CN111850126B - Application of oncolytic virus in treatment of uveal melanoma, marker of treatment effect and detection reagent thereof - Google Patents

Abstract

The invention discloses a preparation for treating, preventing and/or slowing uveal melanoma, which comprises oncolytic type 1 herpes simplex virus capable of expressing cytosine deaminase gene and 5-fluorocytosine, and the combined use of the oncolytic type 1 herpes simplex virus and the 5-fluorocytosine can obviously reduce the volume of the uveal melanoma and improve the survival period of a subject. The invention also discloses a marker for evaluating the treatment effect of the uveal melanoma through the preparation, wherein the marker is selected from markers capable of representing the epithelial-mesenchymal transition degree and mainly comprises IL-6, DPD, TWIST1, ZEB1, CD44 and CDH1.

Description

Application of oncolytic virus in treatment of uveal melanoma, marker of treatment effect and detection reagent thereof

Technical Field

The invention belongs to the field of medicines, relates to a marker for evaluating the treatment effect of uveal melanoma and a detection preparation thereof, and particularly relates to a marker for evaluating the treatment effect of oncolytic herpes simplex virus containing cytosine deaminase gene combined with 5-FC on the treatment of uveal melanoma, a detection preparation thereof and a corresponding kit containing the marker or the detection preparation.

Background

Oncolytic virus is an emerging and important tumor treatment method, and can selectively kill and destroy tumor cells. A variety of oncolytic RNA and DNA viruses that selectively replicate and cause direct lysis of tumor cells have been widely reported^[1,2]. Most clinical studies have focused on adenoviruses, poxviruses, herpes simplex virus type 1 (oHSV-1), measles and reoviruses.

Uveal Melanoma (UM) is the most common primary intraocular malignancy among adults^[3]. It can be used for 5-year survival rate of patients ranging from 25% to 66% by removing eyeball, radioactive application therapy and other treatments^[4,5]. Because limited therapy is available to treat such chemoresistant tumors, metastasis occurs within 15 years and causes about 90% of patients to die^[6]. However, no difference in mortality was observed between conservative and surgical treatments. Oncolytic adenoviral therapy for the treatment of UM has been reported in several studies^[7]. Oncolytic adenoviruses, as a vector for DNA genomic sequences, are often combined with immunologically active genes to induce cell killing due to their insufficient anti-tumor efficacy. Therefore, there is an urgent need for a new therapeutic strategy to improve the survival rate of UM patients.

Reference documents:

[1]H.L.Kaufman,F.J.Kohlhapp,A.Zloza,Oncolytic viruses:a new class of immunotherapy drugs,Nat Rev Drug Discov,14(2015)642-662.

[2]J.Bell,G.McFadden,Viruses for tumor therapy,Cell Host Microbe,15(2014)260-265.

[3]M.J.Jager,C.L.Shields,C.M.Cebulla,M.H.Abdel-Rahman,H.E.Grossniklaus,M.H.Stern,R.D.Carvajal,R.N.Belfort,R.Jia,J.A.Shields,B.E.Damato,Uveal melanoma,Nat Rev Dis Primers,6(2020)24.

[4]A.D.Singh,M.E.Turell,A.K.Topham,Uveal melanoma:trends in incidence,treatment,and survival,Ophthalmology,118(2011)1881-1885.

[5]J.M.Seddon,E.S.Gragoudas,K.M.Egan,R.J.Glynn,S.Howard,R.G.Fante,D.M.Albert,Relative survival rates after alternative therapies for uveal melanoma,Ophthalmology,97(1990)769-777.

[6]D.B.Johnson,A.B.Daniels,Continued Poor Survival in Metastatic Uveal Melanoma:Implications for Molecular Prognostication,Surveillance Imaging,Adjuvant Therapy,and Clinical Trials,JAMA Ophthalmol,136(2018)986-988.

[7]M.Garcia,R.Moreno,M.Gil-Martin,M.Cascallo,M.O.de Olza,C.Cuadra,J.M.Piulats,V.Navarro,M.Domenech,R.Alemany,R.Salazar,A Phase 1Trial of Oncolytic Adenovirus ICOVIR-5Administered Intravenously to Cutaneous and Uveal Melanoma Patients,Hum Gene Ther,30(2019)352-364.

disclosure of Invention

In order to overcome the disadvantages of the prior art, the first aspect of the present invention provides a marker for evaluating the effect of uveal melanoma treatment by administering oncolytic herpes simplex virus to the tumor cells or tumor tissue of said uveal melanoma individual, to uveal melanoma tissue in vitro, or to uveal melanoma cells in vitro, said marker being selected from markers capable of characterizing the degree of epithelial-to-mesenchymal transition.

In some embodiments, the oncolytic herpes simplex virus is an oncolytic herpes simplex virus type 1.

In some embodiments, the in vitro uveal melanoma cell is selected from the group consisting of a MUM2B cell line, a 92.1 cell line, and an MP41 cell line.

In some embodiments, the uveal melanoma individual is a xenograft tumor animal, or a human or animal having uveal melanoma.

In some embodiments, the xenograft tumor animal is a xenograft tumor animal formed in a mouse transplanted with human uveal melanoma cells.

In some embodiments, in the treatment, a tumor chemotherapeutic prodrug, 5-fluorocytosine, is administered to the tumor cells or tumor tissue of the uveal melanoma individual, to the uveal melanoma tissue in vitro, or to the uveal melanoma cells in vitro.

In some embodiments, the oncolytic herpes simplex virus contains a gene encoding cytosine deaminase that is capable of converting the tumor chemotherapeutic prodrug 5-fluorocytosine to a tumor chemotherapeutic.

In some embodiments, the oncolytic herpes simplex virus is gamma₁34.5 (i.e., ICP 34.5) deletion, ICP47 deletion, and the presence of glycoprotein US11, and a gene insertion encoding cytosine deaminaseγ₁A recombinant oncolytic type 1 herpes simplex virus at position 34.5.

In some embodiments, the gene encoding cytosine deaminase is an escherichia coli cytosine deaminase gene.

In some embodiments, the cytosine deaminase gene encodes an amino acid sequence as set forth in SEQ ID No.14.

In some embodiments, the nucleic acid sequence of the cytosine deaminase gene is as set forth in SEQ ID No.13.

In some embodiments, the marker is a marker of the IL-6 signaling pathway, a marker of the STAT3 signaling pathway, and/or a marker of the TGF beta signaling pathway.

In some embodiments, the marker is selected from the group consisting of: 1-10 of DPD, TWIST1, ZEB1, CD44, CDH1, IL-6, TS, p-STAT3, CDH2 and vimentin.

The method for evaluating the effect of the treatment of uveal melanoma using the marker of the present invention comprises: before the oncolytic herpes simplex virus or the virus is used with 5-fluorocytosine for treatment, the concentration of any one or more of IL-6, DPD, TWIST1, ZEB1, CD44, TS, p-STAT3, vimentin CDH1 and TS in the plasma of a treated object or pathological tissues of a primary tumor is detected, the concentration or the expression quantity of one or more of the substances in the plasma or pathological tissues of the primary tumor is detected again after treatment, and if the concentration or the expression quantity of any 1-7 of IL-6, DPD, TWIST1, ZEB1, CD44, TS, p-STAT3 and vimentin is remarkably reduced and/or the concentration or the expression quantity of CDH1 and/or TS is remarkably increased, the curative effect of the oncolytic herpes simplex virus or the virus used with 5-fluorocytosine is proved to be remarkable.

In a second aspect, the present invention provides a reagent for detecting the marker of the first aspect, wherein the reagent is a reagent for detecting the expression level of mRNA of the marker and/or a reagent for detecting the expression level of protein of the marker.

In some embodiments, the reagent for detecting the mRNA expression level of the marker comprises a reagent for detecting the expression level of the marker by using a quantitative PCR method, a reagent for detecting the expression level of the marker by using a gene chip method, or a reagent for detecting the expression level of the marker by using a high throughput sequencing method.

In some embodiments, the reagent for detecting the expression level of the marker using a quantitative PCR method comprises a quantitative PCR primer pair for detecting the marker.

In some embodiments, the quantitative PCR primer pair for detecting the marker is selected from any one of a quantitative PCR primer pair for detecting DPD, a quantitative PCR primer pair for detecting TWIST1, a quantitative PCR primer pair for detecting ZEB1, a quantitative PCR primer pair for detecting CD44, a quantitative PCR primer pair for detecting CDH1, a quantitative PCR primer pair for detecting IL-6, a quantitative PCR primer pair for detecting TS, a quantitative PCR primer pair for detecting p-STAT3, a quantitative PCR primer pair for detecting CDH2, and a quantitative PCR primer pair for detecting vimentin 1-10.

In some embodiments, the specific sequence of the quantitative PCR primer pair for detecting DPD is shown as SEQ ID NO.1 and SEQ ID NO. 2;

the specific sequence of the quantitative PCR primer pair for detecting TWIST1 is shown as SEQ ID NO.3 and SEQ ID NO. 4;

the specific sequence of the quantitative PCR primer pair for detecting ZEB1 is shown as SEQ ID NO.5 and SEQ ID NO. 6;

the specific sequences of the quantitative PCR primer pair for detecting CD44 are shown as SEQ ID NO.7 and SEQ ID NO. 8; and/or

The specific sequences of the quantitative PCR primer pair for detecting CDH1 are shown as SEQ ID NO.9 and SEQ ID NO. 10.

In some embodiments, the reagent for detecting the mRNA expression level of the marker further comprises a reagent for detecting the expression level of an internal reference gene using a quantitative PCR method.

In some embodiments, the reference gene is selected from GAPDH, β -Actin, or a combination thereof.

In some embodiments, the reagent for detecting the expression level of the reference gene comprises a quantitative PCR primer pair for detecting the reference gene.

In some embodiments, the specific sequences of the quantitative PCR primer pair for detecting the reference gene are shown as SEQ ID NO.11 and SEQ ID NO. 12.

In some embodiments, the reagent for detecting the protein expression level of the marker comprises a reagent for detecting the expression level of the marker by using a western blot method, a reagent for detecting the expression level of the marker by using an ELISA method, or a reagent for detecting the expression level of the marker by using a mass spectrometry method.

In some embodiments, the reagent for detecting the expression amount of the marker using a western blot method or the reagent for detecting the expression amount of the marker using an ELISA method is selected from any 1 to 10 of an antibody for detecting DPD, an antibody for detecting TWIST1, an antibody for detecting ZEB1, an antibody for detecting CD44, an antibody for detecting CDH1, an antibody for detecting IL-6, an antibody for detecting TS, an antibody for detecting p-STAT3, an antibody for detecting CDH2, and an antibody for detecting vimentin.

In some embodiments, the reagent for detecting the expression level of the marker by using a western blotting method or the reagent for detecting the expression level of the marker by using an ELISA method is selected from any 1 to 10 monoclonal antibodies for detecting DPD, TWIST1, ZEB1, CD44, CDH1, IL-6, TS, p-STAT3, CDH2 and vimentin.

In some embodiments, the reagent for detecting the protein expression level of the marker further comprises a reagent for detecting the expression level of an internal reference gene using a western blot method or using an ELISA method.

In some embodiments, the reference gene is selected from GAPDH, β -Actin, or a combination thereof.

In some embodiments, the reagent for detecting the expression level of the reference gene is an antibody for detecting the reference gene.

In some embodiments, the reagent for detecting the expression level of the reference gene is a monoclonal antibody for detecting the reference gene.

In a third aspect, the invention provides a kit comprising a reagent according to the second aspect of the invention.

The fourth aspect of the invention provides a preparation for treating, preventing and/or alleviating uveal melanoma, which comprises recombinant oncolytic herpes simplex virus and tumor chemotherapy drug precursor, wherein the recombinant oncolytic virus comprises prodrug conversion gene with expression activity, and the expression product of the prodrug conversion gene is used for converting the tumor chemotherapy drug precursor into tumor chemotherapy drug.

In some embodiments, the prodrug-converting gene is a cytosine deaminase gene and the tumor chemotherapeutic prodrug is 5-fluorocytosine.

In some embodiments, the cytosine deaminase gene is an escherichia coli cytosine deaminase gene.

In some embodiments, the amino acid sequence of the protein encoded by the cytosine deaminase gene is SEQ ID No.14.

In some embodiments, the nucleic acid sequence of the gene encoding the cytosine deaminase is SEQ ID No.13.

In some embodiments, the recombinant oncolytic herpes simplex virus is gamma₁34.5 deletion, ICP47 deletion and Presence of glycoprotein US11, and insertion of the Gene encoding cytosine deaminase Gamma₁A recombinant oncolytic herpes simplex 1 virus at position 34.5. .

The fifth aspect of the invention provides the application of the oncolytic herpes simplex virus in the preparation of the medicines for treating 1-7 tumors with abnormally high expression of IL-6, DPD, TWIST1, ZEB1, CD44, TS, p-STAT3 and vimentin and/or abnormally low expression of CDH1 and/or TS.

Before determining the treatment means, the concentration or expression level of one or more substances of IL-6, DPD, TWIST1, ZEB1, CD44, TS, p-STAT3, vimentin, CDH1 and TS in the plasma of a tumor patient is detected, and if the concentration or expression level of IL-6, DPD, TWIST1, ZEB1, CD44, TS, p-STAT3 and vimentin is obviously higher than the normal level of a healthy person or the concentration or expression level of CDH1 and TS is obviously lower than the normal level of the healthy person, the tumor disease can be determined to be suitable for being treated by the oncolytic herpes simplex virus.

In the use of the fifth aspect of the present invention, as a preferred embodiment, the tumor comprises uveal melanoma.

In the use of the fifth aspect of the invention, as a preferred embodiment, the oncolytic herpes simplex virus is gamma₁34.5 deletion, ICP47 deletion and Presence of 11 glycoprotein US11, and insertion of the Gene encoding cytosine deaminase Gamma₁A recombinant oncolytic herpes simplex 1 virus at position 34.5.

The sixth aspect of the invention provides the application of oncolytic herpes simplex virus combined tumor chemotherapy prodrug 5-fluorocytosine in the preparation of tumor drugs for treating abnormal high expression of any 1-7 of IL-6, DPD, TWIST1, ZEB1, CD44, p-STAT3 and vimentin and/or abnormal low expression of CDH1 and/or TS.

In some embodiments, the tumor comprises uveal melanoma; the oncolytic herpes simplex virus is gamma₁34.5 deletion, ICP47 deletion and Presence of glycoprotein US11, and insertion of the Gene encoding cytosine deaminase Gamma₁A recombinant oncolytic herpes simplex 1 virus at position 34.5.

Uveal Melanoma (UM) is the most common primary intraocular malignancy in adults, and this tumor possesses a high rate of distant metastasis. The methods of UM treatment include enucleation, radiation application therapy, local excision, etc., and studies have shown that existing therapies have less effect in improving patient survival. Therefore, the invention constructs a novel oncolytic herpes simplex virus type 1 (oHSV-1) which contains a suicide gene (CD) for coding Cytosine Deaminase. The invention detects the curative effect of oHSV-1 for coding the Escherichia coli CD. In vitro experiments suggest that binding of oHSV-1-CD to the prodrug 5-Fluorocytosine (5-FC) enhances the therapeutic efficacy of oncolytic viruses. In vivo experiments suggest that the life cycle of an OHSV-1-CD/5-FC treatment UM nude mouse xenograft animal model can be remarkably prolonged. The present invention demonstrates the therapeutic efficacy of reconstituted viruses and discusses the underlying molecular mechanisms of this therapeutic approach. The invention provides a reasonable basis for further exploring the use of the oncolytic virus in UM clinical treatment.

The present invention constructs an oHSV-1, recombinant oncolytic herpes simplex virus type 1 (oHSV-1-CD), containing a gene encoding the escherichia coli cytosine deaminase CD, which is capable of converting prodrug 5-fluorocytosine (5-FC) into cytotoxic 5-fluorouracil (5-FU) in virally infected cells, which virus selectively replicates and kills cancer cells. In vitro and in vivo experiments prove the killing efficacy of the oHSV-1-CD/5-FC on UM cells. In the present invention, oHSV-1 has the ability to down-regulate IL-6 and inhibit epithelial-to-mesenchymal transition (EMT) phenotype. Meanwhile, experiments prove that the rate-limiting enzyme dihydropyrimidine dehydrogenase (DPD, DPYD) is also regulated down. Thus, the efficacy of oHSV-1-CD/5-FC is synergistically enhanced. By using in vitro and in vivo experiments of cell killing experiments and western blot determination, transmission electron microscope imaging, qPCR, ELISA, immunofluorescence staining and IVIS imaging, the invention provides experimental evidence for the mechanism of action of the novel oncolytic virus combined suicide gene in UM, verifies the curative effect and provides a new idea for UM treatment.

Uveal Melanoma (UM) is the most common intraocular primary malignancy in adults. The tumor has a high rate of distant metastasis, resulting in a high mortality rate for the patient, while the prognosis of the current therapy is poor. Therefore, there is an urgent need to develop new treatment regimens for UM patients. The invention constructs a novel oncolytic type 1 herpes simplex virus (oHSV-1), which comprises a gene (Cytosine Deaminase, CD) for coding escherichia coli Cytosine Deaminase, researches the action mechanism of the virus and evaluates the treatment effect of the virus in an UM nude mouse xenograft animal model.

The oHSV-1 vector can effectively kill human UM cells, down-regulate IL-6 expression in cells, and inhibit Epithelial-Mesenchymal Transition (EMT) phenotype. At the same time, virus-infected UM cells can down-regulate Dihydropyrimidine Dehydrogenase (DPD), the rate-limiting enzyme. The introduction of the CD gene into the viral backbone does not change the oncolytic properties of the virus, thereby enhancing the therapeutic effect of oHSV-1-CD/5-FC in vitro and in vivo. Oncolytic virus treatment of nude mice orthotopic tumor implantation models can reduce tumor volume and improve mouse survival.

oHSV-1-CD/5-FC is effective in treating UM, inducing a persistent anti-tumor response, and CD expression converts 5-FC into 5-FU. Down-regulation of DPD decreases 5-FU metabolism and enhances the cell killing effect of the virus, while oncolytic viruses down-regulate IL-6 to reverse the EMT phenotype.

Drawings

FIG. 1 is a schematic diagram of the construction of oHSV-1-CD.

FIG. 2 shows the results of a human uveal melanoma cell line sensitivity test to oncolytic HSV-1 vector.

Figure 3 shows photographs of oncolytic HSV-1 vectors resulting in the down-regulation of DPD and inhibition of EMT phenotype.

FIG. 4 shows the therapeutic effect of oncolytic virus oHSV-1-CD/5-FC on the UM cell line.

FIG. 5 shows that oHSV-CD/5-FC inhibits EMT by downregulating IL-6 and downregulates DPD in vitro.

FIG. 6 shows that oHSV-CD/5-FC induces anti-tumor efficacy in a BALB/c nude mouse xenograft model.

Figure 7 shows that oncolytic viruses down-regulate IL-6 signaling and inhibit DPD expression in vivo.

FIG. 8 shows that 5-FU shows less sensitivity to human uveal melanoma cell lines.

Figure 9 shows that IL-6 and DPD are well expressed in tumor specimens of patients with uveal melanoma (n = 9).

Figure 10 shows that DPD expression in UM samples was positively correlated with IL-6 and STAT3 (n = 79).

Detailed Description

To make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in detail with reference to the accompanying drawings.

1. Materials and methods

1. Cell lines

In the present invention, the cell lines MUM2B (genotype BRAF wild type), 92.1 (genotype GNAQ mutant type) and MP41 (genotype GNA11 mutant type) were used. Primary MUM2B and primary MP41 cells were obtained from the American type culture Collection (ATCC, rockville, md., USA) and cultured in DMEM medium containing 10vol% fetal bovine serum. The original 92.1 cell line was awarded by professor Vavvas Demetrios and doctor efsithiou Nikolaos, general hospital, massachusetts. 92.1 cells were cultured in RPMI-1640 medium containing 10vol% fetal bovine serum. All cell lines are transfected by CMV/firefly-Luciferase-neomycin lentivirus (Genechem, shanghai, china, the carrier number is GV542, the element sequence is Ubi-MCS-fire _ Luciferase-SV 40-neomycin), the transfection dose is MOI =10, so that the subsequent in vivo and in vitro experiments are carried out, IVIS imaging observation is carried out, the transfection does not influence the infection capacity and the biological activity of the oHSV-1, and the MUM2B,92.1 and MP41 cell lines used in the subsequent steps of the invention are transfected cell lines.

2. Oncolytic virus

In the present invention, the type of the oncolytic herpes simplex virus is not particularly limited, and any known oncolytic herpes simplex virus in the art may be used, but the herpes simplex virus is preferably a type I herpes simplex virus in order to better achieve stable expression of foreign nucleic acid and killing of tumor cells. The source of the herpes simplex virus of the present invention is not particularly limited, and the herpes simplex virus may be obtained commercially or may be isolated in a laboratory, and preferably is a human-derived herpes simplex virus. The oncolytic type 1 herpes simplex virus used in the present invention may be a wild-type oncolytic type 1 herpes simplex virus or a recombinant oncolytic type 1 herpes simplex virus, although not particularly limited thereto. The recombinant oncolytic 1-type herpes simplex virus is obtained by transforming wild-type oncolytic 1-type herpes simplex virus (HSV-1), and the construction method comprises the following steps:

the ICP34.5 gene and ICP47 gene of wild-type HSV-1 virus (GenBank number: NC-001806, the same applies below for its gene sequence) were knocked out to generate an oncolytic HSV-1 vector (oHSV-1) according to the method described in the patent application with application No. 2004100064921, and then an exogenous nucleic acid sequence containing the CD gene of Escherichia coli was inserted at the position where the ICP34.5 gene was knocked out (see FIG. 1). FIG. 1 is a schematic representation of the insertion of the E.coli CD transgene (nucleic acid sequence see SEQ ID NO.13, protein sequence see SEQ ID NO. 14)Drawing, replacing gamma₁34.5, the inserted exogenous nucleic acid sequence also includes CMV and poly (A) promoters in order to make the inserted exogenous CD gene express smoothly. The methods for gene knockout and gene insertion of the present invention are conventional methods in the art, such as homologous recombination, and are not described herein. By deleting gamma₁34.5 Gene and ICP47 Gene the recombinant virus constructed was called oHSV-1-CD. Briefly, all viruses were grown and titrated in Vero cells, harvested by sonication and centrifugation at 1200 × g for 20 minutes. The virus was stored at-80 ℃ avoiding freeze-thaw cycling. The recombinant oncolytic herpes simplex virus is gamma₁34.5 deletion, ICP47 deletion and presence of the characteristic short 11 glycoprotein US11, and the gene coding for cytosine deaminase is inserted gamma₁A recombinant oncolytic herpes simplex 1 virus at position 34.5.

Sequence of SEQ ID NO. 13:

ATGTCGAATAACGCTTTACAAACAATTATTAACGCCCGGTTACCAGGCGAAGAGGGGCTGTGGCAGATTCATCTGCAGGACGGAAAAATCAGCGCCATTGATGCGCAATCCGGCGTGATGCCCATAACTGAAAACAGCCTGGATGCCGAACAAGGTTTAGTTATACCGCCGTTTGTGGAGCCACATATTCACCTGGACACCACGCAAACCGCCGGACAACCGAACTGGAATCAGTCCGGCACGCTGTTTGAAGGCATTGAACGCTGGGCCGAGCGCAAAGCGTTATTAACCCATGACGATGTGAAACAACGCGCATGGCAAACGCTGAAATGGCAGATTGCCAACGGCATTCAGCATGTGCGTACCCATGTCGATGTTTCGGATGCAACGCTAACTGCGCTGAAAGCAATGCTGGAAGTGAAGCAGGAAGTCGCGCCGTGGATTGATCTGCAAATCGTCGCCTTCCCTCAGGAAGGGATTTTGTCGTATCCCAACGGTGAAGCGTTGCTGGAAGAGGCGTTACGCTTAGGGGCAGATGTAGTGGGGGCGATTCCGCATTTTGAATTTACCCGTGAATACGGCGTGGAGTCGCTGCATAAAACCTTCGCCCTGGCGCAAAAATACGACCGTCTCATCGACGTTCACTGTGATGAGATCGATGACGAGCAGTCGCGCTTTGTCGAAACCGTTGCTGCCCTGGCGCACCATGAAGGCATGGGCGCGCGAGTCACCGCCAGCCACACCACGGCAATGCACTCCTATAACGGGGCGTATACCTCACGCCTGTTCCGCTTGCTGAAAATGTCCGGTATTAACTTTGTCGCCAACCCGCTGGTCAATATTCATCTGCAAGGACGTTTCGATACGTATCCAAAACGTCGCGGCATCACGCGCGTTAAAGAGATGCTGGAGTCCGGCATTAACGTCTGCTTTGGTCACGATGATGTCTTCGATCCGTGGTATCCGCTGGGAACGGCGAATATGCTGCAAGTGCTGCATATGGGGCTGCATGTTTGCCAGTTGATGGGCTACGGGCAGATTAACGATGGCCTGAATTTAATCACCCACCACAGCGCAAGGACGTTGAATTTGCAGGATTACGGCATTGCCGCCGGAAACAGCGCCAACCTGATTATCCTGCCGGCTGAAAATGGGTTTGATGCGCTGCGCCGTCAGGTTCCGGTACGTTATTCGGTACGTGGCGGCAAGGTGATTGCCAGCACACAACCGGCACAAACCACCGTATATCTGGAGCAGCCAGAAGCCATCGATTACAAACGTTGA

SEQ ID No.14 sequence:

MSNNALQTIINARLPGEEGLWQIHLQDGKISAIDAQSGVMPITENSLDAEQGLVIPPFVEPHIHLDTTQTAGQPNWNQSGTLFEGIERWAERKALLTHDDVKQRAWQTLKWQIANGIQHVRTHVDVSDATLTALKAMLEVKQEVAPWIDLQIVAFPQEGILSYPNGEALLEEALRLGADVVGAIPHFEFTREYGVESLHKTFALAQKYDRLIDVHCDEIDDEQSRFVETVAALAHHEGMGARVTASHTTAMHSYNGAYTSRLFRLLKMSGINFVANPLVNIHLQGRFDTYPKRRGITRVKEMLESGINVCFGHDDVFDPWYPLGTANMLQVLHMGLHVCQLMGYGQINDGLNLITHHSARTLNLQDYGIAAGNSANLIILPAENGFDALRRQVPVRYSVRGGKVIASTQPAQTTVYLEQPEAIDYKR

3. cell survival assay

Cells were seeded in 96-well plates overnight at a density of 5,000 cells per well. Cells were incubated with virus at a defined multiplicity of infection (MOI), MUM2B, MP41 in DMEM medium and 92.1 in RPMI-1640 medium, both at 37 ℃. For the oHSV-1-CD/5-FC test, after 24 hours of incubation, 100. Mu.l of 5-FC (50. Mu.g/mL) was added to each well of the oHSV-1-CD/5-FC group. Incubation was continued for 48h. Cell viability was determined using cell counting kit-8 (CCK-8, dojindo Molecular technologies, shanghai, china) according to the manufacturer's instructions. The absorbance of the sample was measured at 450nm using a Spectra Microplate Reader.

4. Western blot analysis

Before cell collection, MUM2B,92.1 and MP41 cells were incubated for 48h with the virus oHSV-1-CD or oHSV-1-CD/5-FC in combination. The cells were then scraped into lysis buffer (Thermo Scientific, carlsbad, CA, USA) containing protease inhibitors and phosphatase inhibitors. After incubation on ice for 45 minutes, the supernatant was collected and the protein concentration was determined. Proteins (32. Mu.g per lane) were loaded onto gels for separation by SDS-PAGE. After separation, the proteins were transferred to nitrocellulose membranes and blocked with 1 × TBST (Tris buffered saline, 0.1vol% tween 20) containing 5wt% skim milk powder for 30 minutes at room temperature. Membranes were washed with 1 × TBST and incubated with primary antibody overnight at 4 ℃. Table 1 lists the primary antibodies used in the present invention. After washing the membrane with 1 × TBST, the membrane was incubated with horseradish peroxidase-labeled goat anti-rabbit IgG secondary antibody (Thermo Scientific,31462, G-21040) or horseradish peroxidase-labeled goat anti-mouse IgG secondary antibody (Thermo, G-21040) at room temperature for 1 hour. The signal is detected using an ECL detection system. ImageJ was used to quantify western blot bands. Secondary antibody against immunofluorescence IF: goat anti-rabbit IgG (CST, 4413S) labeled with fluorescence (Alexa Fluor 555) or goat anti-rabbit IgG (CST, 4412S) labeled with fluorescence (Alexa Fluor 488).

TABLE 1 list of antibodies (Primary antibodies) for western blotting and immunofluorescence

5. Transmission Electron Microscope (TEM) imaging

MUM2B cells at 10cm²The culture dishes were incubated and treated with virus as described above. Virus was added at the desired MOI, cells were washed with PBS, and fixed in osmium tetroxide (OsO)₄) In (1). After continuous dehydration in gradient ethanol, the samples were stained with basic lead citrate and uranyl acetate. Images were taken by TEM at 80 kV.

6. Quantitative PCR

Total RNA was extracted from the virus-treated frozen cell pellet using TRIzol reagent (Thermo Scientific). cDNA synthesis was performed using a reverse transcription system kit (Promega A3500, fitchburg, wis., USA) according to the manufacturer's instructions. qPCR analysis was performed using SYBR-Green PCR Master Mix (Applied Biosystems, waltham, MA, USA) on a QuantStaudio 6Flex system (Applied Biosystems) using routine procedures. Each target was replicated three times, GAPDH was used as an internal control. The results are expressed as 2-^ΔΔCt. See table 2 for primer sequences.

TABLE 2 primer List used in qPCR

7.ELISA

Cytokines were measured using the ELISA kit shown in table 3 and summarized according to the manufacturer's instructions (table 3). The absorbance of the sample was measured at 450nm using a Spectra Microplate Reader.

TABLE 3 ELISA kit List used in ELISA analysis

Cytokine	Purchasing company	Product goods number
			IL-1β	Abcam	ab100562
IL-2	Abcam	ab174444
			IL-4	Abcam	ab215089
IL-5	Abcam	ab215536
			IL-6	Abcam	ab178013
IL-10	Abcam	ab46034
			IL-12p70	Abcam	ab223592
IL-17A	Abcam	ab83688
			IL-17F	Abcam	ab100557
IL-22	Abcam	ab216170
			TNFα	Abcam	ab181421
TNFβ	Abcam	ab119576
			IFNγ	Abcam	ab46025

8. Immunofluorescent staining

MUM2B cells were cultured overnight in Lab-Tek laboratory (Nunc, roskilde, denmark). Virus (MOI = 1), 100 μ l of 5-FC (50 μ g/mL) and 100 μ l of IL-6 (50 ng/mL) were added to the different groups. The device was incubated from the time of cell inoculation until the drug was added. Each slide was seeded at a density of 10000 cells. Cells were fixed with 4% paraformaldehyde for 15 minutes at 37 ℃ and cleared with 0.3% Triton X-100 for 20 minutes at room temperature. Slides were then washed with PBS and blocked with goat IgG for 30 min. Primary antibody (table 1) was diluted and incubated overnight at 4 ℃. After washing with PBS, the slides were incubated with secondary antibodies, specifically fluorescent (Alexa Fluor 555) labeled goat anti-rabbit IgG (CST, 4413S) or fluorescent (Alexa Fluor 488) labeled goat anti-rabbit IgG (CST, 4412S), and washed with PBS. Finally, chamber slides were mounted with Prolong gold anti Reagent with DAPI (Invitrogen). Fluorescence images were captured using a Leica Aperio AT2 and Leica DM IRB instrument. Integrated Optical Density (IOD) was analyzed using ImageJ.

Tumor tissue sections were taken from animal specimens obtained two weeks after virus injection into the tumor. Immunofluorescent staining was performed as described previously. Briefly, samples were fixed in 4% paraformaldehyde and embedded in paraffin. The tissue slides were blocked with goat serum and incubated with primary antibody (table 1) overnight at 4 ℃. The next day, the samples were incubated with secondary antibodies labeled goat anti-rabbit IgG (CST, 4413S) labeled with FITC fluorescence (Alexa Fluor 555) or Cy3 fluorescence (Alexa Fluor 488) for 60 minutes at room temperature, and then stained with DAPI to visualize the nuclei. Mounting was performed using aqueous mounting medium (Thermo Scientific).

9. Construction of nude mouse heterogeneous tumor planting model

All in vivo experiments were performed according to the Helsinki declaration and guidelines for animal care and use (DHEW Press, NIH 80-23). Six-week-old male BALC/c nude mice (n =5 per group, and tolithan in beijing) were used. An animal model of subcutaneous xenograft tumor was established by injecting MUM2B cells into the right groin (2X 10) of mice at a time⁶Cells), virus (1X 10)⁵PFU/μ l, 50 μ l total) was injected once 10 days after cell implantation. In the operation of injecting 5-FC, 5-FC is injected intraperitoneally every two days from the next day after virus injection. Injection amount of 500mg/kg mouse body weight, injection of 5-FCThe concentration was 50. Mu.g/mL.

Using MUM2B cells (1X 10)⁵Cells) an intraocular xenograft tumor animal model was established and implanted into the right eye of the mouse once as previously described. One injection of virus (1X 10) into the vitreous cavity 10 days after tumor cell implantation⁵PFU/. Mu.l, 5. Mu.l total). In the case of the 5-FC injection, 5-FC was injected intraperitoneally every two days from the next day after virus injection. The injection amount is 500mg/kg mouse body weight.

IVIS imaging

In vitro testing: biological luciferase images were obtained using IVIS spectroscopy. After incubating with the virus oHSV-1-CD or co-processing oHSV-1-CD/5-FC for 48 hours, an in vitro image can be obtained. The culture medium for incubation was 100. Mu.L of DMEM medium containing 10vol% fetal bovine serum containing 0.5mg/mL D-fluorescein.

The individual treatments were: imaging was carried out 72h after addition of oHSV-1-CD. The combination therapy is to add oHSV-1-CD for 24h, then add 5-FC, incubate for 48h, and then image.

Mouse in vivo assay: biological luciferase images were obtained on day 0 (before virus injection), 7 days after virus injection, and 14 days after virus injection. Each mouse was injected intraperitoneally with 100. Mu.L of 15 mg/mL D-fluorescein 5min prior to IVIS assay. The image is analyzed and ROI values are obtained.

The individual treatments were: imaging was performed 10 days after the addition of oHSV-1-CD. The combination therapy was achieved by adding 5-FC 10 days after the addition of oHSV-1-CD, incubating for an additional 48h, and imaging.

11. Tumor volume, animal body weight and survival

Tumor volume and animal body weight were measured every three days to day 24 post-treatment and survival time was followed.

12. Statistical analysis

All data are expressed as mean ± standard deviation. Statistical analysis was performed using Student's t-test. Survival was analyzed using the Kaplan-Meier method and the log rank test. GraphPad Prism 7.0 was used to prepare all the graphs and to perform statistical analysis. P <0.05 was considered significant. Asterisks are used to indicate the importance of numbers. * P <0.05; * P <0.005; * P < 0.0005; p is less than 0.0005.* P <0.00005; NS, no statistical significance.

2. Examples of the embodiments

Example 1. Human UM cell lines were tested for oHSV-1 backbone sensitivity.

Sensitivity of oHSV-1 to UM was tested in models of the human UM cell lines, MUM2B,92.1 and MP41, described in section 1 of materials and methods, respectively. The three cell lines represent the major genotype of UM. The sensitivity of the oHSV-1 vector to UM cells was tested using the cell survival assay described in section 3 of materials and methods (figure 2). The results show that UM cells are sensitive to oHSV-1 in a dose-dependent manner. IC of each of these three cell lines₅₀Respectively at 0.1211MOI, 0.03897MOI, and 0.01195MOI. These results indicate that UM cells are sensitive to the genetically engineered oHSV-1 virus.

After the cells are inoculated for 24 hours, the culture medium is replaced by diluted oHSV-1, the diluted oHSV-1 is added into the complete culture medium, a DMEM culture medium with 10% fetal calf serum is adopted for MUM2B and MP41 cells, an RPMI-1640 culture medium with 10% fetal calf serum is adopted for 92.1 cell lines, and the dilution and cell activity values are shown in figure 2. Cell survival experiments were performed in 3 human uveal melanoma cell lines after 48 hours incubation with virus. IC (integrated circuit)₅₀Respectively at 0.1211MOI, 0.03897MOI, and 0.01195MOI.0 As can be seen from FIG. 2, the cell viability of all three cell lines is reduced with the increase of the amount of oHSV-1, and the oHSV-1 is sensitive to UM and can effectively kill UM cells.

Example 2 Effect of oncolytic HSV-1 on MUM2B cell phenotype and Gene expression

To further test the tumor killing efficacy of oHSV-1, the ultrastructure of MUM2B cells (infection dose MOI 0.1, infection time 72 h) after oHSV-1 infection was observed using electron microscope TEM (fig. 3A), according to the materials and methods of section 5. The virus was observed in the nucleus and cytoplasm (black arrows). Microvilli were reduced in infected cells compared to uninfected cells (white arrows). These data indicate that the EMT (epithelial-mesenchymal transition) process is inhibited by oHSV-1 infection.

Next, using MUM2B cells as a control, using oHSV-1 infection as a test group, and using the infection dosage MOI of 0.1, the invention further detects whether the oHSV-1 infection can inhibit EMT. Using the primers shown in table 2, the expression abundance of EMT marker genes, including mesenchymal marker genes, TWIST1, ZEB1, CD44 and DPD and epithelial marker genes, CDH1, GAPDH, were tested by conventional qPCR (fig. 3B) as internal controls. DPD expression is essential for EMT, where EMT is promoted by intracellular accumulation of dihydropyrimidines produced by DPD activation. Significant reductions in mesenchymal marker expression and increases in epithelial marker expression are observed with the present invention.

72h after viral infection, the relevant protein levels were detected using Western blotting using antibodies as shown in Table 1, according to the methods of section 4 of the materials and methods (FIG. 3C). With beta-Actin as an internal reference, western blotting results show that after virus treatment, levels of DPD (-110 kDa) and TWIST1 (-26 kDa) are reduced, and levels of CDH1 (-135 kDa) are increased. These results are consistent with the judgement of EMT inhibition after treatment with oHSV-1 based on qPCR assay.

Next, the present invention examined whether the OHSV-1-CD virus reconstituted by the methods of section 2 of the materials and methods inhibits the EMT phenotype like the OHSV-1 backbone, in the same manner and procedure as described above for the OHSV-1. qPCR and Western blot analysis (FIGS. 3B and 3C) were performed, and gene and protein expression of oHSV-1-CD was similar to that of oHSV-1. These data indicate that the construction of oHSV-1-CD does not affect the function of oHSV-1. Based on these studies, the present invention further tested the efficacy of oHSV-1-CD/5-FC.

FIG. 3 shows that oncolytic HSV-1 vectors cause downregulation of PDP and inhibit EMT phenotype. A. TEM images of untreated MUM2B cells and OHSV-1 vector-treated MUM2B cells. (black arrow: virus; white arrow: microvilli). Scale bar, 500nm. B. The mRNA expression levels of DPD, TWIST1, ZEB1, CD44 and CDH1 in the non-virus-infected group (control), oHSV-1 vector-infected group and oHSV-1-CD-infected group were detected by qPCR analysis. GAPDH was used as an internal control. Statistical analysis of the data was performed using Student-t test, and values are expressed as mean ± standard deviation. * P <0.05; * P <0.005; * P < 0.0005; p is less than 0.0005.* P <0.00005, compared to data from control cells. C. Expression of DPD, TWIST1 and CDH1 in three cell species control groups, vector group oHSV-1 and oHSV-1-CD group was detected by western blotting. Beta-actin is used as an internal control.

Example 3.OHSV-1-CD/5-FC validity test on UM cell lines

OHSV-1-CD, constructed using the methods of materials and methods section 2, was tested against the OHSV-1-CD/5-FC model in vitro to determine whether the recombinant virus functioned in the UM cell line. The efficacy of treatment with oHSV-1-CD/5-FC was examined using three human UM cell lines, MUM2B,92.1 and MP 41. Using materials and methods, section 10, 5,000 cells were seeded in each plate from left to right at 0MOI, 0.001MOI, 0.01MOI, 0.1MOI, 1MOI, 10MOI, 5-FC concentration in the oHSV-1-CD/5-FC group of 50 μ g/mL, and three rows repeated. The gradation drop in each process is displayed by the IVIS image. The reduction in IVIS graying was significantly greater in cells receiving combination treatment compared to the group using oHSV-1-CD alone (fig. 4A). The ROI was measured to quantify the pixel intensity in IVIS images (fig. 4B). This indicates a significant decrease in cell viability following an increase in MOI, whereas combined treatment with 5-FC enhanced killing. Cell survival experiments were performed to confirm the results using the cell survival experimental methods described in section 3 of materials and methods (fig. 4C). For the MUM2B cells: IC of oHSV-1-CD₅₀IC at 0.08238MOI, oHSV-1-CD/5-FC₅₀Is 0.07201MOI; for 92.1 cells: IC of oHSV-1-CD₅₀IC at 0.01693MOI, oHSV-1-CD/5-FC₅₀0.008233MOI; for MP41 cells: IC of oHSV-1-CD₅₀IC at 0.208MOI, oHSV-1-CD/5-FC₅₀0.08105MOI; IC of combination therapy in all three cell lines₅₀Lower than the oHSV-1-CD treatment alone. These results indicate that oHSV-1-CD is an effective UM therapy and that the combination with 5-FC improves efficacy.

Various 5-FC concentrations were tested to examine the effectiveness of the suicide gene in oncolytic viruses (FIG. 4D), using the MUM2B cell assay using the cell survival assay described in section 3 of materials and methods. At low MOI, the suicide gene is more significant in efficacy. In addition, increasing the 5-FC concentration above 50. Mu.g/mL did not improve the therapeutic effect. Therefore, the optimum concentration of 5-FC in the treatment was 50. Mu.g/mL. Cell viability was examined after different time periods (fig. 4E). Differences were observed at low MOI with or without 5-FC (MOI = 0.01). However, cell viability declined at day 3 post-treatment and was considered time-dependent. Around day 6, the viability of both the lowest and highest MOI tended to be consistent. These data demonstrate that this approach can be used to reflect in vivo therapeutic situations where the virus is most likely at a low MOI.

Western blot assays were used to assess CD expression following viral infection, using the antibodies shown in table 1, according to the methods of materials and methods section 4, at an infectious dose of 0.1MOI. Expression of CD (. About.48 kDa) was detected 24 hours post infection (FIG. 4F). Inhibition of thymidylate synthase (TS,. About.30 kDa) by 5-FU was evaluated indirectly (FIG. 4G). The results of the experiments indicate that the up-regulation of TS in the combination treatment group may be due to the conversion of 5-FU.

FIG. 4 shows the therapeutic effect of oncolytic virus oHSV-1-CD/5-FC on the UM cell line. Ivis images showed a gray reduction within each treatment, which was more pronounced in the combination treatment group (containing 50 μ g/mL 5-FC). B. The quantified pixel intensities are measured in IVIS images. C. Cellular activity was measured in 3 human uveal melanoma cell lines treated with oHSV-1-CD and oHSV-1-CD/5-FC. D. Cell viability was examined at different 5-FC concentrations. E. Cell viability was checked at different time lines. F. Western blot shows CD expression 24 hours after viral infection. Beta-actin is used as an internal control. G. CD and TS expression was detected by western blot. Beta-actin is used as an internal control.

Example 4 oncolytic viruses down-regulate IL-6/STAT3 and inhibit DPD expression.

To further demonstrate the effectiveness of oHSV-1-CD, the collected cell supernatants were used to perform ELISA assays for various cytokines in culture media using 0.1MOI of viral oHSV-1-CD seeded into MUM2B cells, one without 5-FC and the other at a concentration of 50 μ g/mL, using MUM2B cells as control, using the materials and methods described in section 7 and the kit described in table 3 (fig. 5A). The results indicate that IL-6 is reduced in both the virome alone and the combination treatment. This suggests that IL-6 is greatly affected and its signaling pathway plays an important role in the treatment of oncolytic viruses.

Since IL-6 signaling is a key mechanism of EMT, the present invention next detects via the IL-6/STAT3 signaling pathway whether IL-6 enhances EMT by activating the signaling pathway. 5,000 MUM2B cells were inoculated with 1MOI of the virus oHSV-1 or oHSV-1-CD at a concentration of 50. Mu.g/mL for 5-FC and 10ng/mL for IL-6. The level of the relevant protein was determined using western blotting using the antibodies shown in table 1, according to the methods of material and method section 4 (fig. 5B and 5D). STAT3 is highly phosphorylated in both the MUM2B cell and IL-6 treatment groups. oHSV-1-CD and combination therapy resulted in decreased levels of phosphorylated STAT3, TWIST1 and DPD. IL-6 treatment resulted in elevated levels of phosphorylated STAT3, TWIST1 and DPD. Immunocytochemistry confirmed these results using the antibodies shown in Table 1, according to the methods of materials and methods section 8 (FIG. 5C). Taken together, these data indicate that the therapeutic advantages of the combination treatment of oHSV-1-CD/5-FC are associated with the ability to reverse EMT and inhibit IL-6 signaling in vivo.

IL-6 was added to perform cell viability assay (FIG. 5E (1)). Cell viability was repeated three times and IC was calculated₅₀Fold change (fig. 5E (2)). Addition of IL-6 reduced the sensitivity, IC, of oHSV-1-CD₅₀And higher. Taken together, these data indicate that oncolytic viruses can cause the under-expression of IL-6, resulting in the cancer cells reaching an epithelial phenotype. The virus also reduced DPD expression, which helped restore sensitivity to CD/5-FC.

FIG. 5 shows the inhibition of EMT by downregulation of IL-6 by oHSV-CD/5-FC, and downregulation of DPD in vitro. ELISA analysis showed that IL-6 was reduced for both the OHSV-1-CD and the OHSV-1-CD/5-FC groups. Statistical analysis of the data was performed using Student's-t test, and the values are expressed as mean ± standard deviation. * P <0.005 compared to placebo cells. ohsv-1-CD reduces activation of IL-6 signaling and reduces DPD expression in MUM2B cells. Beta-actin is used as an internal control. C. Immunofluorescent staining confirmed the expression of CDH1, CDH2, vimentin and DPD. Oncolytic viruses reverse the IL-6 induced EMT phenotype. Scale bar, 100 μm. Quantification of blots in d.b. E. (1) Additional IL-6 treated finesAnd (4) measuring the cell viability. (2) IC in cell viability assay₅₀A change in (c). Statistical analysis of the data was performed using Student's-t test, values are expressed as mean ± standard deviation. * P is less than 0.05.

Example 5 OHSV-1-CD/5-FC antitumor Activity induced in BALB/c nude mouse xenograft model

To identify the therapeutic efficacy of oHSV-1-CD/5-FC, a BALB/c nude mouse transplantation model was established according to the materials and methods in sections 9 and 10. The mice were implanted with MUM2B cells. 5-FC (500 mg/kg mouse body weight) was used at the indicated times (FIG. 6E). IVIS images and quantification of subcutaneous xenografted ROI clearly showed that tumor size was reduced in the oHSV-1-CD group, while this effect was enhanced in the oHSV-1-CD/5-FC group (FIGS. 6A and 6B). Subcutaneous tumors were harvested, their volume determined (fig. 6C and 6D), and a significant decrease was observed. An in situ tumor model was constructed to more accurately observe the therapeutic effect. IVIS images and associated ROI quantification were obtained (fig. 6F and 6G). The volume of the eye was calculated and showed a significant volume reduction (fig. 6H).

These results indicate that oHSV-1-CD is effective in treating UM, while 5-FC enhances this effect. There was no significant difference in body weight within 24 days after virus injection (FIG. 6I). This indicates that the treatment administered had no negative effects on the animals and that the toxic effects were low. In addition, the log rank test results showed median survival for the control, OHSV-1-CD and OHSV-1-CD/5-FC groups for 23, 33 and 50 days (p < 0.05) (FIG. 6J), respectively. The results indicate that the survival time of the virus-infected group was prolonged compared to the virus-only group, and was significantly prolonged in the combination treatment group. Overall, these results indicate that treatment with oHSV-1-CD/5-FC in combination is significantly effective in UM.

FIG. 6 shows that oHSV-CD/5-FC induces anti-tumor efficacy in a BALB/c nude mouse xenograft model. A. IVIS images of subcutaneous tumor xenografts in different groups (n =5 mice per group, only 2 shown in the figure) were administered 500mg/kg to 5-FC according to time line. Quantification of ROI of b.a. C. Inguinal resection of subcutaneous tumors in different groups. D. Inguinal resection of subcutaneous tumor weights in different groups. E. Schedule in vivo study protocol, virus treatment was performed on day 10 after tumor implantation. 5-FC treatment was then performed every other day. Small animal in vivo fluorescence imaging images were taken before, on day 7, and on day 14, respectively, before virus treatment. F. IVIS images of orthotopic xenografts from uninfected oHSV-1-CD and oHSV-1-CD/5-FC groups (n =5 mice per group, only 3 shown in the figure). ROI quantification of g.f. H. Eye volume measured after tumor cell implantation and under different treatments. I. Tumor cell implantation and weight of in situ xenografts after treatment. J. Survival curves of in situ UM tumors with xenografts. Log rank test, p <0.05, statistical analysis of data using Student's-t test, values expressed as mean ± standard deviation. * P <0.05; * P <0.005; * P < 0.0005; p is less than 0.0005.* P <0.00005.

Example 6 oncolytic viruses overcome DPD resistance and inhibit IL-6 signaling activation in vivo

To elucidate the underlying mechanisms of efficacious treatment of oHSV-1-CD/5-FC, the present invention analyzed the EMT and IL-6 signaling pathways in the xenograft model of example 5 using the antibodies shown in Table 1, according to the methods of materials and methods, sections 4, 9, and 10. Using mice transplanted with oHSV-1-CD as a control, the test group was intraperitoneally injected with a 5-FC physiological saline solution at 500mg/kg of mouse body weight, and immunofluorescence was used to examine these components in three groups (FIG. 7A). Tumor specimens were obtained 2 weeks after virus injection and IOD was calculated (fig. 7E).

Using the methods of section 7 of materials and methods and the kit described in table 3 to detect various cytokines in the culture medium after 72h of culture, factors were detected in the plasma of each group of mice and a decrease in the levels of IL-6, p-STAT3, CDH2, vimentin and DPD and an increase in the levels of CDH1 were observed in the treated groups. These results indicate that EMT is inhibited in both the OHSV-1-CD and the OHSV-1-CD/5-FC groups. These results were confirmed by western blot analysis (fig. 7C) and quantified (fig. 7D).

When factors were detected in the plasma of mice in each group according to the method of section 4 of the materials and methods using the antibodies shown in Table 1, CDH1 expression was increased and p-STAT3, TWIST1 and DPD were decreased after the oncolytic virus treatment, as compared to the control group. IL-6 secretion in sera from xenograft model of nude mice was examined using ELISA (FIG. 7B). A significant reduction in serum IL-6 was detected in the group injected with virus. Taken together, these data suggest that the therapeutic advantage of the oHSV-1-CD/5-FC combination therapy is due to the ability of oncolytic viruses to inhibit DPD and function through the IL-6 signaling pathway in vivo to reverse EMT.

Figure 7 shows that oncolytic viruses down-regulate IL-6 signaling and inhibit DPD expression in vivo. oHSV-1-CD treatment reverses EMT by inhibiting the IL-6/STAT3 signaling pathway in xenograft tumor masses. The tumor was immunostained in paraffin-embedded sections. Scale bar, 50 μm. B. ELISA was evaluated to determine cytokine levels in xenograft serum. OHSV-1-CD reduces the level of IL-6 in serum. C. Western blot analysis the expression of the relative marker proteins obtained from tumor extraction. Beta-actin is used as an internal control. D.c quantitative blotting of results. Quantification of immunostaining positive cells in e.a. Statistical analysis of the data was performed using Student's-t test, and the values are expressed as mean ± standard deviation. * P <0.05; * P <0.005; * P < 0.0005; p is less than 0.0005.* P <0.00005, compared to control cells, respectively.

UM is the most common intraocular tumor in adults and the incidence of metastasis is high. Current treatment of UM remains limited to extirpation and radiation therapy, resulting in poor prognosis of this chemotherapy-resistant cancer. Therefore, new strategies are urgently needed to extend the survival of UM patients. The invention realizes a novel recombinant oHSV-1 with Escherichia coli CD, proves the treatment efficacy of the virus in vitro and in vivo, and determines the potential molecular mechanism of the virus oHSV-1 in UM. The present invention examined the anti-tumor efficacy of the novel recombinant oHSV-1 with e. The present invention determines the efficacy of oncolytic viruses in UM cell lines. In vivo experiments have shown that treatment with this virus reduces tumor volume and increases survival rates. The invention further proves the molecular mechanism of the oHSV-1-CD/5-FC treatment. Oncolytic viruses down-regulate IL-6, thereby reversing the EMT phenotype. DPD, which functions as a rate-limiting enzyme in the metabolism of 5-FU, is also down-regulated. Therefore, the efficacy of oHSV-1-CD/5-FC can be synergistically enhanced by down-regulating DPD and inhibiting EMT. The invention introduces the oncolytic HSV-1 vector into UM for the first time. Unexpectedly, cell viability analysis showed that UM was more sensitive to oHSV-1 vector than to adenovirus. The high efficiency of the oHSV-1 vector provides a new strategy for treating UM. Based on the novel finding of the present invention that treatment with oHSV-1 results in inhibition of the EMT phenotype, the present invention investigated the transition from a mesenchymal to an epithelial phenotype in UM cells. EMT is characterized by stem cell-like properties, loss of cell adhesion, and the ability to migrate, making cells more capable of local invasion and distant migration. EMT is also associated with chemotherapy resistance given its aggressive tumor behavior. Studies have linked DPD function to the resistance of acquired tumors to 5-FU chemotherapy and its important role in EMT. Patients with low DPD expression experience profound efficacy of 5-FU therapy by reducing drug catabolism. The present inventors have found that the UM cell line is less sensitive to 5-FU (FIG. 8), which makes the combination of oHSV-1-CD and 5-FC a potential therapeutic approach. For the MUM2B,92.1 and MP41 cell lines, three rows were repeated from left to right in each plate with 5-FC addition of 0. Mu.M, 1.25. Mu.M, 2.5. Mu.M, 5. Mu.M, 10. Mu.M, 20. Mu.M, referenced to the materials and methods of section 10. The same is the cell killing experiment. Cells were seeded in 96-well plates overnight at a density of 5,000 cells per well. Cells were incubated with 5-FU mixed at 50. Mu.g/mL for 48h and cell viability was determined using cell counting kit-8 (CCK-8, dojindo Molecular technologies, shanghai, china) according to the manufacturer's instructions. The absorbance of the sample was measured at 450nm using a Spectra Microplate Reader.

FIG. 8 shows that 5-FU shows less sensitivity to human uveal melanoma cell lines. Ivis images show the radiation decline of 5-FU treatment. B. The quantified pixel intensities are measured in IVIS images. C. Cell viability was measured in 5-FU treated 3 human uveal melanoma cell lines, their IC₅₀Respectively as follows: 12.9. Mu.M, 108.4. Mu.M, 56.67. Mu.M. DPD is an EMT-promoting transcription factor. This metabolic gene is also essential for the pyrimidine degradation pathway and is an inhibitor of the rapid degradation of 5-FU to Dihydrofluorouracil (DHFU). This is the rate-limiting step in the catabolism of 5-FU. With 5-FU atCell viability assays performed on the UM cell line (FIG. 8) showed that UM is less sensitive to 5-FU. Therefore, it is believed that down-regulation of DPD by oHSV-1 will enhance the efficacy of 5-FU treatment. The results of examining the expression levels of IL-6 and DPD according to the method in section 8 of the Material and method by using the antibodies shown in Table 1 showed that IL-6 and DPD were well expressed in UM tumor specimens (FIG. 9). Therefore, the constructed oHSV-1 is enhanced by encoding a CD suicide gene to synergistically enhance the efficacy of oHSV-1. After oHSV-1-CD treatment, DPD expression was down-regulated, and DPD expression was enhanced after additional IL-6 was introduced into the culture medium in vitro. The association between DPD and IL-6/STAT3 in the genomic profile of cancer (TCGA) and clinical UM specimens was analyzed using the GEPIA2 platform and a significant relationship between DPD and IL-6/STAT3 mRNA levels was observed (FIG. 10). Down-regulation of DPD is associated with the IL-6/STAT3 signaling pathway and may explain the efficacy of the combination therapy with oHSV-1-CD/5-FC.

Figure 9 shows that IL-6 and DPD are well expressed in tumor specimens of uveal melanoma patients (n = 9). Photomicrographs of UM patient tumor masses in a.h & E. IF is a representative paraffin-embedded section of red IL-6 and green DPD. Scale bar, 50 μm. Quantification of immunostaining positive cells in b.a.

Figure 10 shows that DPD expression in UM samples was positively correlated with IL-6 and STAT3 (n = 79). A. Analysis of the TCGA database using the GEPIA2 platform showed a correlation of DPD with IL-6 or STAT3 at the mRNA level. GAPDH was used as the normalization gene. B. Overall survival of UM patients expressing different levels of DPD in the TCGA database.

5-FU is a small molecule that can diffuse into and out of cells, making the "bystander effect" a special feature of the CD/5-FC suicide gene system. However, this suicide gene system cannot target specific cells. The present invention combines oHSV-1 with a CD/5-FC system to create oHSV-1-CD/5-FC combination therapy. Through in vitro and in vivo experiments, the invention finds that the oHSV-1-CD/5-FC has wide prospect in treating UM patients. The present invention observes that IL-6 is inhibited after viral infection. HSV-1 encoded gene gamma₁34.5 and Us11 were specifically designed to prevent accumulation of phosphorylated eIF2 α. Us11 is an ancient mechanism that blocks the action of activated PKRAnd has been substituted by gamma 134.5 viral protein. Cells infected with oHSV-1 cause a reduction in IL-6, one of the major cytokines activating the STAT family. The present inventors have found that phosphorylation of STAT3 is down-regulated after viral treatment, while phosphorylation of STAT3 is increased after IL-6 is added. STAT3 acts on the proliferation and invasion of tumor cells and is known for its carcinogenic effects. Inhibition of IL-6/STAT3 reduced tumor cell growth after viral therapy. Interestingly, inflammation-associated cytosine IL-6 is capable of inducing EMT in cancer cells, whereas down-regulation of IL-6 reverses EMT. We also observed inhibition of TWIST1 after virus treatment. TWIST1 is a key role in EMT and is the direct target of STAT 3. STAT3 may also bind to the vimentin promoter to enhance its expression and directly or indirectly target the transcriptional regulator of CDH1. This suggests that oHSV-1-CD functions in infected UM cells by inhibiting IL-6/STAT3 signaling. New therapeutic approaches have emerged in the field of cancer therapy. Oncolytic viruses keep this field away from conventional therapies. However, research has some limitations. IL-6/STAT3 pathway inhibition in vivo and in clinical samples could not be determined. Given the importance of IL-6 in reducing the efficacy of combination therapy, inhibitors of IL-6 will be available to thoroughly examine the therapy.

In summary, the present invention demonstrates for the first time that oHSV-1-CD/5-FC is effective in treating UM both in vitro and in vivo, and can prolong overall survival in xenograft animal models. The results of the present invention indicate that the anti-tumor efficacy of the treatment with oHSV-1-CD/5-FC is due in part to the reduction in IL-6. Changes in EMT phenotype indicate that oHSV-1-CD/5-FC treatment can inhibit the IL-6/STAT3 signaling pathway. The combined effect of oncolytic virus and suicide gene expression improves the anti-tumor efficacy of 5-FU through DPD down-regulation. The invention provides a solid foundation for future research and solid evidence for supporting the OHSV-1-CD/5-FC combination treatment as a new clinical treatment for UM patients.

It will be appreciated by those skilled in the art that the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The embodiments disclosed above are therefore to be considered in all respects as illustrative and not restrictive. All changes which come within the scope of or equivalence to the invention are intended to be embraced therein.

Sequence listing

<110> Neuko department of neurosurgery research in Beijing

<120> application of oncolytic virus in treatment of uveal melanoma, marker of treatment effect and detection reagent thereof

<130> C1CNCN200742

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtgttccact tcggccaaga a 21

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gagtcgtgtg cttgatgtca t 21

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgcggaagat catccccacg 20

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gctgcagctt gccatcttgg a 21

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccaggtgtaa gcgcagaaa 19

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgcagtttgt cttcatcatc tg 22

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cggacaccat ggacaagttt 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ccgtccgaga gatgctgtag 20

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttgcaccggt cgacaaagga c 21

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tggattccag aaacggaggc c 21

<210> 11

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctgcaccacc aactgcttag c 21

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cttcaccacc ttcttgatgt c 21

<210> 13

<211> 1284

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 13

atgtcgaata acgctttaca aacaattatt aacgcccggt taccaggcga agaggggctg 60

tggcagattc atctgcagga cggaaaaatc agcgccattg atgcgcaatc cggcgtgatg 120

cccataactg aaaacagcct ggatgccgaa caaggtttag ttataccgcc gtttgtggag 180

ccacatattc acctggacac cacgcaaacc gccggacaac cgaactggaa tcagtccggc 240

acgctgtttg aaggcattga acgctgggcc gagcgcaaag cgttattaac ccatgacgat 300

gtgaaacaac gcgcatggca aacgctgaaa tggcagattg ccaacggcat tcagcatgtg 360

cgtacccatg tcgatgtttc ggatgcaacg ctaactgcgc tgaaagcaat gctggaagtg 420

aagcaggaag tcgcgccgtg gattgatctg caaatcgtcg ccttccctca ggaagggatt 480

ttgtcgtatc ccaacggtga agcgttgctg gaagaggcgt tacgcttagg ggcagatgta 540

gtgggggcga ttccgcattt tgaatttacc cgtgaatacg gcgtggagtc gctgcataaa 600

accttcgccc tggcgcaaaa atacgaccgt ctcatcgacg ttcactgtga tgagatcgat 660

gacgagcagt cgcgctttgt cgaaaccgtt gctgccctgg cgcaccatga aggcatgggc 720

gcgcgagtca ccgccagcca caccacggca atgcactcct ataacggggc gtatacctca 780

cgcctgttcc gcttgctgaa aatgtccggt attaactttg tcgccaaccc gctggtcaat 840

attcatctgc aaggacgttt cgatacgtat ccaaaacgtc gcggcatcac gcgcgttaaa 900

gagatgctgg agtccggcat taacgtctgc tttggtcacg atgatgtctt cgatccgtgg 960

tatccgctgg gaacggcgaa tatgctgcaa gtgctgcata tggggctgca tgtttgccag 1020

ttgatgggct acgggcagat taacgatggc ctgaatttaa tcacccacca cagcgcaagg 1080

acgttgaatt tgcaggatta cggcattgcc gccggaaaca gcgccaacct gattatcctg 1140

ccggctgaaa atgggtttga tgcgctgcgc cgtcaggttc cggtacgtta ttcggtacgt 1200

ggcggcaagg tgattgccag cacacaaccg gcacaaacca ccgtatatct ggagcagcca 1260

gaagccatcg attacaaacg ttga 1284

<210> 14

<211> 427

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 14

Met Ser Asn Asn Ala Leu Gln Thr Ile Ile Asn Ala Arg Leu Pro Gly

1 5 10 15

Glu Glu Gly Leu Trp Gln Ile His Leu Gln Asp Gly Lys Ile Ser Ala

20 25 30

Ile Asp Ala Gln Ser Gly Val Met Pro Ile Thr Glu Asn Ser Leu Asp

35 40 45

Ala Glu Gln Gly Leu Val Ile Pro Pro Phe Val Glu Pro His Ile His

50 55 60

Leu Asp Thr Thr Gln Thr Ala Gly Gln Pro Asn Trp Asn Gln Ser Gly

65 70 75 80

Thr Leu Phe Glu Gly Ile Glu Arg Trp Ala Glu Arg Lys Ala Leu Leu

85 90 95

Thr His Asp Asp Val Lys Gln Arg Ala Trp Gln Thr Leu Lys Trp Gln

100 105 110

Ile Ala Asn Gly Ile Gln His Val Arg Thr His Val Asp Val Ser Asp

115 120 125

Ala Thr Leu Thr Ala Leu Lys Ala Met Leu Glu Val Lys Gln Glu Val

130 135 140

Ala Pro Trp Ile Asp Leu Gln Ile Val Ala Phe Pro Gln Glu Gly Ile

145 150 155 160

Leu Ser Tyr Pro Asn Gly Glu Ala Leu Leu Glu Glu Ala Leu Arg Leu

165 170 175

Gly Ala Asp Val Val Gly Ala Ile Pro His Phe Glu Phe Thr Arg Glu

180 185 190

Tyr Gly Val Glu Ser Leu His Lys Thr Phe Ala Leu Ala Gln Lys Tyr

195 200 205

Asp Arg Leu Ile Asp Val His Cys Asp Glu Ile Asp Asp Glu Gln Ser

210 215 220

Arg Phe Val Glu Thr Val Ala Ala Leu Ala His His Glu Gly Met Gly

225 230 235 240

Ala Arg Val Thr Ala Ser His Thr Thr Ala Met His Ser Tyr Asn Gly

245 250 255

Ala Tyr Thr Ser Arg Leu Phe Arg Leu Leu Lys Met Ser Gly Ile Asn

260 265 270

Phe Val Ala Asn Pro Leu Val Asn Ile His Leu Gln Gly Arg Phe Asp

275 280 285

Thr Tyr Pro Lys Arg Arg Gly Ile Thr Arg Val Lys Glu Met Leu Glu

290 295 300

Ser Gly Ile Asn Val Cys Phe Gly His Asp Asp Val Phe Asp Pro Trp

305 310 315 320

Tyr Pro Leu Gly Thr Ala Asn Met Leu Gln Val Leu His Met Gly Leu

325 330 335

His Val Cys Gln Leu Met Gly Tyr Gly Gln Ile Asn Asp Gly Leu Asn

340 345 350

Leu Ile Thr His His Ser Ala Arg Thr Leu Asn Leu Gln Asp Tyr Gly

355 360 365

Ile Ala Ala Gly Asn Ser Ala Asn Leu Ile Ile Leu Pro Ala Glu Asn

370 375 380

Gly Phe Asp Ala Leu Arg Arg Gln Val Pro Val Arg Tyr Ser Val Arg

385 390 395 400

Gly Gly Lys Val Ile Ala Ser Thr Gln Pro Ala Gln Thr Thr Val Tyr

405 410 415

Leu Glu Gln Pro Glu Ala Ile Asp Tyr Lys Arg

420 425

Claims (2)

1. The application of oncolytic herpes simplex virus combined tumor chemotherapy prodrug 5-fluorocytosine in preparing a medicament for reducing IL-6 and DPD expression in uveal melanoma is characterized in that the oncolytic herpes simplex virus is recombinant oncolytic 1-type herpes simplex virus with gamma 134.5 deletion, ICP47 deletion and glycoprotein US11 existing and a gene coding cytosine deaminase inserted into gamma 134.5 position; the amino acid sequence coded by the cytosine deaminase gene is shown in SEQ ID NO.14.

2. The use according to claim 1, wherein the cytosine deaminase gene has the nucleic acid sequence shown in SEQ ID No.13.

Images