO cells.
The above data confirm that EHV-1 viruses lacking the ORF43 gene are able to replicate only in cells expressing the ORF43 protein (as in ST-43-CO cells), but not in conventional cells. The data also demonstrate that ORF43 can be replaced with different transgenes that can be expressed in infected cells via an external promoter (e.g., mCMV) or as part of the EHV-1 gene (without an external promoter; with an endogenous promoter).
Finally, conventional ST cells and ST-54-CO cells were infected with rEHV-1-54-mCMV-RFP virus (FIG. 10). Although both cells were infected with rEHV-1-54-mCMV-RFP virus (as seen from GFP expression), CPE and virus production were only observed in ST-54-CO cells. Transgene (RFP) expression was observed in all infected cells, but only visible CPE or plaques in ST-54-CO cells. This data confirms that EHV-1 viruses lacking the ORF54 gene are able to replicate only in cells expressing the ORF54 protein (as in ST-54-CO cells), but not in conventional cells. The data also demonstrate that ORF54 can be replaced with different transgenes that can be expressed in infected cells via an external promoter (e.g., mCMV).
Titers (in triplicate) of various recombinant viruses produced on different cell lines were compared. The data clearly demonstrate that viruses lacking either ORF43 or ORF54 are unable to replicate in conventional cells (table 1).
TABLE 1
Sample numbering Virus In which cell it is produced Potency (TCID)50/ml)
1 rEHV-1-43-RFP ST 0
2 rEHV-1-43-RFP ST-43-CO 6.49E+06
3 rEHV-1-43-mCMV-RFP ST 0
4 rEHV-1-43-mCMV-RFP ST-43-CO 5.99E+06
5 rEHV-1-54-mCMV-RFP ST 0
6 rEHV-1-54-mCMV-RFP ST-54-CO 1.24E+06
Example 6:
replication-defective EHV-1 viruses with transgenes at other insertion sites
Synthetic DNA flanked to completely knock out ORF43 by two-step red recombination was designed and transformed into GS1783 cells carrying EHV-1/HA BAC DNA (HA sequence, SEQ ID NO: 14). After two steps of red recombination, ORF43 was knocked out (confirmed by Sanger sequencing, data not shown) to generate EHV-1- Δ ORF 43-HA. EHV-1- Δ ORF43-HA BACDNA (with the mCMV-driven HA gene at ORF 1/3 and lacking ORF 43) was transfected into ST-43-CO cells to rescue the recombinant virus rEHV-1- Δ ORF 43-HA.
Synthetic DNA flanked to completely knock out ORF54 by two-step red recombination was designed and transformed into GS1783 cells carrying EHV-1/HA BAC DNA (HA sequence, SEQ ID NO: 14). After two steps of red recombination, ORF54 was knocked out (confirmed by Sanger sequencing, data not shown) to generate EHV-1- Δ ORF 54-HA. EHV-1- Δ ORF54-HA BACDNA (with the mCMV-driven HA gene at ORF 1/3 and lacking ORF 54) was transfected into ST-43-CO cells to rescue the recombinant virus rEHV-1- Δ ORF 54-HA.
CPE/Virus production was only observed in infected ST-43-CO cells when conventional ST and ST-43-CO cells were infected with rEHV-1- Δ ORF43-HA at different MOIs. HA expression in infected cells can be confirmed by IFA (immunofluorescence analysis) using anti-HA antibodies.
CPE/Virus production was only observed in infected ST-54-CO cells when conventional ST and ST-54-CO cells were infected with rEHV-1- Δ ORF54-HA at different MOIs. HA expression in infected cells can be confirmed by IFA (immunofluorescence analysis) using anti-HA antibodies.
Example 7:
testing of replication-deficient EHV-1 vector vaccines expressing HA in vivo at another insertion site in pigs
Synthetic DNA flanked to completely knock out ORF43 by two-step red recombination was designed and transformed into GS1783 cells carrying EHV-1/HA BAC DNA (HA sequence, SEQ ID NO: 25). After two steps of red recombination, ORF43 was knocked out (confirmed by Sanger sequencing, data not shown) to generate EHV-1- Δ ORF 43-HA. EHV-1- Δ ORF43-HA BACDNA (with the mCMV-driven HA gene at ORF 1/3 and lacking ORF 43) was transfected into ST-43-CO cells to rescue the recombinant virus rEHV-1- Δ ORF 43-HA.
CPE/Virus production was only observed in infected ST-43-CO cells when non-supplemented ST and ST-43-CO cells were infected with rEHV-1- Δ ORF 43-HA. HA (SEQ ID NO:25) expression in infected cells can be confirmed by IFA (immunofluorescence analysis) using anti-HA antibody (FIG. 19).
To test the potential of replication deficient EHV-1 viruses as vaccines, 5 pigs at 11 weeks of age were vaccinated twice (day 0 and 14) with rEHV-1-. DELTA.ORF 43-HA virus. Control groups of animals were vaccinated with placebo. Hemagglutination Inhibition (HI) assays were performed from all serum samples to test whether vaccinated pigs carry antibodies against antigens present in replication-defective EHV-1 viruses.
All 5 vaccinated animals had significant HI titers after one vaccination. After the second vaccination, the HI titers of all vaccinated pigs were further increased. On similar test days, none of the control animals had significant HI titers (fig. 20).
Example 8:
use of ORF70(US4) insertion site with p455 promoter in recombinant EHV-1 vector vaccine and construction of recombinant virus
Influenza hemagglutinin subtype H3 (A/pig/Italy/7680/2001 (H3N2), Genbank accession No.: ABS50302.2) was cloned into pU70-p455-71K71 (FIG. 11, SEQ ID NO.15) to generate the transfer plasmid pU70-p455-H3-71K71, placing H3 under the control of the p455 promoter and the novel 71pA polyadenylation signal, and flanking a cassette with a recombinant region for insertion into ORF70 (FIG. 12, SEQ ID NO: 16). The RED recombination system (Tischer et al, 2006Biotechnol. Tech.40,191-197) was used to clone the expression cassette p455-H3-71 at ORF70 of pRacH-SE to generate pRacH-SE70-p455-H3 (FIG. 13).
PK/WRL cells were transfected with pRacH-SE70-p455-H3 to rescue recombinant rEHV-1RacH-SE70-p455-H3 virus. Insertion of the expression cassette was confirmed by sequencing of the high fidelity PCR product of the inserted region. Expression of the transgene in infected cells was analyzed by indirect immunofluorescence analysis (IFA, fig. 14).
Example 9
In vivo testing of a monovalent EHV-1 vector influenza A virus vaccine (H3 vaccine) in pigs
To test the efficacy of rEHV-1RacH-SE-70-p455-H3 as a potential vaccine, the dose of two intramuscular vaccinations of piglets without maternal immunity to porcine IAV (without maternal antibodies) at 2 and 5 weeks of age, respectively, was 1X 107TCID50/mL rEHV-1RacH-SE-70-p455-H3, or vaccination at 5 weeks of age only (single vaccination). The group of non-vaccinated piglets served as negative control and a group of animals vaccinated with a commercial inactivated porcine IAV vaccine at 2 and 5 weeks of age served as positive control (euthanized) according to the manufacturer's instructions (except the time point of vaccination). At 8 weeks of age, all animals except the negative control group received 1X 107Intratracheal administration of TCID50/mL of H3N2 porcine IAV challenge strain (European field virus isolate R452-14, whose H3 is heterologous to the H3 vaccine antigen used in RacH-SE-70-p 455-H3). Unvaccinated and non-challenged animals were used as negative controls, while unvaccinated and challenged animals were used as challenge controls. Body temperature and blood samples were collected at selected time points. One day after challenge, half of the animals in each group were euthanized and lungs were scored for lesions typical of porcine IAV infection, three lung samples were taken from each left and right lung of each animal to determine the titer of infectious porcine IAV in lung homogenate and bronchoalveolar lavage fluid (BALF) was sampled. The same procedure was performed 3 days after challenge on the remaining half of the animals of each group.
When body temperature was studied to rise after application of porcine IAV challenge virus, unvaccinated animals showed an increase in body temperature of about 1 ℃ the day after challenge (fig. 15), unlike piglets vaccinated twice with rhehv-1 RacH-SE-70-p 455-H3.
Lung scores were evaluated in animals euthanized 1 or 3 days post challenge. Typical lung lesions associated with porcine IAV infection were absent in piglets of the negative control group. However, lung foci were observed in the challenge control group (average range 6% to 7%). Finally, mean lung lesion scores were significantly lower (less than 4%) in piglets vaccinated twice with the rEHV1-RacH-SE-70-p455-H3 vaccine (FIG. 16).
Mean porcine IAV lung titers were evaluated in animals euthanized 1 or 3 days post challenge. Although no porcine IAV was present in the lung samples of piglets in the negative control group, the challenge control group showed a viral titer ranging from more than 5 (day 3) to more than 7log (day 1) per gram of lung tissue. In sharp contrast, the group mean was strongly reduced to about 2log or less for the group vaccinated once with rEHV1RacH-SE-70-p455-H3 and to undetectable levels for the group vaccinated twice with rEHV-1RacH-SE-70-p455-H3 (FIG. 17).
When the induction of porcine IAV neutralizing antibodies was tested after vaccination, sera from animals vaccinated once with the rEHV-1RacH-SE-70-p455-H3 vaccine showed a reciprocal neutralization titer of about 160 at 3 weeks after the first vaccination, and sera from animals vaccinated twice with the rEHV-1RacH-SE-70-p455-H3 vaccine showed a reciprocal neutralization titer of about 2560 at 3 weeks after the second vaccination, while sera from the non-vaccinated group had no detectable porcine IAV neutralizing antibody content (FIG. 18).
Taken together, the data from this example demonstrate that the transgene inserted at ORF70 in the context of an EHV-1 vector can be expressed using an external promoter, and that the resulting recombinant EHV-1 vector can be used as a potential vaccine candidate in vivo.
Reference to the literature
The following references are expressly incorporated by reference herein to the extent that they provide exemplary procedures or other details that supplement those set forth herein.
1.Bustin,S.2000.Absolute quantification of mRNA using real-timereverse transcription polymerase chain reaction assays.Journal of MolecularEndocrinology 25(2):169-193。
Goodwin, E.C. and Rottman, F.M.1992.the 3' warping sequence of the bone growth hormone genes polypeptides required for the infection and metabolism, J.biol.chem.267:16330-
Hubert, P.H., Birkenmaier, S., Rziha, H.J., and Osterioder, N.1996, alternations in the E.E.Herpesvirus Type-1(EHV-1) Strain RacH DuringAtement. journal of Veterinary Medicine, Series B,43:1-14.doi: 10.1111/j.1439-0450.1996.tbt.00282. x
Luke, GA and Ryan, MD.2013.the protein coexpression protein in biotechnology and biomedicine, virus 2A and 2A-like sequences protocol resolution, future Virology, Vol.8, No. 10, p.983 and 996.
5.Ma,G.、Azab,W.、Osterrieder,N.2013.Equine herpesviruses type 1(EHV-1)and 4(EHV-4)--masters of co-evolution and a constant threat to equids andbeyond.Vet Microbiol.167(1-2):123-34。
6.Nolan,T.Rebecca E Hands,R.E.,and Bustin S.A.2006.Quantification ofmRNA using real-time RT-PCR Nature Protocols 1:1559-1582
Osterrieder, N., Neubauer, A., Brandmuller, C., Kaaden, O.R. and O' Callaghan, D.J.1996.the equation herepedvirus 1 IR6 protein induced virus growth and yield treated temperature and is a major determiner of virus.virology 226: 243-.
8.Ptashne,M.2014.The Chemistry of Regulation of Genes and OtherThings The Journal of Biological Chemistry Vol.289,(9)5417-5435.Reed,L.J.,andMuench,H.1938.A simple method of estimating fifty percent endpoints.Am.J.Hyg.(27)3；493-497。
Reed LJ and Muench H (1938). A simple method of simulating five percent of points, the American Journal of hygene 27(3)493-497
10.Rosas,C.T.、Konig,P.、Beer,M.、Dubovi,E.J.、Tischer,B.K.、Osterrieder,N.,2007a.Evaluation of the vaccine potential of an equine herpesvirus type1vector expressing bovine viral diarrhea virus structuralproteins.J.Gen.Virol.88(3),748-757。
Rosas, c.t., b.k.tischer, g.a.perkins, b.wagner, l.b.goodman, n.osterrider.2007 b.live-attached recombinant gene expression Virus type 1(EHV-1) indeces a neutral anti-reagent response against last nickel Virus (WNV) Virus Research,125, pages 69-78.
12.Rosas,C.T.、Van de Walle,G.R.、Metzger,S.M.、Loelzer,K.、Dubovi,E.J.、Kim,S.G.、Parrish,C.R.、Osterrieder,N.,2008.Evaluation of a vectored equineherpesvirus type 1(EHV-1)vaccine expressing H3 haemagglutinin in theprotection of dogs against canine influenza.Vaccine 26(19),2335-3234。
13.Said,A.、Elke Lange,E.、Beer,M.Damiani,A.、Osterrieder,N.2013.Recombinant equine herpesvirus 1(EHV-1)vaccine protects pigs againstchallenge with influenza A(H1N1)pmd09 Virus Research 173:371-376
Sambrook J and Russell DW (2001) Molecular Cloning, 3 rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; ISBN 978-
Shaner, n.c., Campbell, r.e., Steinbach, p.a., Giepmans, b.n., Palmer, a.e., Tsien, R, y.2004. improduced monomeric red, orange and yellow fluorescent proteins derived from fluorescent protein sp.red fluorescent protein. 22(12), 1567-72, Epub 2004, 11 months and 21 days.
Tischer, B.K., Kaufer, B.B., Sommer, M., Wussow, F., Arvin, A. and Osterioder, N.A. Self-absorbable information Bacterial organism clone of variant cell-Zoster Virus alloys Analysis of the Essential Tegumentprotein Encoded by ORF9.J.Virol.81(23), 1322007, 13200-.
Tischer, B.K, Smith, g.a. and osterrider, n., in: jeff Braman (eds.), In Vitro Mutagenesis Protocols: Third Edition, Methods In molecular biology, Vol.634, DOI 10.1007/978-1-60761-652-8-30,
Figure BDA0002679943200000611
springer Science + BusinessMedia, LLC 2010, Chapter 30: En Passant Mutagenesis: A Two Step Markerless RedRecombination System.
18.Trapp,S.、von Einem,J.、Hofmann,H.、Kostler,J.、Wild,J.、Wagner,R.、Beer,M.、Osterrieder,N.,2005.Potential of equine herpesvirus 1as a vector forimmunization.J.Virol.79,5445-5454。
19.Wellington,J.E.、Allen,G.P.、Gooley,A.A.、Love,D.N.、Packer,N.H.、Yan,J.X.、Whalley,J.M.1996.The highly O-glycosylated glycoprotein gp2 of equineherpesvirus 1 is encoded by gene 71.J Virol.70(11):8195-8。
Sequence listing
<110> Boringer Invitrogen animal health Co., Ltd
<120> novel EHVs with deactivated UL18 and/or UL8
<130>P01- 3303 Prio
<160>25
<170>PatentIn version 3.5
<210>1
<211>945
<212>DNA
<213> equine herpesvirus 1
<400>1
atggcgagtg ccgcctttga gattgacatc ctactgccca gtgacctatc tcccgctgac 60
ctgtcagctc ttcaaaaatg cgagggtaag cttgtgtttt tgaccgctct gcgtcgtcgc 120
gtgatgctct ccagcgtcac cctctcgtca tactatgtca acggcgcacc cccggacacg 180
ctatccctga tggcggcgtt tcgtaggcgt tttcccgcta taatacagcg cgtgctgccc 240
aacaaaatga tagccgccgc cctgggagtc gcaccgcttc ctcccggggc gttcatacag 300
aacacaggcc cgtttgacct gtgcaacggg gactctgtgt gcgcgctgcc tcccattttg 360
gacgtggagg acaagctgcg cctaggatct gtgggcgagg aaatactatt tccgctgacc 420
gttccactcg cgcaagcgcg cgaactcatc gcgcggctgg tagcgcgcgc ggtgcaggct 480
ctcaccccaa acgcccaggc ccagcgcgga gcggaggtga tgttttacaa cggacgaaag 540
tacaacgtga ccccggatct cagacaccga gacgccgtta acggcgtggc gcggtctctg 600
gtgctaaaca tgatttttgc catgaacgag ggatcgcttg tgctgctctc gctgatacca 660
aacctgctca ccctgggaac ccaggacgga tttgtgaacg ccataatcca gatgggaagc 720
gccacccgtg aggttggcca gctcgtccac cagcagcccg tgccccaacc gcaggacggc 780
gctcgccgct tttgtgtgta cgacgctctg atgtcatgga tcagcgttgc ctcgcgtctt 840
ggtgacgtgg tcggtgggaa acccttggtg cggatctgta cgttcgaggg ccaggctacg 900
atttcccgcg gcgagaaggc ccctgtcatt caaacgcttt tgtaa 945
<210>2
<211>2256
<212>DNA
<213> equine herpesvirus 1
<400>2
atggagggca gcgtcgaatg gtttaacgga catgtttgtg ctaccagtat ttactctcta 60
tggacagatc cgcaccaccc agggcatctt caggcgctcg tctacatgct gtgtcggcgc 120
ggtagcgact acaccgcaga gttttgtcac gttcccgtct cgggcgaact cttgaaacgc 180
ggagctcgcg acgcatctct ggtaacaccg gcgcgcgttg ccagcgccgc gcagaccgcg 240
gctgtgcctg ggtgctggcc cctggctccc ctgggaaacg ccatgttgtg gaaatccgtc 300
tacggtggca taacggcggc gcttaagcgc gccgtgggaa gctttgcttt ctatcaaccc 360
ctggtgttag gaattaacac gcaaactgga cttttagtta ccctccgacc cgccgcgtct 420
gcgggtgaag gcggtggcga ccacgtctct ccgcgggcgg cgatcgtaaa tgtgtcggtg 480
gaggtagact tggacccagc gggcattgaa gcgagcgcgg ctagctccac aggatcgtct 540
ctcgccaggg ccagactctg cacgcttcga gatggatatt ttctctcaaa gcgggacatt 600
gccctagaag ttgagatcgc tacaaaggag gtttcatttt acagaaagta tgactctgtg 660
caacagcctg ccaacaagcg tcgcggcgac atggcagatt tgttcgtcgt gcacgaacga 720
acccttttgc tagggggatg taaacgaatg ggagttaagg ttctattgcc gcgaacgttt 780
gactgtttag ttgccagctc ccagtcagtg tcgggtttag ctgccatggc gctgtacaaa 840
cagtggcacg ctactctatt ctctgtagag ctaccagata ctgttgtgca aatttttgct 900
tacctagggc cagaattaaa cccgtgtgga gaggaagtcg actattgttg ctttgttgga 960
tttcccggac tcccgaccct caaggccagt tcgagcacca cggaggctgt gcgcgatgca 1020
atggccgcct atagactgtc cgacgggctg tggccggctc taggtatgag cgcgtttcac 1080
tttttggctc catgggaccc ggaagacagg tggcccggtg aatcggaggc aaaacgggta 1140
gagggggcgg tacacaggct tcagcttggt accgaggatg attggggggc tgggcgggta 1200
tcatgcattt tagagtcgga cgctgtaatg caggggccgt ggttcgcaaa gtttgacttt 1260
tcggcgtttt tccccacgct gtacctgttg ctgtttcccg ccaatgagcg cttggctgag 1320
gtggttagat tgagggcacg tggccaacac cccaccctta agctcgcctt ggtatccttt 1380
tttggggggc tgcagcacat caaccccgta gcctataggt ccatcatagc cctatccaac 1440
ggaatcagta agcggctgga gcacgaagtc aatcagaggg gttttgccat ctgtacatat 1500
gtcaaagatg gcttttgggg ggcagccgga aatctgccat cagactctgt atcctacgcc 1560
gacgcgctgg tttacgcaga ggagctaaga agcgccgctc agaaggcggc cctcggacac 1620
gtgtccgaga tggggttttc gctgccggag ggtgtccact tgaatttgcg gctggagggt 1680
ttgtttacag acgccatctc gtggtccacc cactgttact ggttgtacaa ccgcctcacc 1740
aagatggaag actttgtagg cttccccgcc aagagcgggg ccggcagagc cgcgaaggcg 1800
agcttgtctg ccttgctacc gctggtagcc gcggtatgcg actctagcga tatgagcacc 1860
ctccatcagt ctgtacgggg ggcctgcgaa cagctggtag ccggcgcttt tgccgagcgc 1920
aacaacccgc agttttggag taccaggacg gggatcgagt cgtctacgct actccccccg 1980
gcagtttaca ggaacggcag cttgctcgac agagactgtg ggcagaggga aattgtgttg 2040
actcgcaaac acgactgtga atccccatcg cccgtaccct ggacgctctt cccaccaccc 2100
ttggttttgg ggcgcattga ctgtatggtc tatcttacgt ccattttcaa aacttatcta 2160
agcatgttaa acagagcaat atctgcctcg tgcgacgcgg atgaatctat gaatgtggac 2220
tttccaatct ctgattatgc atttttattt acctaa 2256
<210>3
<211>945
<212>DNA
<213> equine herpesvirus 1
<400>3
atggcatccg ccgccttcga gatagatata ctgctcccat ccgatctgtc accggctgac 60
cttagcgccc ttcaaaaatg tgaaggaaag ttggtctttc ttaccgcgtt gcgccgcagg 120
gtgatgctta gctccgttac gctgtcatct tattatgtga acggtgctcc tccagacact 180
ctcagtctga tggccgcatt tagacgacgg ttcccagcaa taatacaacg ggtgctcccg 240
aataaaatga tcgctgcggc tttgggcgtt gctccccttc cacctggagc gtttatacaa 300
aacaccggcc cattcgatct gtgcaacggc gactctgtgt gtgcgctccc gcccatactc 360
gacgttgaag acaaactgcg acttggctcc gttggagagg aaattctctt tccccttact 420
gtccccttgg cgcaagcccg agagcttata gcgcgattgg tcgcaagggc agtgcaggcg 480
ctgaccccga atgctcaagc tcagcgcggg gcagaagtga tgttttacaa cggaaggaaa 540
tacaatgtga ctcctgatct taggcaccga gatgcagtta atggggtcgc cagaagtctt 600
gttttgaata tgatcttcgc aatgaatgag gggagcttgg tcttgctcag cctgattcct 660
aatcttctga cacttggtac gcaggatggc tttgtcaatg caataattca aatgggatct 720
gctactaggg aagtcggaca gctcgtgcac cagcagcctg tgccccaacc acaagatggg 780
gcccgccgct tttgcgttta cgacgcactg atgagctgga tatcagtggc ttccagactg 840
ggtgatgtgg ttggtggtaa gccactcgtt cggatctgca ccttcgaggg gcaagctacg 900
atttcccgcg gcgaaaaggc tcctgtcata cagacacttc tctaa 945
<210>4
<211>2256
<212>DNA
<213> equine herpesvirus 1
<400>4
atggaaggtt ccgtggaatg gtttaatgga cacgtctgcg ccactagcat ttactctttg 60
tggaccgatc cacaccaccc tggacacttg caggcgctgg tctacatgct gtgccgccgc 120
ggctccgact atactgctga attttgtcac gtccccgtca gtggtgaact tctgaaacgg 180
ggggcaagag atgccagctt ggttacgcct gcgcgcgttg ccagtgcggc ccaaaccgcc 240
gcagtccccg gatgctggcc tctggcacca ctcggcaacg ccatgctgtg gaagagtgtc 300
tatggaggta ttacagccgc tctcaagcgg gcagtgggct cattcgcatt ttaccaaccg 360
ttggtcctcg gcataaatac ccaaacggga ctccttgtta ctctccggcc ggctgcctca 420
gcgggcgagg gaggcggcga ccacgtttct cctagggctg cgatagtgaa cgtctccgtc 480
gaggtggacc tcgatccagc cgggatcgag gcgtccgcgg cgtcatctac cggaagctca 540
cttgcacgag cacggctttg taccttgcgc gatggctact ttctttccaa acgagatatt 600
gcgttggagg tcgagatcgc aacaaaagag gttagtttct atagaaaata tgattccgtt 660
cagcagccgg ccaataaacg gcgcggcgat atggctgatt tgtttgtggt ccatgagcga 720
acactgctcc tggggggctg taaacgaatg ggtgttaaag ttttgcttcc acggactttt 780
gactgcctcg tggcttctag tcaaagtgtc tcaggtcttg ccgcaatggc gttgtataaa 840
cagtggcacg cgacgctgtt ttcagtggag ttgccagata cagttgtgca aatctttgcg 900
tacttgggtc ctgagcttaa tccttgcgga gaggaagtgg actattgttg ttttgtcggc 960
tttccgggtt tgccgacact gaaggcttct tccagtacca cggaggctgt ccgagatgcc 1020
atggctgcat atcgacttag cgatggtctc tggcccgcac tcggcatgtc agcttttcat 1080
tttctcgccc cgtgggaccc ggaagaccgg tggccgggtg agtcagaggc caagagagtg 1140
gagggggcag ttcaccggct gcaattggga acagaggacg attggggtgc tggacgggtc 1200
tcatgtatat tggagtctga cgctgtcatg cagggaccat ggtttgcaaa attcgatttc 1260
tccgctttct ttccaacgtt gtacctgctt cttttccccg ccaacgaaag gcttgcagaa 1320
gttgttcggt tgcgggcgag gggacagcat ccgaccctga aactggcatt ggtgagcttc 1380
tttggcggct tgcagcatat taacccagtt gcgtacaggt caattattgc tctctccaat 1440
gggataagca agcggttgga gcacgaggtc aaccagagag ggtttgcaat ttgcacatac 1500
gtcaaggacg ggttttgggg agccgctgga aacctgccgt ccgatagcgt tagttatgca 1560
gacgccctcg tttacgctga ggagctgaga agcgcggcgc aaaaggctgc gttgggacac 1620
gtttccgaaa tgggcttctc tctccctgaa ggtgttcatc ttaatctcag gctggaaggg 1680
ttgttcaccg atgctattag ctggagcaca cactgctact ggttgtacaa ccgacttacc 1740
aaaatggaag actttgtggg cttccccgcg aaaagtggag ctgggagggc cgctaaggcc 1800
agcttgtctg cgttgttgcc gctcgtggca gccgtctgcg attcctcaga tatgtctacc 1860
ctccatcaaa gcgtcagagg agcctgcgag cagcttgttg ccggggcctt cgccgaaagg 1920
aacaatccgc aattttggtc cacgcggact ggtattgaat catccaccct gctccctccg 1980
gcggtgtacc ggaatggctc tctcttggac agggattgtg gccaaagaga gatcgtgctg 2040
acaaggaaac atgactgtga gagcccaagc cccgttccgt ggactctgtt tccgcccccg 2100
cttgttctcg gtcggatcga ttgtatggtt tatcttacaa gcattttcaa aacttatctt 2160
agcatgttga atcgagcaat aagcgcatct tgcgacgcgg acgagtctat gaatgtcgac 2220
tttcctatct cagactacgc ttttctcttc acttaa 2256
<210>5
<211>171
<212>DNA
<213> equine herpesvirus 1
<400>5
tctgcttgag cgctagcgct ccgtctcgac ctcccagagt ggttattggt acggttggtg 60
ggtggttttg actgccttta atccctagca gactttaatc gatagaaggg gcataataag 120
gaagtttttt tgggggggcg tcgctcgggt ttggggtgcc tccacgtaga g 171
<210>6
<211>265
<212>DNA
<213> equine herpesvirus 1
<400>6
cctcaccctc cccccaacgc ccattttaac ccccttatgc aaataaactt gacaccatgt 60
tatatattac atgtagtatg agtttttaat gatgtcggca aacaaaacta acacgtatcc 120
tcactgcgcg gggagactgg aaaacgcatc gctggttggc gggaggctgg acaaataaac 180
ggccatcacc agggccacca acatatcgtc cgacgcgccg ttgcgtttac cggtaaacac 240
tctagtttcg gaggttccgg taacc 265
<210>7
<211>3528
<212>DNA
<213> Artificial sequence
<220>
<223> mCMV promoter having RFP gene
<400>7
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60
cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120
ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180
accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240
attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300
tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360
tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acctcgcgaa 420
tgcatctaga tgacccaatt tcgctacctt aggaccgtta tagttaggta acctctgctt 480
gagcgctagc gctccgtctc gacctcccag agtggttatt ggtacggttg gtgggtggtt 540
ttgactgcct ttaatcccta gcagacttta atcgatagaa ggggcataat aaggaagttt 600
ttttgggggg gcgtcgctcg ggtttggggt gcctccacgt agagactagt tactgagtca 660
ttagggactt tccaatgggt tttgcccagt acataaggtc aataggggtg aatcaacagg 720
aaagtcccat tggagccaag tacactgagt caatagggac tttccattgg gttttgccca 780
gtacaaaagg tcaatagggg gtgagtcaat gggtttttcc cattattggc acgtacataa 840
ggtcaatagg ggtgagtcat tgggtttttc cagccaattt aattaaaacg ccatgtactt 900
tcccaccatt gacgtcaatg ggctattgaa actaatgcaa cgtgaccttt aaacggtact 960
ttcccatagc tgattaatgg gaaagtaccg ttctcgagcc aatacacgtc aatgggaagt 1020
gaaagggcag ccaaaacgta acaccgcccc ggttttcccc tggaaattcc atattggcac 1080
gcattctatt ggctgagctg cgttctacgt gggtataaga ggcgcgacca gcgtcggtac 1140
cgtcgcagtc ttcggtctga ccaccgtaga acgcagacgc gtggcccgaa tgcatctaga 1200
tggatccgcc gccaccatgg tgagcaaggg cgaggaggat aacatggcca tcatcaagga 1260
gttcatgcgc ttcaaggtgc acatggaggg ctccgtgaac ggccacgagt tcgagatcga 1320
gggcgagggc gagggccgcc cctacgaggg cacccagacc gccaagctga aggtgaccaa 1380
gggtggcccc ctgcccttcg cctgggacat cctgtcccct cagttcatgt acggctccaa 1440
ggcctacgtg aagcaccccg ccgacatccc cgactacttg aagctgtcct tccccgaggg 1500
cttcaagtgg gagcgcgtga tgaacttcga ggacggcggc gtggtgaccg tgacccagga 1560
ctcctccctg caggacggcg agttcatcta caaggtgaag ctgcgcggca ccaacttccc 1620
ctccgacggc cccgtaatgc agaagaagac catgggctgg gaggcctcct ccgagcggat 1680
gtaccccgag gacggcgccc tgaagggcga gatcaagcag aggctgaagc tgaaggacgg 1740
cggccactac gacgctgagg tcaagaccac ctacaaggcc aagaagcccg tgcagctgcc 1800
cggcgcctac aacgtcaaca tcaagttgga catcacctcc cacaacgagg actacaccat 1860
cgtggaacag tacgaacgcg ccgagggccg ccactccacc ggcggcatgg acgagctgta 1920
caagtaagtc gactatctag atgcattcga aacttaatta aggtaccctg tgccttctag 1980
ttgccagcca tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac 2040
tcccactgtc ctttcctaat aaaatgagga aattgcatcg cattgtctga gtaggtgtca 2100
ttctattctg gggggtgggg tggggcagga cagcaagggg gaggattggg aagacaatag 2160
caggcatgct ggggatgcgg tgggctctat ggatcctagg gataacaggg taatcgattt 2220
attcaacaaa gccacgttgt gtctcaaaat ctctgatgtt acattgcaca agataaaaat 2280
atatcatcat gaacaataaa actgtctgct tacataaaca gtaatacaag gggtgttatg 2340
agccatattc aacgggaaac gtcttgctcg aggccgcgat taaattccaa catggatgct 2400
gatttatatg ggtataaatg ggctcgcgat aatgtcgggc aatcaggtgc gacaatctat 2460
cgattgtatg ggaagcccga tgcgccagag ttgtttctga aacatggcaa aggtagcgtt 2520
gccaatgatg ttacagatga gatggtcaga ctaaactggc tgacggaatt tatgcctctt 2580
ccgaccatca agcattttat ccgtactcct gatgatgcat ggttactcac cactgcgatc 2640
cccgggaaaa cagcattcca ggtattagaa gaatatcctg attcaggtga aaatattgtt 2700
gatgcgctgg cagtgttcct gcgccggttg cattcgattc ctgtttgtaa ttgtcctttt 2760
aacagcgatc gcgtatttcg tctcgctcag gcgcaatcac gaatgaataa cggtttggtt 2820
gatgcgagtg attttgatga cgagcgtaat ggctggcctg ttgaacaagt ctggaaagaa 2880
atgcataagc ttttgccatt ctcaccggat tcagtcgtca ctcatggtga tttctcactt 2940
gataacctta tttttgacga ggggaaatta ataggttgta ttgatgttgg acgagtcgga 3000
atcgcagacc gataccagga tcttgccatc ctatggaact gcctcggtga gttttctcct 3060
tcattacaga aacggctttt tcaaaaatat ggtattgata atcctgatat gaataaattg 3120
cagtttcatt tgatgctcga tgagtttttc taaccatggc tgtgccttct agttgccagc 3180
catctgttgt ttgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc actcccactg 3240
tcctttccta ataaaatgag gaaattgcat cgcattgtct gagtaggtgt cattctattc 3300
tggggggtgg ggtggggcag gacagcaagg gggaggattg ggaagacaat agcaggcatg 3360
ctggggatgc ggtgggctct atggatccga ccctccccaa acgcatgccc tcaccctccc 3420
cccaacgccc attttaaccc ccttatgcaa ataaacttga caccatgtta tatattacat 3480
gtagtatgag tttttaatga tgtcggcaaa caaaactaac acgtatcc 3528
<210>8
<211>1505
<212>DNA
<213> Artificial sequence
<220>
<223> kanamycin genes flanking SEQ ID NO 5 and 6
<400>8
tctgcttgag cgctagcgct ccgtctcgac ctcccagagt ggttattggt acggttggtg 60
ggtggttttg actgccttta atccctagca gactttaatc gatagaaggg gcataataag 120
gaagtttttt tgggggggcg tcgctcgggt ttggggtgcc tccacgtaga gactagggat 180
aacagggtaa tcgatttatt caacaaagcc acgttgtgtc tcaaaatctc tgatgttaca 240
ttgcacaaga taaaaatata tcatcatgaa caataaaact gtctgcttac ataaacagta 300
atacaagggg tgttatgagc catattcaac gggaaacgtc ttgctcgagg ccgcgattaa 360
attccaacat ggatgctgat ttatatgggt ataaatgggc tcgcgataat gtcgggcaat 420
caggtgcgac aatctatcga ttgtatggga agcccgatgc gccagagttg tttctgaaac 480
atggcaaagg tagcgttgcc aatgatgtta cagatgagat ggtcagacta aactggctga 540
cggaatttat gcctcttccg accatcaagc attttatccg tactcctgat gatgcatggt 600
tactcaccac tgcgatcccc gggaaaacag cattccaggt attagaagaa tatcctgatt 660
caggtgaaaa tattgttgat gcgctggcag tgttcctgcg ccggttgcat tcgattcctg 720
tttgtaattg tccttttaac agcgatcgcg tatttcgtct cgctcaggcg caatcacgaa 780
tgaataacgg tttggttgat gcgagtgatt ttgatgacga gcgtaatggc tggcctgttg 840
aacaagtctg gaaagaaatg cataagcttt tgccattctc accggattca gtcgtcactc 900
atggtgattt ctcacttgat aaccttattt ttgacgaggg gaaattaata ggttgtattg 960
atgttggacg agtcggaatc gcagaccgat accaggatct tgccatccta tggaactgcc 1020
tcggtgagtt ttctccttca ttacagaaac ggctttttca aaaatatggt attgataatc 1080
ctgatatgaa taaattgcag tttcatttga tgctcgatga gtttttctaa ccatggctgt 1140
gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct tgaccctgga 1200
aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc attgtctgag 1260
taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg aggattggga 1320
agacaatagc aggcatgctg gggatgcggt gggctctatg gatccgaccc tccccaaacg 1380
catgccctca ccctcccccc aacgcccatt ttaaccccct tatgcaaata aacttgacac 1440
catgttatat attacatgta gtatgagttt ttaatgatgt cggcaaacaa aactaacacg 1500
tatcc 1505
<210>9
<211>161
<212>DNA
<213> equine herpesvirus 1
<400>9
cgctagcgct ccgtctcgac ctcccagagt ggttattggt acggttggtg ggtggttttg 60
actgccttta atccctagca gactttaatc gatagaaggg gcataataag gaagtttttt 120
tgggggggcg tcgctcgggt ttggggtgcc tccacgtaga g 161
<210>10
<211>120
<212>DNA
<213> equine herpesvirus 1
<400>10
cctcaccctc cccccaacgc ccattttaac ccccttatgc aaataaactt gacaccatgt 60
tatatattac atgtagtatg agtttttaat gatgtcggca aacaaaacta acacgtatcc 120
<210>11
<211>200
<212>DNA
<213> equine herpesvirus 1
<400>11
gcaacaggaa gctgtttgcg ggacccagat ataagctgag ggcgccaaag tggagcagaa 60
acctctgttt tctagaattg gacaatactg gcacctgcaa gactccgctt gatgccgcgc 120
tggcagacct agcccctagc gcgtggccac aggtttacgg agcggttgac ttcgacgcac 180
tgtaacatca accaacccac 200
<210>12
<211>200
<212>DNA
<213> equine herpesvirus 1
<400>12
aaataaagac cataaacgtt attttttttc agtttatttt tgttgtttgg ggtacacacg 60
gtatgggcat cataaaaccc ctccatctca ccagctagtc gtataaaaca tatattgatt 120
ccggcacagg cttttcgtcc gtagcggtcc accagctata gagagtatca gccactactt 180
tagtacatag cggcgcattg 200
<210>13
<211>3138
<212>DNA
<213> Artificial sequence
<220>
<223> mCMV promoter-driven RFP gene
<400>13
gcaacaggaa gctgtttgcg ggacccagat ataagctgag ggcgccaaag tggagcagaa 60
acctctgttt tctagaattg gacaatactg gcacctgcaa gactccgctt gatgccgcgc 120
tggcagacct agcccctagc gcgtggccac aggtttacgg agcggttgac ttcgacgcac 180
tgtaacatca accaacccac gctagttact gagtcattag ggactttcca atgggttttg 240
cccagtacat aaggtcaata ggggtgaatc aacaggaaag tcccattgga gccaagtaca 300
ctgagtcaat agggactttc cattgggttt tgcccagtac aaaaggtcaa tagggggtga 360
gtcaatgggt ttttcccatt attggcacgt acataaggtc aataggggtg agtcattggg 420
tttttccagc caatttaatt aaaacgccat gtactttccc accattgacg tcaatgggct 480
attgaaacta atgcaacgtg acctttaaac ggtactttcc catagctgat taatgggaaa 540
gtaccgttct cgagccaata cacgtcaatg ggaagtgaaa gggcagccaa aacgtaacac 600
cgccccggtt ttcccctgga aattccatat tggcacgcat tctattggct gagctgcgtt 660
ctacgtgggt ataagaggcg cgaccagcgt cggtaccgtc gcagtcttcg gtctgaccac 720
cgtagaacgc agacgcgtgg cccgaatgca tctagatgga tccgccgcca ccatggtgag 780
caagggcgag gaggataaca tggccatcat caaggagttc atgcgcttca aggtgcacat 840
ggagggctcc gtgaacggcc acgagttcga gatcgagggc gagggcgagg gccgccccta 900
cgagggcacc cagaccgcca agctgaaggt gaccaagggt ggccccctgc ccttcgcctg 960
ggacatcctg tcccctcagt tcatgtacgg ctccaaggcc tacgtgaagc accccgccga 1020
catccccgac tacttgaagc tgtccttccc cgagggcttc aagtgggagc gcgtgatgaa 1080
cttcgaggac ggcggcgtgg tgaccgtgac ccaggactcc tccctgcagg acggcgagtt 1140
catctacaag gtgaagctgc gcggcaccaa cttcccctcc gacggccccg taatgcagaa 1200
gaagaccatg ggctgggagg cctcctccga gcggatgtac cccgaggacg gcgccctgaa 1260
gggcgagatc aagcagaggc tgaagctgaa ggacggcggc cactacgacg ctgaggtcaa 1320
gaccacctac aaggccaaga agcccgtgca gctgcccggc gcctacaacg tcaacatcaa 1380
gttggacatc acctcccaca acgaggacta caccatcgtg gaacagtacg aacgcgccga 1440
gggccgccac tccaccggcg gcatggacga gctgtacaag taagtcgact atctagatgc 1500
attcgaaact taattaaggt accctgtgcc ttctagttgc cagccatctg ttgtttgccc 1560
ctcccccgtg ccttccttga ccctggaagg tgccactccc actgtccttt cctaataaaa 1620
tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct attctggggg gtggggtggg 1680
gcaggacagc aagggggagg attgggaaga caatagcagg catgctgggg atgcggtggg 1740
ctctatggat cctagggata acagggtaat cgatttattc aacaaagcca cgttgtgtct 1800
caaaatctct gatgttacat tgcacaagat aaaaatatat catcatgaac aataaaactg 1860
tctgcttaca taaacagtaa tacaaggggt gttatgagcc atattcaacg ggaaacgtct 1920
tgctcgaggc cgcgattaaa ttccaacatg gatgctgatt tatatgggta taaatgggct 1980
cgcgataatg tcgggcaatc aggtgcgaca atctatcgat tgtatgggaa gcccgatgcg 2040
ccagagttgt ttctgaaaca tggcaaaggt agcgttgcca atgatgttac agatgagatg 2100
gtcagactaa actggctgac ggaatttatg cctcttccga ccatcaagca ttttatccgt 2160
actcctgatg atgcatggtt actcaccact gcgatccccg ggaaaacagc attccaggta 2220
ttagaagaat atcctgattc aggtgaaaat attgttgatg cgctggcagt gttcctgcgc 2280
cggttgcatt cgattcctgt ttgtaattgt ccttttaaca gcgatcgcgt atttcgtctc 2340
gctcaggcgc aatcacgaat gaataacggt ttggttgatg cgagtgattt tgatgacgag 2400
cgtaatggct ggcctgttga acaagtctgg aaagaaatgc ataagctttt gccattctca 2460
ccggattcag tcgtcactca tggtgatttc tcacttgata accttatttt tgacgagggg 2520
aaattaatag gttgtattga tgttggacga gtcggaatcg cagaccgata ccaggatctt 2580
gccatcctat ggaactgcct cggtgagttt tctccttcat tacagaaacg gctttttcaa 2640
aaatatggta ttgataatcc tgatatgaat aaattgcagt ttcatttgat gctcgatgag 2700
tttttctaac catggctgtg ccttctagtt gccagccatc tgttgtttgc ccctcccccg 2760
tgccttcctt gaccctggaa ggtgccactc ccactgtcct ttcctaataa aatgaggaaa 2820
ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg gggtggggtg gggcaggaca 2880
gcaaggggga ggattgggaa gacaatagca ggcatgctgg ggatgcggtg ggctctataa 2940
ataaagacca taaacgttat tttttttcag tttatttttg ttgtttgggg tacacacggt 3000
atgggcatca taaaacccct ccatctcacc agctagtcgt ataaaacata tattgattcc 3060
ggcacaggct tttcgtccgt agcggtccac cagctataga gagtatcagc cactacttta 3120
gtacatagcg gcgcattg 3138
<210>14
<211>1695
<212>DNA
<213> Swine influenza Virus
<400>14
atgaagacca ccatcatcct gatcctgctg acccactggg cctactccca gaaccccatc 60
agcggcaaca acaccgccac cctgtgcctc ggccaccacg ctgtggccaa tggcaccctg 120
gtcaagacca tctccgacga ccagattgaa gtcacaaatg ctacagaact ggtgcagagc 180
atctccatgg gcaagatttg taataattcc tatcgcatcc tggacggaag gaactgcacc 240
ctgatcgacg ccatgctcgg cgacccccat tgtgacgcct tccagtatga aaattgggac 300
ctgttcatcg agaggagctc cgccttctcc aattgttatc cctacgacat ccccgactac 360
gccagcctca gatccattgt cgcctccagc ggcaccctgg agttcaccgc ggaaggcttc 420
acctggacag gcgtcaccca gaacggccgc tccggagctt gtaaaagagg cagcgccgat 480
tccttcttca gccgcctgaa ctggctcaca aagagcggca gctcttatcc caccctgaac 540
gtgacaatgc ccaacaacaa gaacttcgac aaactctaca tctggggcat ccaccatcct 600
tccagcaatc aggaacagac aaaactctat attcaggaaa gcggcagggt gaccgtgtcc 660
accaagagaa gccaacagac aattattcct aacatcggca gcaggccctg ggtgagaggc 720
cagagcggac ggatttccat ctactggaca attgtcaaac ctggcgacat cctgatgatt 780
aacagcaatg gcaacctggt ggctccaaga ggatacttca agctgaagac aggcaagtcc 840
tccgtgatgc ggtccgacgt gcccatcgac atctgcgtga gcgaatgtat tacacctaat 900
ggcagcatct ccaacgacaa gccctttcag aacgtgaaca aggtcaccta cggcaagtgt 960
cctaaatata ttagacagaa taccctgaag ctcgctacag gcatgaggaa cgtgcccgaa 1020
aaacagatta ggggaatttt tggagctatt gctggcttca tcgaaaatgg atgggaagga 1080
atggtggacg gatggtatgg cttcagatat cagaatagcg aaggaaccgg acaggctgct 1140
gacctgaaga gcacccaagc cgccatcgac cagatcaacg gcaagctgaa ccgcgtgatc 1200
gaacggacaa atgaaaaatt tcatcagatt gaaaaagagt tctccgaagt cgaaggccgc 1260
atccaggacc tggagaaata tgtcgaggac accaagatcg acctgtggtc ctataatgct 1320
gaactcctcg tggccctgga gaatcagcat acaatcgacc tgaccgacgc tgaaatgaac 1380
aagctctttg agaagacccg ccggcagctc agagaaaatg ccgaagatat gggcggaggc 1440
tgcttcaaga tctaccacaa gtgcgacaac gcctgcattg gctccatccg gaatggaacc 1500
tacgaccatt atatctaccg cgacgaggcc ctgaacaacc ggtttcagat caagggagtc 1560
gagctgaagt ccggatataa agattggatt ctgtggattt ccttcgccat ttcctgcttc 1620
ctgatctgcg tggtgctgtt aggcttcatc atgtgggcct gccagaaggg caacatccgc 1680
tgcaacatct gcatc 1695
<210>15
<211>5191
<212>DNA
<213> Artificial sequence
<220>
<223> nucleotide sequence of transfer vector pU70-p455-71K71
<400>15
caataaacgc ggtatgtcta ccttcaagcc tatgatgaac ggatgtttgg tgtttgcggc 60
tattataacg ctcttgagtt ttatgctatc tctgggaaca tgcgaaaatt acaggcgtgt 120
ggttcgggat cctagggata acagggtaat cgatttattc aacaaagcca cgttgtgtct 180
caaaatctct gatgttacat tgcacaagat aaaaatatat catcatgaac aataaaactg 240
tctgcttaca taaacagtaa tacaaggggt gttatgagcc atattcaacg ggaaacgtct 300
tgctcgaggc cgcgattaaa ttccaacatg gatgctgatt tatatgggta taaatgggct 360
cgcgataatg tcgggcaatc aggtgcgaca atctatcgat tgtatgggaa gcccgatgcg 420
ccagagttgt ttctgaaaca tggcaaaggt agcgttgcca atgatgttac agatgagatg 480
gtcagactaa actggctgac ggaatttatg cctcttccga ccatcaagca ttttatccgt 540
actcctgatg atgcatggtt actcaccact gcgatccccg ggaaaacagc attccaggta 600
ttagaagaat atcctgattc aggtgaaaat attgttgatg cgctggcagt gttcctgcgc 660
cggttgcatt cgattcctgt ttgtaattgt ccttttaaca gcgatcgcgt atttcgtctc 720
gctcaggcgc aatcacgaat gaataacggt ttggttgatg cgagtgattt tgatgacgag 780
cgtaatggct ggcctgttga acaagtctgg aaagaaatgc ataagctttt gccattctca 840
ccggattcag tcgtcactca tggtgatttc tcacttgata accttatttt tgacgagggg 900
aaattaatag gttgtattga tgttggacga gtcggaatcg cagaccgata ccaggatctt 960
gccatcctat ggaactgcct cggtgagttt tctccttcat tacagaaacg gctttttcaa 1020
aaatatggta ttgataatcc tgatatgaat aaattgcagt ttcatttgat gctcgatgag 1080
tttttctaaa ataaacgcgg tatgtctacc ttcaagccta tgatgaacgg atgtttggtg 1140
tttgcggcta ttataacgct cttgagtttt atgctatctc tgggaacatg cgaaaattac 1200
aggcgtgtgg ttcgggatcc gaccctgttg gtgggtgcgg ttggactcag aatcttggcg 1260
caggcatgga agtttgtcgg tgacgaaaca tacgacacca tccgcgcaga agcaaagaat 1320
ttagagaccc acgtaccctc aagtgctgca gagtcgtctc tagaaaacca atcgacacag 1380
gaggagtcta acagccccga agttgcccac ctgcgaagcg tcaacagcga tgacagtaca 1440
cacacggggg gtgcgtcgaa cggcatccag gactgtgaca gtcagctcaa aactgtgtat 1500
gcctgcttgg ctctaattgg actcggcaca tgtgccatga tagggttgat agtttacatt 1560
tgtgtattaa ggtcaaaact gtcctctcgg aatttttcgc gcgcgcaaaa tgtaaaacat 1620
agaaattacc agcgacttga gtacgttgct taagcttggc gtaatcatgg tcatagctgt 1680
ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa 1740
agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac 1800
tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg 1860
cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc 1920
gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 1980
ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 2040
ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 2100
atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 2160
aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 2220
gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 2280
ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 2340
ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 2400
acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 2460
gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 2520
ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 2580
ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 2640
gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 2700
ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct 2760
agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt 2820
ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc 2880
gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac 2940
catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat 3000
cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg 3060
cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata 3120
gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta 3180
tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt 3240
gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag 3300
tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa 3360
gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc 3420
gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt 3480
taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc 3540
tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta 3600
ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa 3660
taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca 3720
tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 3780
aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta 3840
ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt ctcgcgcgtt 3900
tcggtgatga cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc 3960
tgtaagcgga tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt 4020
gtcggggctg gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc 4080
ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc cattcgccat 4140
tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc 4200
tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt 4260
cacgacgttg taaaacgacg gccagtgaat tcctccgagt accccagagg agtatgtgaa 4320
aagctgccac tcgcaactac tgaagataat ttcaacgctc aagataaatc cggaggagtt 4380
tcctcgagac cccgggtcga ggctcgtgcg cggatacatc gagtattcta gactcgagcg 4440
caagccctac acgcgctacc cctgctttca acgcgtcaac ctgcacattg acggggagtt 4500
tctggttcac aagatgctag cgttcaatgc cgcgatgcgc ccatcggccg aggagctgct 4560
gtcataccca atgtttgctc aactttagga tgactaacct gtttctggga ggagacagcg 4620
tgggcgacgg tgtataaagt tggtctgctt tcaagccctg ccactgcgct acagtgccac 4680
caactgtaaa gcggtagtaa gctgcagtgg tcgactggtg gtagcatata ctaccttatt 4740
tatacgctccgagctgtttt tcagcatgct agcacccaac gccgagcgag agtatataac 4800
tcccatcatt gcccacaagc ttatgccact tattagcgtc cgctctgccg tttgcttagt 4860
cataatatct accgccgttt acgcagcaga cgctatctgc gacacaattg gatttgcgat 4920
accgcgcatg tggatgtgta ttttaatgag atcaacctcc atgaagcgta actagggggc 4980
ctcccactga ggcactaccg gcttagcagc tgactaacac agtataaaac gtgagaagaa 5040
atcagtctca tgcgccatta gcgctaggct agttagcgtg gaggaccgga gcgctaccgc 5100
cagcagtttc atccgcctgg ttacgggttt gttaacacct accggtgttt taccgctacc 5160
ataggatccg atccatgggc ggccgcggta c 5191
<210>16
<211>6892
<212>DNA
<213> Artificial sequence
<220>
<223> nucleotide sequence of transfer plasmid pU70-p455-H3-71K71
<400>16
caataaacgc ggtatgtcta ccttcaagcc tatgatgaac ggatgtttgg tgtttgcggc 60
tattataacg ctcttgagtt ttatgctatc tctgggaaca tgcgaaaatt acaggcgtgt 120
ggttcgggat cctagggata acagggtaat cgatttattc aacaaagcca cgttgtgtct 180
caaaatctct gatgttacat tgcacaagat aaaaatatat catcatgaac aataaaactg 240
tctgcttaca taaacagtaa tacaaggggt gttatgagcc atattcaacg ggaaacgtct 300
tgctcgaggc cgcgattaaa ttccaacatg gatgctgatt tatatgggta taaatgggct 360
cgcgataatg tcgggcaatc aggtgcgaca atctatcgat tgtatgggaa gcccgatgcg 420
ccagagttgt ttctgaaaca tggcaaaggt agcgttgcca atgatgttac agatgagatg 480
gtcagactaa actggctgac ggaatttatg cctcttccga ccatcaagca ttttatccgt 540
actcctgatg atgcatggtt actcaccact gcgatccccg ggaaaacagc attccaggta 600
ttagaagaat atcctgattc aggtgaaaat attgttgatg cgctggcagt gttcctgcgc 660
cggttgcatt cgattcctgt ttgtaattgt ccttttaaca gcgatcgcgt atttcgtctc 720
gctcaggcgc aatcacgaat gaataacggt ttggttgatg cgagtgattt tgatgacgag 780
cgtaatggct ggcctgttga acaagtctgg aaagaaatgc ataagctttt gccattctca 840
ccggattcag tcgtcactca tggtgatttc tcacttgata accttatttt tgacgagggg 900
aaattaatag gttgtattga tgttggacga gtcggaatcg cagaccgata ccaggatctt 960
gccatcctat ggaactgcct cggtgagttt tctccttcat tacagaaacg gctttttcaa 1020
aaatatggta ttgataatcc tgatatgaat aaattgcagt ttcatttgat gctcgatgag 1080
tttttctaaa ataaacgcgg tatgtctacc ttcaagccta tgatgaacgg atgtttggtg 1140
tttgcggcta ttataacgct cttgagtttt atgctatctc tgggaacatg cgaaaattac 1200
aggcgtgtgg ttcgggatcc gaccctgttg gtgggtgcgg ttggactcag aatcttggcg 1260
caggcatgga agtttgtcgg tgacgaaaca tacgacacca tccgcgcaga agcaaagaat 1320
ttagagaccc acgtaccctc aagtgctgca gagtcgtctc tagaaaacca atcgacacag 1380
gaggagtcta acagccccga agttgcccac ctgcgaagcg tcaacagcga tgacagtaca 1440
cacacggggg gtgcgtcgaa cggcatccag gactgtgaca gtcagctcaa aactgtgtat 1500
gcctgcttgg ctctaattgg actcggcaca tgtgccatga tagggttgat agtttacatt 1560
tgtgtattaa ggtcaaaact gtcctctcgg aatttttcgc gcgcgcaaaa tgtaaaacat 1620
agaaattacc agcgacttga gtacgttgct taagcttggc gtaatcatgg tcatagctgt 1680
ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa 1740
agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac 1800
tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg 1860
cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc 1920
gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 1980
ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 2040
ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 2100
atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 2160
aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 2220
gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 2280
ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 2340
ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 2400
acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 2460
gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 2520
ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 2580
ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 2640
gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 2700
ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct 2760
agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt 2820
ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc 2880
gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac 2940
catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat 3000
cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg 3060
cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata 3120
gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta 3180
tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt 3240
gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag 3300
tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa 3360
gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc 3420
gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt 3480
taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc 3540
tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta 3600
ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa 3660
taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca 3720
tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 3780
aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta 3840
ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt ctcgcgcgtt 3900
tcggtgatga cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc 3960
tgtaagcgga tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt 4020
gtcggggctg gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc 4080
ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc cattcgccat 4140
tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc 4200
tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt 4260
cacgacgttg taaaacgacg gccagtgaat tcctccgagt accccagagg agtatgtgaa 4320
aagctgccac tcgcaactac tgaagataat ttcaacgctc aagataaatc cggaggagtt 4380
tcctcgagac cccgggtcga ggctcgtgcg cggatacatc gagtattcta gactcgagcg 4440
caagccctac acgcgctacc cctgctttca acgcgtcaac ctgcacattg acggggagtt 4500
tctggttcac aagatgctag cgttcaatgc cgcgatgcgc ccatcggccg aggagctgct 4560
gtcataccca atgtttgctc aactttagga tgactaacct gtttctggga ggagacagcg 4620
tgggcgacgg tgtataaagt tggtctgctt tcaagccctg ccactgcgct acagtgccac 4680
caactgtaaa gcggtagtaa gctgcagtgg tcgactggtg gtagcatata ctaccttatt 4740
tatacgctccgagctgtttt tcagcatgct agcacccaac gccgagcgag agtatataac 4800
tcccatcatt gcccacaagc ttatgccact tattagcgtc cgctctgccg tttgcttagt 4860
cataatatct accgccgttt acgcagcaga cgctatctgc gacacaattg gatttgcgat 4920
accgcgcatg tggatgtgta ttttaatgag atcaacctcc atgaagcgta actagggggc 4980
ctcccactga ggcactaccg gcttagcagc tgactaacac agtataaaac gtgagaagaa 5040
atcagtctca tgcgccatta gcgctaggct agttagcgtg gaggaccgga gcgctaccgc 5100
cagcagtttc atccgcctgg ttacgggttt gttaacacct accggtgttt taccgctacc 5160
ataggatccg atccatgggc ggccgcatga agaccgtgat cgccctgagt tacatcttct 5220
gcctggtgtt tgggcaggac ctccctggta aaggcaacaa cacggccacg ctgtgccttg 5280
ggcaccacgc cgtgccgaac ggcacccttg tgaaaactat taccgacgat cagatcgagg 5340
tgaccaacgc caccgaactg gttcagaatt ttagcatggg caaaatttgc aataacccgc 5400
accgcattct ggacggggcc aactgcacgc tgatcgattc attgctgggt gatccccact 5460
gcgatggctt tcaaaacgaa aagtgggact tgttcatcga acgcagcaag gcattcagca 5520
actgctaccc atacgacgtg cccgaataca ccagcctgcg aagcctgatc gcgagctctg 5580
ggaccctgga gttcaccaat gagaacttca attggaccgg agtgacccaa aacggtggct 5640
ccagcgcctg taaaagggga cccaataaca gcttctttag caagttgaat tggctttaca 5700
agagcggcaa tacttacccg atgttgaatg tgaccatgcc caacagtgac gactttgata 5760
aactgtacat atggggcgtg caccatccca gcacggaccg cgaacagata aacctgtacg 5820
tgcaggccag cgggaagata atcgtgagca ccaagcgcag ccagcagacc atcattccca 5880
acattggcag ccgaccgtgg gtgcgcggtc tgagctcccg catcagcata tactggacca 5940
ttgtcaagcc gggagacatc ctgatcatca actctaatgg caatcttatc gccccacgcg 6000
gctacttcaa gatgcagacc ggcaaaagca gtgtgatgag gagcgacgcc cccatcgaca 6060
cctgcaatag cgaatgcatc acccccaatg gcagcatccc caacgacaag cctttccaga 6120
acgtgaataa gatcacctac ggcgcgtgcc ccaagtacat caagcagaac accctgaagc 6180
tggccaccgg catgcgcaac atccccgagc gacagacacg gggcattttt ggcgcaatcg 6240
cagggttcat tgagaatggc tgggagggaa tggttaacgg ctggtacggc ttccgccatc 6300
agaactctga aggaatcggc caagctgcgg atctgaagtc cacgcaagca gccatcaacc 6360
agatcaacgg caagcttaac cgcgtgattg aaaagacgaa cgagaaattc caccaaatag 6420
agaaagaatt cagcgaggtg gagggccgca tccaagacct cgagcgctac gtggaggaca 6480
ccaagatcga cctgtggagc tacaatgccg agctcctggt cgccttggaa aaccaacaca 6540
ccattgacct gaccgacagc gagatgaata aactcttcga gaagacccgg aagcaactcc 6600
gagagaacgc cgaagacatg ggtaatgggt gttttaagat ctaccacaag tgcgacaata 6660
gctgcatgga gagcatccga aacggaacct acgaccacaa cgagtaccgc gatgaggcag 6720
ttaataaccg cttccaaatc aaaagcgtgg aactgaagag tggctataag gactggatac 6780
tgtggatcag ctttgccata agctgcttcc tgctgtgcgc cgtttggttg ggtttcatca 6840
tgtgggcctg tcaaaagggc aatattcgct gtaacatctg catttgaggt ac 6892
<210>17
<211>417
<212>DNA
<213> equine herpesvirus 1
<400>17
ctccgagtac cccagaggag tatgtgaaaa gctgccactc gcaactactg aagataattt 60
caacgctcaa gataaatccg gaggagtttc ctcgagaccc cgggtcgagg ctcgtgcgcg 120
gatacatcga gtattctaga ctcgagcgca agccctacac gcgctacccc tgctttcaac 180
gcgtcaacct gcacattgac ggggagtttc tggttcacaa gatgctagcg ttcaatgccg 240
cgatgcgccc atcggccgag gagctgctgt catacccaat gtttgctcaa ctttaggatg 300
actaacctgt ttctgggagg agacagcgtg ggcgacggtg tataaagttg gtctgctttc 360
aagccctgcc actgcgctac agtgccacca actgtaaagc ggtagtaagc tgcagtg 417
<210>18
<211>431
<212>DNA
<213> equine herpesvirus 1
<400>18
gaccctgttg gtgggtgcgg ttggactcag aatcttggcg caggcatgga agtttgtcgg 60
tgacgaaaca tacgacacca tccgcgcaga agcaaagaat ttagagaccc acgtaccctc 120
aagtgctgca gagtcgtctc tagaaaacca atcgacacag gaggagtcta acagccccga 180
agttgcccac ctgcgaagcg tcaacagcga tgacagtaca cacacggggg gtgcgtcgaa 240
cggcatccag gactgtgaca gtcagctcaa aactgtgtat gcctgcttgg ctctaattgg 300
actcggcaca tgtgccatga tagggttgat agtttacatt tgtgtattaa ggtcaaaact 360
gtcctctcgg aatttttcgc gcgcgcaaaa tgtaaaacat agaaattacc agcgacttga 420
gtacgttgct t 431
<210>19
<211>417
<212>DNA
<213> equine herpesvirus 1
<400>19
ctccgagtac cccagaggag tatgtgaaaa gctgccactc gcaactactg aagataattt 60
caacgctcaa gataaatccg gaggagtttc ctcgagaccc cgggtcgagg ctcgtgcgcg 120
gatacatcga gtattctaga ctcgagcgca agccctacac gcgctacccc tgctttcaac 180
gcgtcaacct gcacattgac ggggagtttc tggttcacaa gatgctagcg ttcaatgccg 240
cgatgcgccc atcggccgag gagctgctgt catacccaat gtttgcacaa ctttaggatg 300
actaacctgt ttctgggagg agacagcgtg ggcgacggtg tataaagttg gtctgctttc 360
aagccctgcc actgcgctac agtgccacca actgtaaagc ggtagtaagc tgcagtg 417
<210>20
<211>431
<212>DNA
<213> equine herpesvirus 1
<400>20
gaccctgttg gtgggtgcgg ttggactcag aatcttggcg caggcatgga agtttgtcgg 60
tgacgaaaca tacgacacca tccgcgcaga agcaaagaat ttagagaccc acgtaccctc 120
aagtgctgca gagtcgtctc tagaaaacca atcgacacag gaggagtcta acagccccga 180
agttgcccac ctgcgaagcg tcaacagcga tgacagtaca cacacggggg gtgcgtcgaa 240
cggcatccag gactgtgaca gtcagctcaa aactgtgtat gcctgcttgg ctctaattgg 300
actcggcaca tgtgccatga tagggttgat agtttacatt tgtgtattaa ggtcaaaact 360
gtcctctcgg aatttttcgc gcgcgcaaaa tgtaaaacat agaaattacc agcgacttga 420
gtacgttgct t 431
<210>21
<211>283
<212>DNA
<213> equine herpesvirus 1
<400>21
tctagactcg agcgcaagcc ctacacgcgc tacccctgct ttcaacgcgt caacctgcac 60
attgacgggg agtttctggt tcacaagatg ctagcgttca atgccgcgat gcgcccatcg 120
gccgaggagc tgctgtcata cccaatgttt gctcaacttt aggatgacta acctgtttct 180
gggaggagac agcgtgggcg acggtgtata aagttggtct gctttcaagc cctgccactg 240
cgctacagtg ccaccaactg taaagcggta gtaagctgca gtg 283
<210>22
<211>144
<212>DNA
<213> equine herpesvirus 1
<400>22
gaccctgttg gtgggtgcgg ttggactcag aatcttggcg caggcatgga agtttgtcgg 60
tgacgaaaca tacgacacca tccgcgcaga agcaaagaat ttagagaccc acgtaccctc 120
aagtgctgca gagtcgtctc taga 144
<210>23
<211>801
<212>DNA
<213> equine herpesvirus 1
<400>23
atgttgactg tcttagcagc cctgagtctg ctcagcttgc ttacgagcgc aaccggacgg 60
ctcgccccag atgaactctg ttatgccgaa ccccgcagaa ctggcagccc accaaacacc 120
cagcccgaac gcccacccgt aatatttgag cccccaacaa ttgcgattaa agctgaatcc 180
aagggttgtg agctaatttt attagatcca cccatagatg taagctatcg cagagaagat 240
aaggtgaatg cgtccattgc ttggtttttt gactttggcg cttgccggat gcccatcgca 300
tacagagagt attacggttg tattggcaat gctgttccct ccccagagac ttgtgatgcg 360
tactcattta cccttattag gaccgagggt atcgtggagt ttaccatcgt aaacatgagc 420
ctcctgtttc agcctggaat atacgatagt ggcaatttta tctacagcgt tctcctggac 480
taccacatat ttacaggacg tgtaacgttg gaagtggaaa aggacacaaa ctatccctgt 540
ggcatgattc atggactcac tgcttacgga aacatcaacg tagatgaaac catggacaac 600
gccagcccac acccgcgtgc cgtggggtgc tttcccgagc ccatcgacaa cgaagcgtgg 660
gcaaacgtta catttactga attggggata ccagacccaa actcatttct cgatgacgag 720
ggtgattacc cgaatatatc agactgtcac tcgtgggagt catacaccta cccaaatacg 780
ctgaggcagg ccacaggacc c 801
<210>24
<211>801
<212>DNA
<213> equine herpesvirus 1
<400>24
atgttgactg tcttagcagc tctgagtctg ctcagcttgc ttacgagcgc aaccggacgg 60
ctcgccccag atgaactctg ttatgccgaa ccccgcagaa ctggcagccc accaaacacc 120
cagcccgaac gcccacccgt aatatttgag cccccaacaa ttgcgattaa agctgaatcc 180
aagggttgtg agctaatttt attagatcca cccatagatg taagctatcg cagagaagat 240
aaggtgaatg cgtccattgc ttggtttttt gactttggcg cttgccggat gcccatcgca 300
tacagagagt attacggttg tattggcaat gctgttccct ccccagagac ttgtgatgcg 360
tactcattta cccttattag gaccgagggt atcgtggagt ttaccatcgt aaacatgagc 420
ctcctgtttc agcctggaat atacgatagt ggcaatttta tctacagcgt tctcctggac 480
taccacatat ttacaggacg tgtaacgttg gaagtggaaa aggacacaaa ctatccctgt 540
ggcatgattc atggactcac tgcttacgga aacatcaacg tagatgaaac catggacaac 600
gccagcccac acccgcgtgc cgtggggtgc tttcccgagc ccatcgacaa cgaagcgtgg 660
gcaaacgtta catttactga attggggata ccagacccaa actcatttct cgatgacgag 720
ggtgattacc cgaatatatc agactgtcac tcgtgggagt catacaccta cccaaatacg 780
ctgaggcagg ccacaggacc c 801
<210>25
<211>1698
<212>DNA
<213> Swine influenza Virus
<400>25
atgaagacca ccatcatcct gatcctgctg acccactggg cctactccca gaaccccatc 60
agcggcaaca acaccgccac cctgtgcctc ggccaccacg ctgtggccaa tggcaccctg 120
gtcaagacca tctccgacga ccagattgaa gtcacaaatg ctacagaact ggtgcagagc 180
atctccatgg gcaagatttg taataattcc tatcgcatcc tggacggaag gaactgcacc 240
ctgatcgacg ccatgctcgg cgacccccat tgtgacgcct tccagtatga aaattgggac 300
ctgttcatcg agaggagctc cgccttctcc aattgttatc cctacgacat ccccgactac 360
gccagcctca gatccattgt cgcctccagc ggcaccctgg agttcaccgc ggaaggcttc 420
acctggacag gcgtcaccca gaacggccgc tccggagctt gtaaaagagg cagcgccgat 480
tccttcttca gccgcctgaa ctggctcaca aagagcggca gctcttatcc caccctgaac 540
gtgacaatgc ccaacaacaa gaacttcgac aaactctaca tctggggcat ccaccatcct 600
tccagcaatc aggaacagac aaaactctat attcaggaaa gcggcagggt gaccgtgtcc 660
accaagagaa gccaacagac aattattcct aacatcggca gcaggccctg ggtgagaggc 720
cagagcggac ggatttccat ctactggaca attgtcaaac ctggcgacat cctgatgatt 780
aacagcaatg gcaacctggt ggctccaaga ggatacttca agctgaagac aggcaagtcc 840
tccgtgatgc ggtccgacgt gcccatcgac atctgcgtga gcgaatgtat tacacctaat 900
ggcagcatct ccaacgacaa gccctttcag aacgtgaaca aggtcaccta cggcaagtgt 960
cctaaatata ttagacagaa taccctgaag ctcgctacag gcatgaggaa cgtgcccgaa 1020
aaacagatta ggggaatttt tggagctatt gctggcttca tcgaaaatgg atgggaagga 1080
atggtggacg gatggtatgg cttcagatat cagaatagcg aaggaaccgg acaggctgct 1140
gacctgaaga gcacccaagc cgccatcgac cagatcaacg gcaagctgaa ccgcgtgatc 1200
gaacggacaa atgaaaaatt tcatcagatt gaaaaagagt tctccgaagt cgaaggccgc 1260
atccaggacc tggagaaata tgtcgaggac accaagatcg acctgtggtc ctataatgct 1320
gaactcctcg tggccctgga gaatcagcat acaatcgacc tgaccgacgc tgaaatgaac 1380
aagctctttg agaagacccg ccggcagctc agagaaaatg ccgaagatat gggcggaggc 1440
tgcttcaaga tctaccacaa gtgcgacaac gcctgcattg gctccatccg gaatggaacc 1500
tacgaccatt atatctaccg cgacgaggcc ctgaacaacc ggtttcagat caagggagtc 1560
gagctgaagt ccggatataa agattggatt ctgtggattt ccttcgccat ttcctgcttc 1620
ctgatctgcg tggtgctgtt aggcttcatc atgtgggcct gccagaaggg caacatccgc 1680
tgcaacatct gcatctaa 1698

Claims (21)

1. A replication-deficient equine alpha herpes virus (EHV) vector comprising an inactivation of UL18 and/or UL 8.
2. The replication deficient EHV vector of claim 1, wherein said inactivation of UL18 and/or UL8 is a complete or partial deletion, a complete or partial truncation, a complete or partial substitution, a complete or partial inversion, an insertion.
3. The replication deficient EHV vector of claim 1 or 2, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 925 nucleotides, at least 940 nucleotides are deleted, substituted or inverted within said UL 18.
4. The replication defective EHV vector of any one of claims 1 to 3, wherein at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 25 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 1000 nucleotides, at least 1250 nucleotides, at least 1500 nucleotides, at least 1750 nucleotides, at least 2000 nucleotides, at least 2225 nucleotides are deleted, substituted or inverted within the UL 8.
5. The replication deficient EHV vector of any one of claims 1 to 4, wherein a DNA sequence within UL18 having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the DNA sequence set forth in SEQ ID NO 1 is deleted, substituted or inverted.
6. The replication deficient EHV vector of any one of claims 1 to 5, wherein a DNA sequence within UL8 having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the DNA sequence set forth in SEQ ID NO 2 is deleted, substituted or inverted.
7. The replication deficient EHV vector of any one of claims 1 to 6, wherein the EHV vector comprises an expression cassette comprising:
(i) at least one foreign nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-coding sequence, wherein said nucleotide sequence of interest, preferably gene of interest, more preferably antigen-coding sequence, is optionally operably linked to a promoter sequence, and
(ii) at least one upstream UL18 flanking region selected from: 5 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof; 9 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof,
(iii) at least one downstream UL18 flanking region selected from: 6 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof; 10 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof.
8. The replication deficient EHV vector according to any one of claims 1 to 7, wherein said EHV vector comprises an expression cassette comprising:
(i) at least one foreign nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen-coding sequence, wherein said nucleotide sequence of interest, preferably gene of interest, more preferably antigen-coding sequence, is optionally operably linked to a promoter sequence, and
(ii) at least one upstream UL8 flanking region selected from: 11 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof, and
(iii) at least one downstream UL8 flanking region selected from: 12 and 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequences thereof.
9. The replication deficient EHV vector of claim 7, wherein the insertion of the expression cassette into UL18 is characterized by a portion of about 945bp within UL18 of RacH (SEQ ID NO:1) or a deletion of 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology and/or the same sequence.
10. The replication deficient EHV vector of claim 8, wherein the insertion of the expression cassette into UL8 is characterized by a portion of about 2256bp within UL8 of RacH (SEQ ID NO:2) or a deletion of 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology and/or identical sequence thereof.
11. The replication deficient EHV vector of any one of claims 1 to 10, wherein said EHV vector comprises: (i) at least one upstream UL18 flanking region selected from SEQ ID NO:5 and SEQ ID NO:9, and (ii) at least one downstream UL18 flanking region selected from SEQ ID NO:6 and SEQ ID NO: 10.
12. The replication deficient EHV vector of any one of claims 1 to 11, wherein said EHV vector comprises: (i) at least one upstream UL8 flanking region selected from SEQ ID NO:11, and (ii) at least one downstream UL8 flanking region selected from SEQ ID NO: 12.
13. The replication deficient EHV vector according to any one of claims 1 to 12, wherein said replication deficiency is a reduction in replication rate of at least 90%.
14. The replication-deficient EHV vector of any one of claims 1-13, wherein said replication-deficient EHV vector is still infectious.
15. The replication deficient EHV vector according to any one of claims 1 to 14, wherein said EHV vector comprises at least one nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, inserted into an insertion site, preferably UL56 and/or US 4.
16. A replication deficient EHV vector according to any one of claims 7 to 15 wherein said antigen coding sequence is involved in a pathogen infecting a food producing animal, such as pigs, cattle or poultry, or a companion animal, such as cats, horses or dogs, preferably said antigen coding sequence is from a pathogen selected from the group consisting of, but not limited to: schmallenberg virus, influenza a virus, porcine respiratory and reproductive syndrome virus, porcine circovirus, classical swine fever virus, african swine fever virus, hepatitis E virus, bovine viral diarrhea virus, rabies virus, feline measles virus, Clostridium tetani (Clostridium tetani), Mycobacterium tuberculosis (Mycobacterium tuberculosis), actinobacillus pleuropneumoniae (actinobacillus pleuropneumoniae).
17. The replication deficient EHV vector according to any one of claims 1 to 16, wherein said EHV vector is selected from the group consisting of: EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9.
18. A cell line expressing UL8 and/or UL18 of EHV or a functional part thereof for use in culturing the replication deficient EHV vector of any one of claims 1 to 17.
19. A cell line comprising a plasmid comprising an expression cassette comprising UL8 and/or UL18 of EHV or a functional part thereof, wherein the cell line expresses UL8 and/or UL18 or a functional part thereof.
20. An immunogenic composition comprising one or more EHV vectors of any one of claims 1 to 17.
21. A method of immunizing an individual comprising administering to the individual the immunogenic composition of claim 20.
CN201980019028.0A 2018-03-19 2019-03-19 Novel EHVs with deactivated UL18 and/or UL8 Pending CN111867625A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP18162630.0 2018-03-19
EP18162630 2018-03-19
PCT/EP2019/056804 WO2019179998A1 (en) 2018-03-19 2019-03-19 New ehv with inactivated ul18 and/or ul8

Publications (1)

Publication Number Publication Date
CN111867625A true CN111867625A (en) 2020-10-30

Family

ID=61691807

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201980019028.0A Pending CN111867625A (en) 2018-03-19 2019-03-19 Novel EHVs with deactivated UL18 and/or UL8

Country Status (16)

Country Link
US (1) US11384365B2 (en)
EP (1) EP3768307A1 (en)
JP (2) JP7273840B2 (en)
KR (1) KR20200132958A (en)
CN (1) CN111867625A (en)
AR (1) AR115002A1 (en)
AU (1) AU2019239562A1 (en)
BR (1) BR112020019268A2 (en)
CA (1) CA3091954A1 (en)
CL (1) CL2020002195A1 (en)
EA (1) EA202092164A1 (en)
MX (1) MX2020009724A (en)
PH (1) PH12020551442A1 (en)
TW (1) TW202003026A (en)
UY (1) UY38148A (en)
WO (1) WO2019179998A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019179345A1 (en) * 2018-03-19 2019-09-26 Boehringer Ingelheim (China) Investment Co., Ltd. Recombinant virus capable of stably expressing target proteins
EP4076510A4 (en) * 2019-12-16 2024-01-10 Oregon Health & Science University Multi-specific t cell receptors

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998027216A1 (en) * 1996-12-14 1998-06-25 The University Of Leeds Ehv-1 vectors
WO1999036562A1 (en) * 1998-01-14 1999-07-22 Human Gene Therapy Research Institute Nucleotide expression systems with reduced immunogenicity for use in gene therapy
US20040109873A1 (en) * 2002-07-19 2004-06-10 Boehringer Ingelheim Vetmedica Gmbh gM-negative EHV-mutants without heterologous elements
US20100291142A1 (en) * 2007-10-18 2010-11-18 Roger Maes Bacterial Artificial Chromosome Containing Feline Herpes Virus Type 1 Genome and Uses Thereof
CN102238961A (en) * 2008-10-03 2011-11-09 诺华公司 Bovine herpes virus -1 compositions, vaccines and methods
US20130195918A1 (en) * 2011-08-08 2013-08-01 Dennis J. O'Callaghan Equine Herpesvirus 1 Vaccine and Vector and Uses Thereof
CN105535959A (en) * 2015-12-30 2016-05-04 暨南大学 Preparation method of type I UL18 gene deleted attenuated live vaccine of herpes simplex virus

Family Cites Families (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US382425A (en) 1888-05-08 Brandt
US2909462A (en) 1955-12-08 1959-10-20 Bristol Myers Co Acrylic acid polymer laxative compositions
US4394448A (en) 1978-02-24 1983-07-19 Szoka Jr Francis C Method of inserting DNA into living cells
US4769331A (en) 1981-09-16 1988-09-06 University Patents, Inc. Recombinant methods and materials
US4722848A (en) 1982-12-08 1988-02-02 Health Research, Incorporated Method for immunizing animals with synthetically modified vaccinia virus
US5833975A (en) 1989-03-08 1998-11-10 Virogenetics Corporation Canarypox virus expressing cytokine and/or tumor-associated antigen DNA sequence
US4769330A (en) 1981-12-24 1988-09-06 Health Research, Incorporated Modified vaccinia virus and methods for making and using the same
US5338683A (en) 1981-12-24 1994-08-16 Health Research Incorporated Vaccinia virus containing DNA sequences encoding herpesvirus glycoproteins
US5364773A (en) 1991-03-07 1994-11-15 Virogenetics Corporation Genetically engineered vaccine strain
US5174993A (en) 1981-12-24 1992-12-29 Health Research Inc. Recombinant avipox virus and immunological use thereof
US4603112A (en) 1981-12-24 1986-07-29 Health Research, Incorporated Modified vaccinia virus
US5505941A (en) 1981-12-24 1996-04-09 Health Research, Inc. Recombinant avipox virus and method to induce an immune response
CA1247080A (en) 1983-03-08 1988-12-20 Commonwealth Serum Laboratories Commission Antigenically active amino acid sequences
US4745051A (en) 1983-05-27 1988-05-17 The Texas A&M University System Method for producing a recombinant baculovirus expression vector
EP0173552B1 (en) 1984-08-24 1991-10-09 The Upjohn Company Recombinant dna compounds and the expression of polypeptides such as tpa
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
IE872748L (en) 1986-10-16 1988-04-16 Arjomari Europ Polypeptides derived from the evvelope gene of human¹immunodeficiency virus in recombinant baculovirus infected¹insect cells
GB8717430D0 (en) 1987-07-23 1987-08-26 Celltech Ltd Recombinant dna product
WO1990001543A1 (en) 1988-07-29 1990-02-22 Intracel Corporation Method for the genetic expression of heterologous proteins by cells transfected in vivo
CA2003300A1 (en) 1988-11-21 1990-05-21 Franklin Volvovitz Skin test and test kit for aids
US5703055A (en) 1989-03-21 1997-12-30 Wisconsin Alumni Research Foundation Generation of antibodies through lipid mediated DNA delivery
ES2200016T3 (en) 1989-03-21 2004-03-01 Vical Incorporated EXPRESSION OF EXECUTIVE POLINUCLEOTIDIC SEQUENCES IN A VERTEBRATE.
US5552143A (en) 1989-03-24 1996-09-03 The Wistar Institute Of Anatomy & Biology Recombinant cytomegalovirus vaccine
US5591439A (en) 1989-03-24 1997-01-07 The Wistar Institute Of Anatomy And Biology Recombinant cytomegalovirus vaccine
GB9001766D0 (en) 1990-01-25 1990-03-28 Univ Court Of The University O Vaccines
KR100242671B1 (en) 1991-03-07 2000-03-02 고돈 에릭 Genetically engineered vaccine strain
US5997878A (en) 1991-03-07 1999-12-07 Connaught Laboratories Recombinant poxvirus-cytomegalovirus, compositions and uses
US5643578A (en) 1992-03-23 1997-07-01 University Of Massachusetts Medical Center Immunization by inoculation of DNA transcription unit
US5801029A (en) 1993-02-16 1998-09-01 Onyx Pharmaceuticals, Inc. Cytopathic viruses for therapy and prophylaxis of neoplasia
IL108915A0 (en) 1993-03-18 1994-06-24 Merck & Co Inc Polynucleotide vaccine against influenza virus
FR2711670B1 (en) 1993-10-22 1996-01-12 Pasteur Institut Nucleotide vector, composition containing it and vaccine for immunization against hepatitis.
DE69536091D1 (en) 1994-01-27 2010-09-09 Univ Massachusetts Medical Immunization by vaccination of DNA transcription unit
JP3911010B2 (en) 1994-04-29 2007-05-09 イムノ・アクテイエンゲゼルシヤフト Recombinant poxvirus having a foreign polynucleotide in the essential region
EP0871755A1 (en) 1995-03-23 1998-10-21 Cantab Pharmaceuticals Research Limited Vectors for gene delivery
DE69740033D1 (en) 1996-07-03 2010-12-09 Merial Inc RECOMBINANT DOG ADENOVIRUS 2 (CAV2), WHICH CONTAINS EXOGENOUS DNA
US6183752B1 (en) 1997-02-05 2001-02-06 Pasteur Merieux Serums Et Vaccins Restenosis/atherosclerosis diagnosis, prophylaxis and therapy
EP1394258A1 (en) 2002-08-30 2004-03-03 Geneart GmbH Non-human herpesviruses as vectors
MX2011000535A (en) 2008-07-23 2011-02-22 Boehringer Ingelheim Pharma Novel regulatory elements.
CN105641692A (en) 2015-12-30 2016-06-08 暨南大学 Herpes simplex virus I gene recombinant attenuated live vaccine and preparation method thereof

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998027216A1 (en) * 1996-12-14 1998-06-25 The University Of Leeds Ehv-1 vectors
WO1999036562A1 (en) * 1998-01-14 1999-07-22 Human Gene Therapy Research Institute Nucleotide expression systems with reduced immunogenicity for use in gene therapy
US20040109873A1 (en) * 2002-07-19 2004-06-10 Boehringer Ingelheim Vetmedica Gmbh gM-negative EHV-mutants without heterologous elements
US20100291142A1 (en) * 2007-10-18 2010-11-18 Roger Maes Bacterial Artificial Chromosome Containing Feline Herpes Virus Type 1 Genome and Uses Thereof
CN102238961A (en) * 2008-10-03 2011-11-09 诺华公司 Bovine herpes virus -1 compositions, vaccines and methods
US20130195918A1 (en) * 2011-08-08 2013-08-01 Dennis J. O'Callaghan Equine Herpesvirus 1 Vaccine and Vector and Uses Thereof
CN105535959A (en) * 2015-12-30 2016-05-04 暨南大学 Preparation method of type I UL18 gene deleted attenuated live vaccine of herpes simplex virus

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ISABELLA MUYLAERT 等: "Identification of Conserved Amino Acids in the Herpes Simplex Virus Type 1 UL8 Protein Required for DNA Synthesis and UL52 Primase Interaction in the Virus Replisome", 《J BIOL CHEM.》, vol. 287, no. 40, pages 33142, XP055504203, DOI: 10.1074/jbc.M112.356782 *

Also Published As

Publication number Publication date
EA202092164A1 (en) 2021-02-10
KR20200132958A (en) 2020-11-25
US11384365B2 (en) 2022-07-12
JP7273840B2 (en) 2023-05-15
AU2019239562A1 (en) 2020-08-13
CA3091954A1 (en) 2019-09-26
MX2020009724A (en) 2020-10-08
PH12020551442A1 (en) 2021-08-23
TW202003026A (en) 2020-01-16
US20190284577A1 (en) 2019-09-19
AR115002A1 (en) 2020-11-18
JP2021516061A (en) 2021-07-01
UY38148A (en) 2019-10-01
WO2019179998A1 (en) 2019-09-26
BR112020019268A2 (en) 2021-01-05
EP3768307A1 (en) 2021-01-27
CL2020002195A1 (en) 2021-01-22
JP2023012474A (en) 2023-01-25

Similar Documents

Publication Publication Date Title
KR102566066B1 (en) Novel Swine Influenza Vaccine
US20040029279A1 (en) Packaging of positive-strand rna virus replicon particles
KR102618843B1 (en) Novel EHV insertion site ORF70
CN109475619A (en) The gene therapy of neuronal waxy lipofuscinosis
KR102543774B1 (en) new promoter
CN113355296A (en) Recombinant oncolytic newcastle disease virus expressing human CCL19 and application thereof
CN111867625A (en) Novel EHVs with deactivated UL18 and/or UL8
CN101343636A (en) Carrier of reverse gene system for construction of influenza virus and application thereof
CN111867637B (en) Novel EHV insertion site UL43
CN111826397A (en) Method for producing recombinant target protein, overexpression vector and virus suspension
CN109750005A (en) A kind of porcine pseudorabies recombinant virus and its construction method
CN109628416A (en) A kind of expression porcine circovirus 2 type ORF2 genetic recombination porcine pseudorabies virus strain and its construction method
CN101745107A (en) Recombinant replication-defective adenoviral vector H5N1 subtype influenza genetic engineering vaccine
US20240042009A1 (en) Yeast-based expression of therapeutic proteins in vivo
CN101717787A (en) Carrier and application thereof of hepatic tissue specific expression rtTA
KR20220114504A (en) Newcastle disease virus vaccine with improved heat resistance
CN109735551A (en) A kind of porcine reproductive and respiratory syndrome virus recombinant plasmid and its construction method
CN113293179A (en) Plasmid for targeted knockout of HBx protein and construction method and application thereof
EA046085B1 (en) NEW EHV INSERT SITE UL-43
MXPA99012094A (en) Infectious cdna clone of north american porcine reproductive and respiratory syndrome (prrs) virus and uses thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination