CN111850041A

CN111850041A - Viral construct containing IL12 bicistron for treating liver cancer and application and construction method thereof

Info

Publication number: CN111850041A
Application number: CN202010753726.8A
Authority: CN
Inventors: 宫晓艳; 周海涛; 秦苗苗; 刘进稳
Original assignee: Yaoding Beijing International Cell Medical Technology Co ltd
Current assignee: Yaoding Beijing International Cell Medical Technology Co ltd
Priority date: 2020-07-30
Filing date: 2020-07-30
Publication date: 2020-10-30

Abstract

The application relates to a virus construct for treating liver cancer, and application and a construction method thereof. The invention also relates to a novel oncolytic virus for individualized targeted therapy of liver cancer and a construction method thereof. The constructs of the invention comprise, in an operable linkage, an AFP promoter, an RGD-4C gene, an IL-12-p40 gene, an IRES gene and an IL-12-p35 gene, and optionally a glutamyltranspeptidase gene and a tumor-associated antigen gene.

Description

Viral construct containing IL12 bicistron for treating liver cancer and application and construction method thereof

The technical field is as follows:

the invention relates to the field of biotechnology and gene therapy, in particular to a virus construct containing IL12 bicistron for treating liver cancer, and application and a construction method thereof. The invention also relates to a novel oncolytic virus for individualized targeted therapy of liver cancer and a construction method thereof.

Background art:

liver cancer refers to malignant tumor of liver, and is generally divided into two main categories: namely primary liver cancer and secondary liver cancer. The primary liver cancer originates from the epithelium or mesenchymal tissue of the liver and belongs to high-grade cancer in China; compared with primary liver cancer, secondary or metastatic liver cancer mainly refers to cancer in which tumors of various organs of a body have metastasized invade the liver. Liver cancer is induced by many factors, such as hepatitis B and C virus infection, drinking water pollution, carcinogenesis of chemical substances, immune disorder and other complex factors. Currently, there are several main approaches for cancer treatment: surgical treatment, palliative surgical treatment, multi-mode comprehensive treatment, absolute alcohol intratumoral injection, radiotherapy, guide treatment, hepatic artery embolism chemotherapy, radiotherapy, biological treatment and the like. The biological treatment is the fourth major liver cancer treatment method except operation, chemotherapy and radiotherapy at present. But the biological treatment means can be counted, wherein the immunotherapy method is to achieve the effect of autoimmunity by separating anticancer immune cells, carrying out in-vitro culture and then reinjecting the cells into the body of a patient; also targeted drugs for liver cancer, such as lenvatinib, approved by FDA in 2016, 5 months, have been used as first line drugs for systemic treatment of liver cancer. The Levatinib has main targets of VEGFR-1, VEGFR-2, VEGFR-3, FGFR1, PDGFR, cKit and Ret, and inhibits tumorigenesis and development by inhibiting cell activities such as tumorigenesis, angiogenesis and the like. The effective rate of lenvatinib is 24%, the median progression-free survival time is 7.4 months, and the median overall survival time is 13.6 months, which are shown according to clinical effects. Nevertheless, the mortality rate of liver cancer remains high worldwide, and the research on more effective methods for treating liver cancer is in the direction of necessity.

Interleukin-12 (IL-12), also known as natural killer cell stimulating factor (NKSF) or cytotoxic lymphocyte maturation factor (CLM F), it has numerous biological functions, especially show the toxicity and side effects in the tumor immunotherapy, anti-tumor formation and metastasis activity are high, hopefully develop into the new medicament for the treatment of tumor (Tang Dong et al, 1999), IL-12 is an important cytokine involved in immune regulation, it is mainly a heterodimer cytokine produced by antigen presenting cells such as macrophage, dendritic cell, etc., the bipartite subunit must express in a mammalian cell at the same time and can produce IL-12 with intact biological activity. IRES is a sequence in the 5' untranslated region of picornaviruses that can be directly introduced into the ribosome-sized subunit to translate subsequent structural genes. The characteristic of IRES can be applied to the construction of bicistronic eukaryotic expression vectors for expressing two genes simultaneously, especially when the eukaryotic expression of IL-12 is carried out, the application of IRES is more meaningful, because the molecular number of p40 and p35 double subunits is required for forming IL-12 with complete biological function, if p40 is over-expressed, free p40 forms p40 homodimer which is an inhibitor of IL-12, antagonizes the biological activity of IL-12 and regulates the cellular immunity of organisms, therefore, the eukaryotic expression of IL-12 by connecting IRES with p40 and p35 subunits in series can effectively obtain the recombinant IL-12 (Gaojun, 2004).

The invention relates to an Alpha Fetoprotein (AFP) which is a secretory protein mainly expressed in liver cancer cells, the invention utilizes the characteristic of the liver cancer specific expression AFP to construct a novel oncolytic virus Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GT-TAA which targets the infection and propagation of the liver cancer cells, the virus does not infect normal liver cells and other normal tissues, the targeted medication has the characteristics of high efficiency/strong specificity and the like, and the virus has the characteristics of increasing virus replication, regulating and increasing cell immunity and the like.

Oncolytic virus therapy is a novel tumor treatment that kills tumors by the selective infection of tumor cells with the virus. Oncolytic viruses are replication-competent tumor-killing viruses, but such viruses do not affect normal cells, and kill tumors primarily by stimulating a body's residual tumor-specific immune response. At present, oncolytic viruses are mainly divided into two categories, one category is viruses which have specific infection or killing capacity on tumor cells, such as reovirus, newcastle disease virus and the like; the other is a virus which is artificially modified, has specific killing capacity to tumors and can replicate in the tumors, such as adenovirus, herpes simplex virus, influenza virus, human vaccinia virus and the like.

Oncolytic Viruses (OVs) selectively replicate and kill cancer cells and spread within tumors without damaging normal tissues. In addition to this direct oncolytic activity, OVs are also very effective in inducing immune responses both to themselves and to infected tumor cells. OVs comprise a wide diversity of DNA and RNA viruses that are naturally cancer selective or can be genetically engineered. OVs provide a diverse platform for immunotherapy; they act as in situ vaccines, which can be armed with immunomodulatory genes and used in combination with other immunotherapies.

Dynamic development at home and abroad: currently, 3 oncolytic virus products are approved to be marketed, T-vec (Talimogelaherparepvec, Imlygic) is the only oncolytic virus product approved by FDA to be marketed at present, is derived from HSV-1 virus, is modified to delete two genes of ICP34.5 and ICP47, the former can inhibit translation of cell proteins, and the latter can inhibit antigen presentation, and is approved to be marketed for treatment of advanced melanoma 10 months in 2015. Ragova, approved in 2004, for the treatment of various cancers, with about 75% of melanoma patients receiving raggalir therapy; the first approved oncolytic virus product H101 in 2005 was mainly used for treating primary focus, late clinical stage and recurrent head and neck tumors. At present, products of OVs entering evaluation stages such as clinical I/II and the like include Pexa-Vec for treating liver cancer and colorectal cancer, TG6002/5-FC combined treatment for glioma, LOAd703 for treating pancreatic cancer and the like.

Pexa-Vec (JX-594) is an oncolytic vaccinia virus expressing GM-CSF that has been tested in randomized phase II in hepatocellular carcinoma (HCC) patients. Anti-cancer immunity of JX-594 occurs after replication of JX-594 and expression of GM-CSF. Currently, CFDA approved JX-594 for the treatment of advanced liver cancer, the large lees pharmaceutical factory has conducted a global clinical three-phase study, which will be conducted in north america, asia, australia, europe, and china. In addition, in 5 months 2017, FDA granted the product Reolysin from oncoytics biotech, usa, a rapid channel certification for intravenous oncolytic virus in metastatic melanoma patients. Toca511 is an injectable retroviral vector, and Toca FC is an under-developed extended release 5-FU drug. The FDA has granted a breakthrough therapy for the combination of Toca511 and Toca FC for the treatment of high-grade gliomas. Recruitment of phase II clinical patients is currently completed. DNAsrix is discussing the efficiency and safety assessment of DNX-2401 with Merck Cooperation for anti-PD-1 treatment in combination with pembrolizumab.

The application prospect is as follows: oncolytic viruses can overcome the barriers of tumor cells by expressing immune checkpoint inhibitors, tumor antigens, cytokines, and T cell adaptors themselves, and inhibit tumor development. Oncolytic viruses have been widely recognized as a new therapeutic for synergistic anti-cancer, and many oncolytic virus products have entered the clinical stage.

Oncolytic viruses have many characteristics that make them advantageous and distinct from current therapeutic modalities: (i) the potential for drug resistance is low (to date not seen) because OVs are usually targeted to multiple oncogenic pathways and are cytotoxic in a variety of ways; (ii) they replicate in a tumor-selective manner, are nonpathogenic, and detect only minimal systemic toxicity; (iii) due to in situ viral amplification, viral dose in tumors increases over time, whereas traditional drug pharmacokinetics decrease over time; (iv) safety functions such as medication and immune sensitivity may be built in. These characteristics lead to a high therapeutic index.

For example, in application No. 20180904522.2, published as 2019, month 01 and 08, the invention is named as "a novel oncolytic virus for selectively killing hepatoma cells and a construction method thereof", and the invention is a Chinese patent application, wherein an ICP4 gene promoter on a genome of a type I herpes simplex virus 17+ strain is replaced by a hepatoma specific promoter, an ICP34.5 gene on the genome of the type I herpes simplex virus 17+ strain is removed and an IL-12 expression sequence is inserted, so that high-selectivity propagation in hepatoma cells is realized, normal tissue cells are ensured not to be infected by the virus, and meanwhile, the IL-12 expression sequence is inserted to enhance the immunoregulation function of the novel oncolytic virus HSVAFP + IL-12, so that damaged hepatoma cells are completely removed by immune cells of an organism to obtain the HSVAFP + IL-12. However, the present invention does not consider the necessity of IL-12 bi-subunit and cistron, and the promotion of viral replication to oncolytic tumor.

The invention content is as follows:

in order to solve the problems of the background art, the invention aims to provide a virus construct containing IL12 bicistron for treating liver cancer, and application and a construction method thereof. The invention also provides a novel oncolytic virus for individualized targeted therapy of liver cancer and a construction method thereof.

The invention discloses a construction method of a novel oncolytic virus for individualized targeted therapy of liver cancer, which comprises the steps of replacing a CMV promoter on adenovirus PDC316 with a liver cancer specific promoter, connecting RGD-4C for increasing virus replication and a gene IL-12 (a double subunit p40 and a gene p35 are connected through a cistron IRES) for enhancing cell immune regulation effect to an adenovirus expression vector through cloning, and obtaining Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}. The invention provides a construction method of a novel oncolytic virus for individualized targeted therapy of liver cancer, and the novel virus Adv-Ade^{AFP+RGD-4C+p40-IRES-p35-GT-TAA}The AFP promoter is adopted to realize high-selectivity propagation in liver cancer cells, so that the virus is ensured not to infect normal tissue cells; the simultaneous insertion of RGD-4C for increasing virus replication and IL-12-p40-IRES-IL-12-p35 gene for enhancing cell immunoregulation action ensures efficient and selective replication and killing of cancer cells without damaging normal tissues and spread in tumors. Finally, the individual liver cancer population is treated in a targeted manner by combining a molecular diagnosis technology and an oncolytic virus technology, so that the establishment of an oncolytic virus individual customized service system is realized.

In one aspect, the application relates to a viral construct for treating liver cancer comprising in operable linkage an AFP promoter, an RGD-4C gene, an IL-12-p40 gene, an IRES gene, and an IL-12-p35 gene. In one aspect, the AFP promoter comprises or consists of the nucleotide sequence of SEQ ID No. 1. In one aspect, the RGD-4C gene comprises or consists of the nucleotide sequence of SEQ ID No. 6. In one aspect, the IL-12-p40 gene comprises or consists of the nucleotide sequence of SEQ ID No. 3. In one aspect, the IRES gene comprises or consists of the nucleotide sequence of SEQ ID No. 2. In one aspect, the IL-12-p35 gene comprises or consists of the nucleotide sequence of SEQ ID No. 4. In one aspect, the viral construct may further comprise a glutamyl transpeptidase gene and a tumor-associated antigen gene.

In one aspect, the present application relates to a viral construct for the treatment of liver cancer comprising in operative linkage (a) an AFP promoter having the nucleotide sequence shown in SEQ ID No.1, (b) an RGD-4C gene having the nucleotide sequence shown in SEQ ID No.6, (C) an IL-12-p40 gene having the nucleotide sequence shown in SEQ ID No.3, (d) an IRES gene having the nucleotide sequence shown in SEQ ID No.2, and (e) an IL-12-p35 gene having the nucleotide sequence shown in SEQ ID No. 4. In one aspect, the viral construct may further comprise (f) a glutamyl transpeptidase gene and a tumor-associated antigen gene.

"construct" as used herein refers to a nucleic acid molecule comprising one or more nucleotide sequences or nucleic acid fragments capable of performing the corresponding function. For example, the construct may comprise a promoter, a viral replication gene or genes that promote viral replication, and an oncolytic gene or genes that enhance somatic immune regulation. For example, the promoter can be an AFP promoter. The viral replication gene or the gene promoting viral replication may be the RGD-4C gene. The oncolytic gene or gene that enhances immune regulation in somatic cells can be an IL-12 gene, such as IL genes with the bi-subunits p40 and p35 linked by a cistron IRES. In one aspect, the constructs of the invention may be in the form of vectors, such as viral vectors or plasmids. The form of the nucleic acid constructs can be determined by the person skilled in the art as long as they fulfill the desired function of the respective nucleic acid fragment in the target cell, for example a tumor cell. In one aspect, the constructs described herein can be viral expression vectors, such as adenoviral expression vectors.

As used herein, "operably linked" refers to the joining together or joining of two or more nucleic acid fragments into a nucleic acid construct such that each performs a corresponding function. In this context, "operatively connected" may also be abbreviated as "connected". These "nucleic acid fragments" may also be referred to as "nucleic acid components" or "components". For example, a promoter, a gene that increases viral replication, and an oncolytic gene that activates cellular immunity are "operably linked", and the promoter can drive the transcription of the latter two genes, thereby realizing the expression of the gene-encoded protein in the cell and realizing the corresponding functions. It is understood by those skilled in the art that after multiple nucleic acid fragments are operably linked, their respective functions should not be disrupted, or even not impaired. Preferably, the function of the other native nucleic acid fragments is not affected or disrupted after effective ligation. In one example, each step in the methods of the invention embodies the means by which the nucleic acid fragments or components described above are operably linked. In one example, the individual nucleic acid fragments are linked by phosphodiester linkages.

Glutamyl Transpeptidase (GT) is a liver enzyme that transports glutathione and amino acids into cells and influences glutathione metabolism. Tumor-associated antigen (TAA) may refer to antigenic material that is newly present or overexpressed in the process of tumor development, progression. Tumor-associated antigens may include antigens that are not specific for tumor cells, are also present on normal cells and other tissues, except in amounts that are significantly increased when cells become cancerous. The glutamyltranspeptidase gene and the tumor associated antigen gene (GT-TAA) which are effectively connected attract Antigen Presenting Cells (APC) for antigen delivery of membrane antigen expression, and act as a target recognition point of liver cancer.

In one aspect, the viral construct is an adenoviral construct. For example, the adenoviral construct may be derived from the adenoviral vector PDC 316. In one aspect, the virus described herein can be an adenovirus. The virus of the invention may comprise a viral construct of the invention.

In one aspect, the constructs described herein are nucleic acid constructs. The nucleic acid may be DNA or RNA. For example, the construct of the invention may be a DNA construct.

In one aspect, the viral construct comprises, in a5 'to 3' orientation, an AFP promoter, an RGD-4C gene, an IL-12-p40 gene, an IRES gene, and an IL-12-p35 gene, and optionally a glutamyltranspeptidase gene and a tumor-associated antigen gene. The viral construct comprises in the 5 'to 3' direction the components (a), (b), (c), (d), (e) and optionally (f). In one aspect the viral construct comprises these genes or components in the direction of transcription. In one aspect the viral construct comprises these genes or modules in the sense strand orientation.

In one aspect, a virus of the invention, such as an adenovirus, can comprise a construct of the invention.

In one aspect, the present application relates to the use of a viral construct of the invention in the manufacture of a medicament for the treatment of cancer in a patient. In one aspect, the application also relates to the use of a virus of the invention in the manufacture of a medicament for the treatment of cancer in a patient. The cancer may be liver cancer, such as hepatocellular carcinoma. The viral construct or virus may also be used in the manufacture of a medicament for inhibiting the growth of a tumor, reducing the volume of a tumor, or eliminating a tumor in a patient. The tumor may be a liver tumor.

In addition, the virus of the invention is a novel oncolytic virus for individualized targeted therapy of liver cancer.

In one aspect, the patient described herein is a human.

In one aspect, the present application relates to a method of constructing a viral construct or a virus containing the construct, comprising the steps of:

operably linking the RGD-4C gene which increases viral replication and the IL-12-p40 gene, IRES gene and IL-12-p35 gene which enhance cellular immunoregulatory effects, to an adenovirus expression vector, and

replacing the CMV promoter on the adenovirus vector with a liver cancer promoter AFP promoter,

thereby constructing an oncolytic virus expression vector Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}。

In one aspect, the above method further comprises linking the glutamyl transpeptidase gene and the tumor-associated antigen gene to Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Thereby constructing Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GT-TAA plasmid.

The method of constructing the constructs of the invention may be carried out in any suitable order, for example according to the written sequential order.

In one aspect, the present application relates to a method of constructing a viral construct of the invention, comprising the steps of:

constructing Ade-PDC316-CMV-IRES plasmid: designing a forward amplification primer containing EcoRI-IRES-F and a reverse amplification primer of Hind III-IRES-R, introducing IRES gene fragments with EcoRI and Hind III enzyme cutting sites from PSMPPUW-IRES-GFP amplification, using EcoRI/Hind III enzyme cutting IRES gene fragments and an Ade-PDC316 vector, and constructing a plasmid Ade-PDC316-CMV-IRES after connection;

construction of Ade-PDC316-CMV-IL-12-p40-IRES plasmid: designing a forward amplification primer containing EcoRI-IL-12-p 40-F and an directional amplification primer containing EcoRI-IL-12-p 40-R, amplifying an IL-12-p40 target gene of EcoRI containing an enzyme cutting site from cDNA of an NK cell, then respectively using the IL-12-p40 target gene of EcoRI and an Ade-PDC316-CMV-IRES vector which are singly cut by the EcoRI, and constructing a plasmid Ade-PDC316-CMV-IL-12-p40-IRES after connecting a verification sequence;

construction of Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35 plasmid: designing a forward amplification primer containing Hind III-IL-12-p 35-F and a reverse amplification primer containing Hind III-IL-12-p 35-R, amplifying an IL-12-p35 target gene containing Hind III with enzyme cutting sites from cDNA of NK cells, then singly cutting the IL-12-p35 target gene and an Ade-PDC316-CMV-IL-12-p40-IRES vector by using Hind III respectively, and constructing a plasmid Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35 after connecting and verifying the sequence;

constructing Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35 plasmid: designing a forward amplification primer of EcoRI-RGD-4C-IL-12-p 40-F containing RGD-4C sequence, using the forward amplification primer and a reverse amplification primer of Hind III-IL-12-p 35-R, using Ade-PDC316-CMV-RGD-4C IL-12-p40-IRES-IL-12-p35 as a template to amplify and introduce RGD-4C target gene, using EcoRI/Hind III to cut RGD-4C-IL-12-p40-IRES-IL-12-p35 target gene and a vector Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35 after amplification, and constructing a plasmid Ade-CMV-316-CMV-4C-RGD-12-IL-12-p 353584 after connection p40-IRES-IL-12-p 35; and

construction of Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 plasmid construction of plasmid Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 by synthesizing a human AFP promoter with Xba I and EcoRI cleavage sites, and by using Xba I/EcoRI cleavage of the AFP gene fragment and Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 vector, replacing the CMV promoter with the human AFP promoter, preferably after ligation using T4 DNA ligase^{AFP+RGD-4C+IL-12-p40-IRES-IL-12-p35}。

In one aspect, the above method further comprises linking the glutamyl transpeptidase gene and the tumor-associated antigen gene to Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Thus, Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GT-TAA plasmid was constructed.

In one aspect, the method of constructing the viral constructs of the present invention may further comprise the step of constructing in parallel various corresponding vectors comprising the GFP gene. Such steps are to facilitate the detection of the expression of various embedded genes.

For example, the method of constructing the viral construct of the present invention may further comprise the steps of:

constructing Ade-PDC316-CMV-GFP plasmid: designing a forward amplification primer containing HindIII-GFP and a reverse amplification primer containing SalI-GFP, amplifying a GFP target gene with HindIII/SalI double enzyme cutting sites from PSMPuW-GFP, and connecting an Ade-PDC316-CMV vector by using HindIII/SalI double enzyme cutting to obtain a plasmid Ade-PDC 316-CMV-GFP;

the Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35-GFP plasmid was constructed: Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35 and Ade-PDC316-CMV-GFP vectors are digested by EcoRI/Hind III, and plasmids Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35-GFP are constructed after ligation;

constructing Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP plasmid, namely digesting the vector Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35 and the vector Ade-PDC316-CMV-GFP by using EcoRI/Hind III, and constructing the plasmid Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP after connection; and/or

Construction of Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP plasmidHuman AFP promoter of EcoRI cleavage site, Xba I/EcoRI cleavage of AFP gene fragment and Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP vector, replacement of CMV promoter with human AFP promoter, preferably ligation using T4 DNA ligase, construction of plasmid Ade^{AFP+RGD-4C+IL-12-p40-IRES-IL-12-p35+GFP}。

The application also discloses a construction method of the oncolytic virus for individualized targeted therapy of liver cancer, and the oncolytic virus comprises the virus construct.

In one aspect, the invention discloses a construction method of a novel oncolytic virus for individualized targeted therapy of liver cancer, which comprises the following steps:

optionally (1) constructing Ade-PDC316-CMV-GFP plasmid: designing a forward amplification primer containing HindIII-GFP and a reverse amplification primer containing SalI-GFP, amplifying a GFP target gene with HindIII/SalI double enzyme cutting sites from PSMPuW-GFP, and connecting an Ade-PDC316-CMV vector by using HindIII/SalI double enzyme cutting to obtain a plasmid Ade-PDC 316-CMV-GFP;

(2) constructing Ade-PDC316-CMV-IRES plasmid: designing a forward amplification primer containing EcoRI-IRES-F and a reverse amplification primer of Hind III-IRES-R, introducing IRES gene fragments with EcoRI and Hind III enzyme cutting sites from PSMPPUW-IRES-GFP amplification, using EcoRI/Hind III enzyme cutting IRES gene fragments and an Ade-PDC316 vector, and constructing a plasmid Ade-PDC316-CMV-IRES after connection;

(3) construction of Ade-PDC316-CMV-IL-12-p40-IRES plasmid: designing a forward amplification primer containing EcoRI-IL-12-p 40-F and an directional amplification primer containing EcoRI-IL-12-p 40-R, amplifying an IL-12-p40 target gene of EcoRI containing an enzyme cutting site from cDNA of an NK cell, then respectively using the IL-12-p40 target gene of EcoRI and an Ade-PDC316-CMV-IRES vector which are singly cut by the EcoRI, and constructing a plasmid Ade-PDC316-CMV-IL-12-p40-IRES after connecting a verification sequence;

(4) construction of Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35 plasmid: designing a forward amplification primer containing Hind III-IL-12-p 35-F and a reverse amplification primer containing Hind III-IL-12-p 35-R, amplifying an IL-12-p35 target gene containing Hind III with enzyme cutting sites from cDNA of NK cells, then singly cutting the IL-12-p35 target gene and an Ade-PDC316-CMV-IL-12-p40-IRES vector by using Hind III respectively, and constructing a plasmid Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35 after connecting and verifying the sequence;

optionally (5) constructing Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35-GFP plasmid: Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35 and Ade-PDC316-CMV-GFP vectors are digested by EcoRI/Hind III, and plasmids Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35-GFP are constructed after ligation;

(6) constructing Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35 plasmid: designing a forward amplification primer of EcoRI-RGD-4C-IL-12-p 40-F containing RGD-4C sequence, using the forward amplification primer and a reverse amplification primer of Hind III-IL-12-p 35-R, using Ade-PDC316-CMV-RGD-4C IL-12-p40-IRES-IL-12-p35 as a template to amplify and introduce RGD-4C target gene, using EcoRI/Hind III to cleave the RGD-4C-IL-12-p40-IRES-IL-12-p35 target gene and a vector Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35 after amplification, and constructing a plasmid Ade-CMV-316-CMV-RGD-4C-IL-12-p 40 after ligation -IRES-IL-12-p 35;

optionally (7) constructing Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP plasmid by digesting the vector Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35 and the vector Ade-PDC316-CMV-GFP with EcoRI/Hind III, and constructing the plasmid Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP after ligation;

(8) constructing Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 plasmid, synthesizing human AFP promoter with Xba I and EcoRI enzyme cutting sites, cutting AFP gene segment and Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 vector by Xba I/EcoRI enzyme cutting, replacing CMV promoter by human AFP promoter, preferably connecting by T4 DNA ligase, and constructing plasmid Ade-PDC316-AFP + RGD-4C + IL-12-p40-IRES-IL-12-p 35;

optionally (9) constructing Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP plasmid by synthesizing a human-derived AFP promoter with XbaI and EcoRI cleavage sites, cleaving the AFP gene fragment and Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP vector with XbaI/EcoRI, replacing the CMV promoter with a human-derived AFP promoter, preferably ligating with T4 DNA ligase, and constructing plasmid Ade AFP + RGD-4C + IL-12-p40-IRES-IL-12-p35+ GFP; and

optionally (10) the glutamyltranspeptidase gene and the tumor-associated antigen gene are ligated to Adv-Ade^AFP ^{+RGD-4C+p40-IRES-p35}Thus, Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GT-TAA plasmid was constructed.

In the above technical scheme, in step (1), the sequences of the forward amplimer of Hind iii-GFP and the reverse amplimer of sali-GFP are as follows:

HindⅢ-GFP-F-p：CCCAAGCTTATGGTGAGCAAGGGCGAGGAGC

SalⅠ-GFP-R-p:ACGC GTCGACTTACTTGTACAGCTCGTCCATG。

in the technical scheme, the RGD-4C-IL-12-p40-IRES-IL-12-p35 target gene obtained by using the following primers in the step (6),

EcoRI-RGD-4C-IL-12-p 40-IRES-IL-12-p35 forward amplification primer, and Hind III-RGD-4C-IL-12-p 40-IRES-IL-12-p35 reverse amplification primer, whose sequences are as follows:

EcoRⅠ-RGD-4C-IL-12-p40-IRES-IL-12-p35-F:CCG GAATTC TGTGACTGCCGCGGAGACTG TTTCTGC GAGAGACTCGAGCAAGATGTGTCACCAGCAG

HindⅢ-RGD-4C-IL-12-p40-IRES-IL-12-p35-R:CCC AAGCTTGAGAGAGTCGACAACGGTTTGGAGGGA。

in the above technical scheme, in each step of the method of the present invention, all newly constructed plasmids or vectors are obtained by selecting single colonies through transformation, extracting plasmid clones, and sequencing.

In the technical scheme, the liver cancer specific promoter is an AFP promoter.

In the technical scheme, the construction method is a construction method of a novel oncolytic virus for individualized targeted therapy of liver cancer.

In the technical scheme, GT-TAA is introduced by primer design and amplification according to different liver cancer types.

Compared with the prior art, the invention has the beneficial effects that:

replacing CMV promoter on adenovirus vector with hepatocarcinoma promoter, and adding virusThe RGD-4C gene and the gene fragment IL-12-p40-IRES-IL-12-p35 for increasing the cell immunoregulation to cause the tumor lysis are connected to an adenovirus expression vector with a liver cancer promoter to construct a novel tumor-dissolving virus expression vector Adv-Ade^AFP ^{+RGD-4C+p40-IRES-p35}。

Almost all liver cancer cells can express AFP, so the AFP promoter can ensure Adv-Ade^AFP ^{+RGD-4C+p40-IRES-p35}Selectively propagate in liver cancer cells. The virus does not infect normal liver cells and other normal tissues, is used in a targeted mode, has the characteristics of high efficiency/strong specificity and the like, can enhance the replication capacity of the virus by inserting an RGD-4C expression sequence, and can increase the introduction of immunoregulation IL-12-p40-IRES-IL-12-p35 to ensure that damaged liver cancer cells are thoroughly and cleanly removed by immune cells of an organism.

Description of the drawings:

FIG. 1 shows recombinant adenopathy Adv-Ade of the present invention^{AFP+RGD-4C+p40-IRES-p35}Schematic representation of (a).

FIG. 2 shows Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Bar graph of the ability to selectively inhibit the survival of hepatoma cells HepG 2.

FIG. 3 shows Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Bar graph of the ability to selectively inhibit the clonogenic potential of hepatoma cells HepG 2.

FIG. 4 shows Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Bar graph of the ability to selectively inhibit migration of hepatoma cell HepG 2.

FIG. 5 shows Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Bar graph of the ability to selectively inhibit the invasion of hepatoma cell HepG 2.

The specific implementation mode is as follows:

in order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the following description further explains how the invention is implemented by combining the attached drawings and the specific implementation method.

Examples

Example 1 construction of viral constructs

The restriction enzymes HindIII/SalI/EcoRI/XbaI of the invention were purchased from New England Biolabs; PCR amplification reagent, cDNA synthesis kit purchased from TARAKA BAOri doctor technology (Beijing) GmbH; endotoxin-free plasmid extraction kits DP117, DP118 were purchased from Tiangen (TIANGN) Biochemical technology (Beijing) Ltd; pBHGlox _ E1,3Cre recombinant adenovirus skeleton vector and pDC316 adenovirus vector are purchased from Changsha Youbao organism; IRES, IL12-P40, IL12-P35, RGD-4C-IL 12-P40-IRES-IL 12-P35 and AFP fragments and all amplification primers were synthesized in Sangon Biotech (Shanghai); DNA recovery kits were purchased from Promega; NK cells and PSMPOW-IRES-GFP were both stored and prepared in the company's laboratory.

The invention discloses a construction method of a novel oncolytic virus for individualized targeted therapy of liver cancer, which comprises the following steps:

the method comprises the following steps: constructing Ade-PDC316-CMV-GFP plasmid: in order to facilitate the detection of the expression conditions of various embedded genes, various vectors containing GFP genes are constructed in parallel, a forward amplification primer containing HindIII-GFP and a reverse amplification primer containing SalI-GFP are designed, a GFP target gene with HindIII/SalI double digestion sites is amplified from PSMPuW-GFP (stored in laboratories), and a HindIII/SalI double digestion Ade-PDC316-CMV vector is used for connection to obtain a new plasmid Ade-PDC 316-CMV-GFP.

Step two: : constructing Ade-PDC316-CMV-IRES plasmid: a forward amplification primer containing EcoRI-IRES-F and a reverse amplification primer containing Hind III-IRES-R are designed, IRES gene fragments with EcoRI and Hind III cleavage sites are introduced from PSMPuW-IRES-GFP (laboratory preservation) amplification, and the IRES gene fragments and an Ade-PDC316 vector are cleaved with EcoRI/Hind III, and ligated to construct a new plasmid Ade-PDC 316-CMV-IRES.

Step three: construction of Ade-PDC316-CMV-IL-12-p40-IRES plasmid: designing a forward amplification primer containing EcoRI-IL-12-p 40-F and a reverse amplification primer containing EcoRI-IL-12-p 40-R, amplifying an IL-12-p40 target gene containing EcoRI with an enzyme cutting site from cDNA of an NK cell, then respectively using the IL-12-p40 target gene of EcoRI and an Ade-PDC316-CMV-IRES vector which are singly cut by the EcoRI, and connecting a verification sequence to construct a new plasmid Ade-PDC316-CMV-IL-12-p 40-IRES.

Step four: construction of Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35 plasmid: designing a forward amplification primer containing Hind III-IL-12-p 35-F and an directional amplification primer of Hind III-IL-12-p 35-R, amplifying an Hin III IL-12-p35 target gene containing a restriction site from NK cell cDNA, then singly digesting the IL-12-p35 target gene and an Ade-PDC316-CMV-IL-12-p40-IRES vector by using Hind III respectively, and constructing a new plasmid Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35 after connecting and verifying the sequence.

Step five: the Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35-GFP plasmid was constructed: Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p35 and Ade-PDC316-CMV-GFP vectors were digested with EcoRI/Hind III, ligated to construct a new plasmid Ade-PDC316-CMV-IL-12-p40-IRES-IL-12-p 35-GFP.

Step six: constructing Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35 plasmid: designing a forward amplification primer of EcoRI-RGD-4C-IL-12-p 40-F containing RGD-4C sequence, using the forward amplification primer and a reverse amplification primer of Hind III-IL-12-p 35-R, using Ade-PDC316-CMV-RGD-4C IL-12-p40-IRES-IL-12-p35 as a template to amplify and introduce a new target gene of RGD-4C, using EcoRI/Hind III to cut the target gene of RGD-4C-IL-12-p40-IRES-IL-12-p35 and a vector Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35 after amplification, and constructing a new plasmid Ade-CMV-316-RGD-4C-IL-12-p 35 after connection p40-IRES-IL-12-p 35.

Step seven: Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP plasmid was constructed by digesting the vector Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35 and the vector Ade-PDC316-CMV-GFP with EcoRI/Hind III, ligating them to construct a novel plasmid Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p 35-GFP.

Step eight: construction of Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 plasmid A novel plasmid Ade AFP + RGD-4C + IL-12-p40-IRES-IL-12-p35 was constructed by synthesizing a human AFP promoter with XbaI and EcoRI cleavage sites, cleaving the AFP gene fragment and Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 vector with XbaI/EcoRI, replacing the CMV promoter with the human AFP promoter, and ligating with T4 DNA ligase.

Step nine: construction of Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP plasmid A human AFP promoter with XbaI and EcoRI cleavage sites was synthesized, and the AFP gene fragment and Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP vector were cleaved with XbaI/EcoRI, using the human AFP promoter to replace the CMV promoter, and after T4 DNA ligase ligation, a new plasmid was constructed, Ade AFP + RGD-4C + IL-12-p40-IRES-IL-12-p35+ GFP.

Step ten: the Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GT-TAA plasmid is customized individually, and corresponding specific antigens can be found out by combining molecular diagnosis in the later stage to make individual customization. For example, an Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 plasmid was constructed by ligating a glutamyl transpeptidase gene and a tumor-associated antigen gene to the Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p 35. Finally, the GT-TAA is introduced by primer design and amplification according to different liver cancer types.

In the above experimental procedure, the sequences of the HindIII-GFP forward amplification primer and the SalI-GFP reverse amplification primer obtained in the first step are as follows:

HindⅢ-GFP-F-p：CCCAAGCTTATGGTGAGCAAGGGCGAGGAGC

SalⅠ-GFP-R-p:ACGC GTCGACTTACTTGTACAGCTCGTCCATG。

in the RGD-4C-IL-12-p40-IRES-IL-12-p35 target gene in step six of the above experimental process,

the sequences of EcoRI-RGD-4C-IL-12-p 40-IRES-IL-12-p35 forward amplification primer, and Hind III-RGD-4C-IL-12-p 40-IRES-IL-12-p35 reverse amplification primer are as follows:

TABLE 1 primers for construction of plasmid Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GT-TAA

Note: the genomic sequence is indicated in bold, the restriction sites used in plasmid construction are underlined, and the unlabeled bases are the protecting bases for the cleavage sites.

In the invention, all newly constructed plasmids in the steps from the first step to the ninth step are obtained by transforming and picking single colonies, extracting plasmid clone and sequencing.

The invention also discloses a novel oncolytic virus for individualized targeted therapy of liver cancer, which adopts the following construction method: replacing CMV promoter on adenovirus vector with liver cancer promoter, connecting RGD-4C gene for increasing virus replication and gene fragment-IL-12-p 40-IRES-IL-12-p35 for increasing regulation and enhancing cell immunity to cause oncolytic to adenovirus expression vector with liver cancer promoter, and constructing novel oncolytic virus expression vector Adv-Ade^AFP ^{+RGD-4C+p40-IRES-p35-GT-TAA}. Wherein the liver cancer specific promoter is an AFP promoter; as shown in fig. 1.

In the invention, the construction method is the construction method in the construction method of the novel oncolytic virus for individualized targeted therapy of liver cancer.

Example 2 verification of oncolytic Effect

In the present invention, a novel oncolytic virus Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Has selective inhibition effect on liver cancer cells, does not infect normal liver cells, and has low infection rate in other tumor cells.

MTT assay

MTT is a good method to reflect the viability of cells. The invention uses MTT to detect (0, 0.001, 0.01, 0.1, 1 Adv-Ade) under different virus titers^{AFP+RGD-4C+p40-IRES-p35}The effect on the survival ability of hepatoma cells HepG2 and normal cells HL7702 shows that the novel virus Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Can remarkably inhibit the survival ability of liver cancer cell HepG2, has no influence on the survival ability of normal liver cell HL7702 (see figure 2)

2. Plate clone formation experiment

Clonality is a unique property of malignant cells. The plate clone formation experiment can well reflect the clone formation ability of tumor cellsForce. The invention uses plate clone formation experiment to detect Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}The influence on the clone forming capability of liver cancer cells HepG2 and normal liver cells HL7702, and the discovery shows that the novel oncolytic virus Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Can obviously inhibit the clonogenic capacity of hepatoma cell HepG2, and has no influence on the clonogenic capacity of normal hepatoma cell HL7702 (see figure 3).

Transwell cell migration experiment

The ability to migrate is a characteristic of malignant tumors, reflecting the metastatic ability of tumors. Transwell cell migration assays were able to detect this migration ability. The invention uses a Transwell cell migration experiment to detect Adv-Ade^AFP ^{+RGD-4C+p40-IRES-p35}The influence on the migration capacity of liver cancer cells HepG2 and normal liver cells HL7702, and the discovery of the novel oncolytic virus Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Can obviously inhibit the migration ability of the liver cancer cell HepG2, and has no influence on the migration ability of the normal liver cell HL7702 (see figure 4).

Transwell cell invasion assay

Invasion is a unique characteristic of malignant tumors and the Transwell cell invasion assay can respond to this invasive capability. The invention uses a Transwell cell invasion experiment to detect Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}The influence on the invasion capacity of hepatoma cells HepG2 and normal hepatoma cells HL7702, and the discovery shows that the novel oncolytic virus Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Can obviously inhibit the invasion capacity of the liver cancer cell HepG2, and has no influence on the invasion capacity of the normal liver cell HL7702 (see figure 5).

The invention shows that the novel virus Adv-Ade provided by the invention is proved through MTT detection, plate clone formation experiment, Transwell cell migration experiment and Transwell cell invasion experiment^{AFP+RGD-4C+p40-IRES-p35}Has the capability of selectively inhibiting the survival, clone formation, migration and invasion of hepatoma cell HepG2, and shows that the Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}Can selectively kill liver cancer cells.

In the present invention, the AFP promoter sequence (SEQ ID NO. 1):

sequence of IRES in the present invention (SEQ ID NO. 2):

the sequence of IL12-P40 (SEQ ID NO.3) in the invention:

the sequence of IL12-P35 (SEQ ID NO.4) in the invention:

sequence of GFP in the invention (SEQ ID NO.5):

the sequence of RGD-4C (SEQ ID NO.6) in the present invention:

finally, the above embodiments are only intended to illustrate the technical solution of the present invention and not to limit the same, and although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that modifications or equivalent substitutions may be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention, which should be covered by the claims of the present invention.

Sequence listing

<110> Bingding (Beijing) International cell medicine technology Ltd

<120> virus construct containing IL12 bicistron for treating liver cancer, and application and construction method thereof

<141>2020-07-30

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>276

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

attctgtagt ttgaggagaa tatttgttat atttgcaaaa taaaataagt ttgcaagttt 60

tttttttctg ccccaaagag ctctgtgtcc ttgaacataa aatacaaata accgctctgc 120

tgttaattat tggcaaatgt cccattttca acctaaggaa ataccataaa gtaacagata 180

taccaacaaa aggttactag ttaacaggca ttgcctgaaa agagtataaa agaatttcag 240

catgattttc catattgtgc ttccaccact gccaat 276

<210>2

<211>625

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ctcgagggcc ggcgcgccgc ggccgctacg taaattccgc ccctctccct cccccccccc 60

taacgttact ggccgaagcc gcttggaata aggccggtgt gcgtttgtct atatgttatt 120

ttccaccata ttgccgtctt ttggcaatgt gagggcccgg aaacctggcc ctgtcttctt 180

gacgagcatt cctaggggtc tttcccctct cgccaaagga atgcaaggtc tgttgaatgt 240

cgtgaaggaa gcagttcctc tggaagcttc ttgaagacaa acaacgtctg tagcgaccct 300

ttgcaggcag cggaaccccc cacctggcga caggtgcctc tgcggccaaa agccacgtgt 360

ataagataca cctgcaaagg cggcacaacc ccagtgccac gttgtgagtt ggatagttgt 420

ggaaagagtc aaatggctct cctcaagcgt attcaacaag gggctgaagg atgcccagaa 480

ggtaccccat tgtatgggat ctgatctggg gcctcggtgc acatgcttta catgtgttta 540

gtcgaggtta aaaaacgtct aggccccccg aaccacgggg acgtggtttt cctttgaaaa 600

acacgatgat aatatggcca caacc 625

<210>3

<211>1036

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

agagcaagat gtgtcaccag cagttggtca tctcttggtt ttccctggtt tttctggcat 60

ctcccctcgt ggccatatgg gaactgaaga aagatgttta tgtcgtagaa ttggattggt 120

atccggatgc ccctggagaa atggtggtcc tcacctgtga cacccctgaa gaagatggta 180

tcacctggac cttggaccag agcagtgagg tcttaggctc tggcaaaacc ctgaccatcc 240

aagtcaaaga gtttggagat gctggccagt acacctgtca caaaggaggc gaggttctaa 300

gccattcgct cctgctgctt cacaaaaagg aagatggaat ttggtccact gatattttaa 360

aggaccagaa agaacccaaa aataagacct ttctaagatg cgaggccaag aattattctg 420

gacgtttcac ctgctggtgg ctgacgacaa tcagtactga tttgacattc agtgtcaaaa 480

gcagcagagg ctcttctgac ccccaagggg tgacgtgcgg agctgctaca ctctctgcag 540

agagagtcag aggggacaac aaggagtatg agtactcagt ggagtgccag gaggacagtg 600

cctgcccagc tgctgaggag agtctgccca ttgaggtcat ggtggatgcc gttcacaagc 660

tcaagtatga aaactacacc agcagcttct tcatcaggga catcatcaaa cctgacccac 720

ccaagaactt gcagctgaag ccattaaaga attctcggca ggtggaggtc agctgggagt 780

accctgacac ctggagtact ccacattcct acttctccct gacattctgc gttcaggtcc 840

agggcaagag caagagagaa aagaaagata gagtcttcac ggacaagacc tcagccacgg 900

tcatctgccg caaaaatgcc agcattagcg tgcgggccca ggaccgctac tatagctcat 960

cttggagcga atgggcatct gtgccctgca gttaggttct gatccaggat gaaaatttgg 1020

aggaaaagtg gaagat 1036

<210>4

<211>930

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

aagcaagaga ccagagtccc gggaaagtcc tgccgcgcct cgggacaatt ataaaaatgt 60

ggccccctgg gtcagcctcc cagccaccgc cctcacctgc cgcggccaca ggtctgcatc 120

cagcggctcg ccctgtgtcc ctgcagtgcc ggctcagcat gtgtccagcg cgcagcctcc 180

tccttgtggc taccctggtc ctcctggacc acctcagttt ggccagaaac ctccccgtgg 240

ccactccaga cccaggaatg ttcccatgcc ttcaccactc ccaaaacctg ctgagggccg 300

tcagcaacat gctccagaag gccagacaaa ctctagaatt ttacccttgc acttctgaag 360

agattgatca tgaagatatc acaaaagata aaaccagcac agtggaggcc tgtttaccat 420

tggaattaac caagaatgag agttgcctaa attccagaga gacctctttc ataactaatg 480

ggagttgcct ggcctccaga aagacctctt ttatgatggc cctgtgcctt agtagtattt 540

atgaagactt gaagatgtac caggtggagt tcaagaccat gaatgcaaag cttctgatgg 600

atcctaagag gcagatcttt ctagatcaaa acatgctggc agttattgat gagctgatgc 660

aggccctgaa tttcaacagt gagactgtgc cacaaaaatc ctcccttgaa gaaccggatt 720

tttataaaac taaaatcaag ctctgcatac ttcttcatgc tttcagaatt cgggcagtga 780

ctattgatag agtgatgagc tatctgaatg cttcctaaaa agcgaggtcc ctccaaaccg 840

ttgtcatttt tataaaactt tgaaatgagg aaactttgat aggatgtgga ttaagaacta 900

gggaggggga aagaaggatg ggactattac 930

<210>5

<211>720

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

<210>6

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tgtgactgcc gcggagactg tttctgc 27

Claims

1. A viral construct for the treatment of liver cancer comprising in operative association:

(a) AFP promoter with nucleotide sequence shown as SEQ ID NO.1,

(b) RGD-4C gene,

(c) IL-12-p40 gene with nucleotide sequence shown in SEQ ID NO.3,

(d) IRES gene having a nucleotide sequence shown in SEQ ID NO.2, and

(e) the nucleotide sequence of the IL-12-p35 gene is shown in SEQ ID NO. 4.

2. The virus construct according to claim 1, wherein the nucleotide sequence of (b) RGD-4C gene is shown in SEQ ID No. 6.

3. The viral construct of claim 1, which is an adenoviral construct.

4. The viral construct of claim 1, further comprising (f) a glutamyl transpeptidase gene and a tumor-associated antigen gene.

5. The viral construct according to any one of claims 1 to 4, comprising in 5 'to 3' direction the components (a), (b), (c), (d), (e) and optionally (f).

6. Use of the viral construct of any one of claims 1-5 in the manufacture of a medicament for treating cancer in a patient.

7. The use of claim 6, wherein the cancer is liver cancer, such as hepatocellular carcinoma.

8. A method of constructing the viral construct of any one of claims 1 to 5, comprising the steps of:

the RGD-4C gene for increasing virus replication and IL-12-p40 gene, IRES gene and IL-12-p35 gene for enhancing cell immunoregulation are effectively connected to adenovirus expression vector, and CMV promoter on adenovirus vector is replaced by liver cancer promoter AFP promoter, so as to construct oncolytic virus expression vector Adv-Ade^{AFP+RGD-4C+p40-IRES-p35}。

9. A method of constructing the viral construct of any one of claims 1 to 5, comprising the steps of:

(8) construction of Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 plasmid construction of plasmid Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 by synthesizing a human AFP promoter with Xba I and EcoRI cleavage sites, and by using Xba I/EcoRI cleavage of the AFP gene fragment and Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35 vector, replacing the CMV promoter with the human AFP promoter, preferably after ligation using T4 DNA ligase^{AFP+RGD-4C+IL-12-p40-IRES-IL-12-p35}；

Optionally (9) construction of Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP plasmid by synthesizing the human AFP promoter with XbaI and EcoRI cleavage sites and cleaving the AFP gene fragment and Ade-PDC316-CMV-RGD-4C-IL-12-p40-IRES-IL-12-p35-GFP vector, using a human AFP promoter instead of the CMV promoter, preferably ligated using T4 DNA ligase, to construct plasmid Ade^{AFP+RGD-4C+IL-12-p40-IRES-IL-12-p35+GFP}(ii) a And

optionally (10) linking the glutamyltranspeptidase gene and the tumor-associated antigen gene to Ade^AFP ^{+RGD-4C+IL-12-p40-IRES-IL-12-p35}Thus, Ade-PDC316-AFP-RGD-4C-IL-12-p40-IRES-IL-12-p35-GT-TAA plasmid was constructed.

10. The method of claim 9, wherein in step (1), the HindIII-GFP forward amplification primer and SalI-GFP reverse amplification primer sequences are as follows:

Hind Ⅲ-GFP-F-p：CCCAAGCTTATGGTGAGCAAGGGCGAGGAGC

Sal Ⅰ-GFP-R-p:ACGCGTCGACTTACTTGTACAGCTCGTCCATG。

11. the method of claim 9, wherein in step (6), the RGD-4C-IL-12-p40-IRES-IL-12-p35 target gene is obtained using the following primers:

EcoR Ⅰ-RGD-4C-IL-12-p40-IRES-IL-12-p35-F:CCG GAATTC TGTGACTGCCGCGGAGACTGTTTCTGC GAGAGACTCGAGCAAGATGTGTCACCAGCAG