CN111849976A - Promoter Wx of rice Wx geneb6And use thereof - Google Patents
Promoter Wx of rice Wx geneb6And use thereof Download PDFInfo
- Publication number
- CN111849976A CN111849976A CN202010072111.9A CN202010072111A CN111849976A CN 111849976 A CN111849976 A CN 111849976A CN 202010072111 A CN202010072111 A CN 202010072111A CN 111849976 A CN111849976 A CN 111849976A
- Authority
- CN
- China
- Prior art keywords
- rice
- promoter
- gene
- construct
- host cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a rice product suitable for riceWxPromoters for gene expressionWx b6 The promoterWx b6 The nucleotide sequence of (a) is shown as SEQ ID NO: 1 is shown. The promoterWx b6 Can be used as a promoter element for regulating riceWxThe gene expression can adjust the amylose content of the rice, improve the cooking taste quality of the rice, and ensure stable rice yield and good taste. The method is applied to the rice variety improvement and breeding work, and has important application value.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to a rice Wx basePromoter of factor Wxb6And the use thereof.
Background
Rice is one of the most important food crops in the world. High quality and high yield are two permanent topics for rice variety improvement. In recent decades, with the implementation of high-yield breeding, ultrahigh-yield breeding, super rice breeding, green super rice breeding and other programs, the rice yield is continuously improved and reaches 1152.3 kg/mu (2018 data). However, the research on the quality of rice is relatively delayed while the yield of rice is greatly improved. In contrast, with the increase of the consumption level of the public and the taste of life, the demand of high-quality rice is more and more increased.
Starch is the most main component in the endosperm of rice, accounts for about 80% of dry weight of grains and 90% of edible part of rice, and is one of the most main factors determining the quality of rice. The rice starch mainly comprises amylose and amylopectin. Among them, Amylose Content (AC) is generally considered to be the most important factor determining the quality of rice cooked food. The variety with lower AC can have very high PKV and disintegration value, is not easy to recover in the storage process and after cooking than high AC starch, can bring better palatability, and has better cooked taste quality. For example, the high quality taste soft rice "nan jing" series (including nan jing 46, nan jing 9108, etc.) AC is significantly lower than conventional indica and japonica rice varieties. The variety with higher AC has harder mouthfeel and poorer palatability, but is rich in resistant starch, is beneficial to preventing diseases such as type II diabetes, obesity and the like, and is healthier. The preference of rice AC for a population of people with different regional and cultural preferences is very different.
Disclosure of Invention
In order to overcome the problems in the prior art, the invention aims to provide a rice Wx gene promoter Wxb6And the use thereof.
In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:
The first aspect of the invention provides a promoter Wx suitable for rice Wx gene expressionb6The promoter Wxb6Nucleotide sequence of (A) such as SEQ ID NO: 1 is shown.
In a second aspect, the invention provides a construct comprising the aforementioned promoter Wxb6。
In a third aspect the invention provides a host cell comprising the aforementioned construct or having integrated into its genome the aforementioned promoter Wxb6。
In a fourth aspect of the present invention, there is provided the aforementioned promoter Wxb6The application of (1) is as follows: as a promoter element, the promoter element is used to start rice Wx gene expression.
In a fifth aspect, the invention provides the use of the aforementioned construct or host cell: and the promoter element is used for promoting the expression of the rice Wx gene.
In a sixth aspect, the present invention provides the aforementioned promoter Wxb6Or the construct of the foregoing, or the host cell of the foregoing for use in any one of:
a. adjusting the amylose content of the rice;
b. improving the quality of the rice;
c. and (5) breeding for improving the rice quality.
The seventh aspect of the invention provides a product for regulating the content of amylose in rice, and the effective substance of the product contains the promoter Wxb6Or a construct as described above, or a host cell as described above.
An eighth aspect of the present invention provides a method for modulating Wx gene expression or amylose content or improving rice quality, comprising the steps of: the method comprises the following steps:
in rice with SEQ ID NO: 1, the promoter Wxb6Promoting the expression of Wx gene.
Compared with the prior art, the invention has the following beneficial effects:
the promoter provided by the invention can regulate the amylose content of rice, improves the cooking taste quality of rice and has good taste. The method is applied to the rice variety improvement and breeding work, and has important application value.
Drawings
FIG. 1 is Wxb6Compared with the main sequence characteristics of other Wx promoters. A is a schematic diagram of a gene editing Wx gene core promoter vector; b is promoter Wxb6Sequencing peak patterns for specific fragments; c is Wxb6Alignment with specific promoter sequences of different Wx promoters.
FIG. 2 shows a graph containing a structural formula consisting of Wxb6Near isogenic line (Wx for short) with promoter for promoting rice Wx geneb1Material) and its recurrent parent Nipponbare (containing Wx)bAlleles, abbreviated as WxbMaterial) was compared. A to F are each Wxb6Comparison with Nipponbare (Wx)b) The plant height, thousand grain weight, seed setting rate, grain length, grain width and grain thickness are compared.
FIG. 3 is a comparison of Nipponbare control (Wx) b),Wxb6The expression of Wx gene in the material under the condition of normal sowing in summer. A-C are the expression of Wx gene precursor mRNA (Wx-Pre), mature mRNA (Wx-Mat) and total mRNA (Wx-Tot), respectively.
FIG. 4 shows Wx under different planting environmentsb6Amylose content in the material. A and B are Wx under conditions of Yangzhou in summer and Hainan in winter respectivelyb6Amylose content of (a).
Detailed Description
AC in rice endosperm is mainly synthesized by the catalysis of Granule-bound starch synthase (GBSSI) encoded by Waxy gene (wax, Wx). Extensive variation of the Wx gene is key to causing AC variation in different rice varieties. Allelic variation of the Wx gene has been fully exploited up to now, and at least 8 alleles have been published. In glutinous rice, wx causes premature transcription termination due to deletion of 23bp of exon 2, and AC is usually less than 2%. In non-waxy varieties, carry WxaThe rice of (1) is of high AC type (more than 25%), Wxg3Similarly thereto. WxinA-C variation occurring in exon 6 reduced AC to moderate levels (18% -22%). WxbMainly distributed in japonica rice varieties, with AC at moderate to low levels (15% -18%). In addition to the conventional alleles described above, there are 3 "soft rice genes", Wx mq、WxmpAnd WxopIs cloned to the cell surface of the cell to be cloned,its AC is around 10%. The difference in AC causes a significant difference in rice quality, especially in cooked taste quality, among different rice varieties. Creating more Wx or related genetic variation is an important method for regulating AC to meet the requirements of people in different areas and different cultures and improve the cooking taste quality of rice.
Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.
When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.
Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ conventional techniques in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA techniques, gene mutation techniques, and related fields.
The promoter Wx suitable for rice Wx gene expression in one embodiment of the inventionb6The promoter Wxb6The nucleotide sequence of (a) is shown as SEQ ID NO: 1 is shown.
Specifically, the method comprises the following steps: TACAAATAGC CACCCCTCTC ACCATTCC are provided.
Compared with the existing Wx in cultivated ricebAllele, Wxb6The promoter lacks 15 bases shown in SEQ ID NO. 2.
Specifically, ACACCACCAC CCCCT (SEQ ID NO. 2).
The construct of the present invention comprises the aforementioned promoter Wxb6. Capable of expressing the promoter Wxb6。
Further, the construct is selected from a viral vector or a plasmid vector.
The construction body of the invention is formed by combining the promoter Wxb6Cloning into a known vector which is mostly a plasmid vector, transferring the construct into a host cell to infect rice, and further starting the Wx gene.
The host cell of the invention, which comprises the aforementioned construct or integrates into the genome the aforementioned promoter Wx b6。
The host cell may be an engineered bacterium.
The aforementioned promoter Wxb6The application of (1) is as follows: as a promoter element, the promoter element is used to start rice Wx gene expression.
The use of the aforementioned construct or host cell is: and the promoter element is used for promoting the expression of the rice Wx gene.
The aforementioned promoter Wxb6Or the construct of the foregoing, or the host cell of the foregoing for use in any one of:
a. adjusting the amylose content of the rice;
b. improving the quality of the rice;
c. and (5) breeding for improving the rice quality.
The effective substance of the product for regulating the content of the amylose in the rice contains the promoter Wxb6And/or the aforementioned construct, and/or the aforementioned host cell.
The product can be a kit for adjusting the content of the amylose in the rice.
The method for regulating Wx gene expression or amylose content or improving rice quality comprises the following steps:
in rice with SEQ ID NO: 1 start-upSub Wxb6Promoting the expression of Wx gene.
In one embodiment, the following method may be employed:
1) construction of the promoter Wx Using the aforementioned constructsb6The recombinant expression vector of (1);
2) transfecting the recombinant expression vector obtained in step 1 into a host, and culturing the host under appropriate conditions.
In one embodiment, the rice Wx gene promoter can be edited by targeting a target sequence in the rice Wx gene promoter by the CRISPR system.
The nucleotide sequence of the target sequence is shown as SEQ ID NO. 3. The method specifically comprises the following steps: CCCACACCAC CACCCCCTCT are provided.
The gene editing technology represented by CRISPR/Cas9 is a popular genome site-directed editing technology. In rice, it has been proved that multiple target genes can be efficiently and conveniently edited in a fixed site. More difficult and more expensive, the target site and the T-DNA insertion site of the technology can be positioned on different chromosomes, so that the transgenic trace can be removed in the transgenic rice plant mediated by agrobacterium tumefaciens by a progeny screening method, the potential safety hazard possibly brought by the transgene can be eliminated, and the possibility is provided for the application and production practice of the transgenic rice plant. Therefore, the creation of a new Wx promoter by using a gene editing technology is an important method for regulating AC to meet the requirements of people in different areas and different cultures and improve the cooking taste and quality of rice.
Example 1: wxb6Creation, identification and rice quality analysis of
1. Rice material
Japonica rice (Oryza sativa subsp.
2. Construction of Gene editing vector
The gene editing method used in the research is the CRISPR/Csa9 system provided by the Wangchan project group of Rice institute of agricultural sciences. Selecting 20bp of TGG upstream on a Wx gene promoter fragment (the nucleotide sequence is shown as SEQ ID NO. 3) reverse complementary sequence as a target site; designing a target site into a reverse complementary primer and then connecting the reverse complementary primer into an intermediate vector SK-gRNA; the intermediate vector is digested, the gRNA fragment containing the target site is recovered and ligated into the final vector pC1300-Cas9, and after sequencing is correct, the recombinant vector is transferred into rice by Agrobacterium-mediated genetic transformation (Liu et al 1998).
3.Wxb6Identification and agronomic trait survey of
Wxb6And WxbCompared with the base difference of a specific sequence of a promoter. After genome DNA is rapidly extracted from rice leaves by a CTAB method, primers Wxpro Test-F and Wxpro Test-R are used for PCR amplification of a promoter Wxb6Sequence, Wx can be found by sequencingb6Compare Wxb15 bases were missing (FIG. 1A). The Wxb6The promoter fragment and the 25 bases deleted were highly conserved among the different Wx alleles (fig. 1B). The specific sequence of the primer is as follows:
Wxpro Test-F(SEQ ID No.4)CGGGTAAAATGTGTTGCGG
Wxpro Test-R(SEQ ID No.5)ACTTGCAGATGTTCTTCCTGATGA
the observation of the agricultural characters in the field shows that Wxb6The plant type, grain traits and the like of the plants are not significantly changed compared with the control (figure 2).
4. Containing promoter Wxb6Expression of Wx Gene in Rice
Taking out promoter Wx containing originalbThe control variety Nipponbare and the promoter Wxb6Immature seeds 10 days after plant blossoming are ground into powder after quick freezing by liquid nitrogen, total RNA is extracted by a plant total RNA extraction kit of Tiangen company, and the concentration and purity of the RNA are determined by Onedrop. Then, the cDNA was inverted with HiScript II 1st StrandcDNA Synthesis Kit from Vazyme in an amount of 1000ng of total RNA to obtain cDNA. Separately, Wx was determined by qRT-PCR using the same company's AceQ qPCR SYBR Green Master Mix, OsActin01 as endogenous reference genebControl and Wxb6Expression of Wx gene precursor mRNA, mature mRNA and total mRNA in plants. The results show that under normal seeding conditions in summer, Wx b6The expression of Wx gene precursor mRNA and total mRNA in the plant seed endosperm is obviously reduced, and the reduction rate is 49.99 percent and 37.61 percent respectively; expression of mature mRNA is more WxbA significant increase, with a growth rate of 11.40% (fig. 3).
The Wx gene precursor mRNA, mature mRNA and total mRNA used in qRT-PCR and the Action01 primers were:
Wx-Pre qRT-F(SEQ ID No.6)ATCTTTCATTGCTCGTTTTTCCTTA
Wx-Pre qRT-R(SEQ ID No.7)GCCTAACCAAACATAACGAACGA
Wx-Mat qRT-F(SEQ ID No.8)TCAAGACACAAATAACTGCAGTCTC
Wx-Mat qRT-R(SEQ ID No.9)ATGGTGGTTGTCTAGCTGTTGC
Wx-Tot qRT-F(SEQ ID No.10)CGTCATTCCTGGAGAAGGTTTG
Wx-Tot qRT-R(SEQ ID No.11)CAGACGAACACAACATCCTCACC
Actin01-F(SEQ ID No.12)CGTCATTCCTGGAGAAGGTTTG
Actin01-R(SEQ ID No.13)CAGACGAACACAACATCCTCACC
5. containing promoter Wxb6Determination of Amylose Content (AC) of Rice
Will contain Wx respectivelyb6And WxbThe allele-rich mature grains were husked (husked) with a huller (Model SY88-TH, Korea) and then milled into polished rice with a Kett polisher (Tokyo, Japan). The polished rice was pulverized by a FOSS cyclone mill (FOSS, Sweden), sieved in a 100-mesh sieve, placed in an oven at 40 ℃ for 3 days, placed at room temperature for 3 days, and sealed. The rice flour AC is measured by the rice flour pretreated according to the method of the ministerial standard NY 147-88. In the determination process, four standard samples provided by the Chinese rice research institute are selected to make a standard curve, and the amylose content of the standard curve is 1.5%, 10.4%, 16.2% and 26.5% respectively. The AC measurement result shows that the seed contains Wx under the normal seeding condition of Yangzhou in summerb6Comparison of Rice AC in allelic Rice seeds with existing Wx in cultivated RicebThe amylose content is 16.90 percent; under the sowing condition of lower temperature in Hainan in winter, the AC ratio of rice to Wx of rice bThe reduction was significant, with an amylose content of 12.28% (fig. 4).
In conclusion, Wx having the promoter sequence shown in SEQ ID No.1b6Is a new Wx promoter. Under the seeding condition of Yangzhou in summer, the promoter Wx is containedb6The expression of Wx gene precursor mRNA and total mRNA in rice seeds is obviously reduced, and the expression and the pair of mature mRNACorresponding Rice AC vs. WxbA significant increase; and under the sowing condition of Hainan in winter, the rice is compared with Wx by ACbThe significant reduction shows that the rice cooking taste quality can be significantly improved under the condition of stabilizing the rice yield.
Finally, it should also be noted that the above-mentioned list is only one specific embodiment of the invention. The promoter sequence has high conservation property between different Wx gene alleles and different rice varieties and has only one base difference, and obviously, the invention is not limited to the above embodiment and can have a plurality of variants. Materials with the same sequence obtained by editing related promoter sites in different rice varieties by using CRISPR/Cas and other gene editing technologies are considered to be the protection scope of the invention.
The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the methods and compositions set forth herein, as well as variations of the methods and compositions of the present invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.
Sequence listing
<110> Yangzhou university
<120> promoter Wxb6 of rice Wx gene and application thereof
<160>13
<170>SIPOSequenceListing 1.0
<210>1
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
tacaaatagc cacccctctc accattcc 28
<210>2
<211>15
<212>DNA
<213> Rice (Oryza sativa)
<400>2
<210>3
<211>20
<212>DNA
<213> Rice (Oryza sativa)
<400>3
<210>4
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cgggtaaaat gtgttgcgg 19
<210>5
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
acttgcagat gttcttcctg atga 24
<210>6
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
atctttcatt gctcgttttt cctta 25
<210>7
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
gcctaaccaa acataacgaa cga 23
<210>8
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
tcaagacaca aataactgca gtctc 25
<210>9
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
atggtggttg tctagctgtt gc 22
<210>10
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
cgtcattcct ggagaaggtt tg 22
<210>11
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
cagacgaaca caacatcctc acc 23
<210>12
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
cgtcattcct ggagaaggtt tg 22
<210>13
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
cagacgaaca caacatcctc acc 23
Claims (10)
1. Promoter Wx suitable for rice Wx gene expressionb6The promoter Wxb6The nucleotide sequence of (a) is shown as SEQ ID NO: 1 is shown.
2. A construct comprising the promoter Wx of claim 1b6。
3. The construct of claim 2, selected from a viral vector or a plasmid vector.
4. A host cell comprising the construct or genome of any one of claims 2 to 3 and incorporating into the genome the promoter Wx of any one of claim 1b6。
5. The host cell of claim 4, wherein the host cell is selected from the group consisting of engineered bacteria.
6. The promoter Wx of claim 1b6The application of (1) is as follows: as a promoter element, the promoter element is used to start rice Wx gene expression.
7. The construct of any one of claims 2 to 3, or the use of the host cell of any one of claims 4 to 5, being: and the promoter element is used for promoting the expression of the rice Wx gene.
8. The promoter Wx of claim 1b6Or the construct of claims 2-3, or the host cell of claims 4-5, for use in any one of:
a. adjusting the amylose content of the rice;
b. improving the quality of the rice;
c. and (5) breeding for improving the rice quality.
9. A product for regulating amylose content in rice, which contains the active ingredient of claim 1Promoter Wxb6Or a construct according to claims 2-3, or a host cell according to claims 4-5.
10. A method of modulating Wx gene expression or amylose content or improving rice quality comprising the steps of:
in rice with SEQ ID NO: 1, the promoter Wxb6Promoting the expression of Wx gene.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010072111.9A CN111849976A (en) | 2020-01-21 | 2020-01-21 | Promoter Wx of rice Wx geneb6And use thereof |
PCT/CN2020/076351 WO2021147134A1 (en) | 2020-01-21 | 2020-02-24 | Method for cultivating and screening rice on basis of amylose content and use of novel wx promoters created thereby |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010072111.9A CN111849976A (en) | 2020-01-21 | 2020-01-21 | Promoter Wx of rice Wx geneb6And use thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN111849976A true CN111849976A (en) | 2020-10-30 |
Family
ID=73542972
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010072111.9A Pending CN111849976A (en) | 2020-01-21 | 2020-01-21 | Promoter Wx of rice Wx geneb6And use thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111849976A (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108949753A (en) * | 2018-07-26 | 2018-12-07 | 扬州大学 | Expression vector WxbThe building of -10T, the preparation of transgenic paddy rice and primer |
CN110093349A (en) * | 2019-05-07 | 2019-08-06 | 华中农业大学 | SgRNA and application using CRISPR/Cas9 systemic characteristic shearing rice xal3 gene promoter |
-
2020
- 2020-01-21 CN CN202010072111.9A patent/CN111849976A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108949753A (en) * | 2018-07-26 | 2018-12-07 | 扬州大学 | Expression vector WxbThe building of -10T, the preparation of transgenic paddy rice and primer |
CN110093349A (en) * | 2019-05-07 | 2019-08-06 | 华中农业大学 | SgRNA and application using CRISPR/Cas9 systemic characteristic shearing rice xal3 gene promoter |
Non-Patent Citations (1)
Title |
---|
孙业盈等: "水稻Wx基因表达调控的研究进展", 遗传, vol. 27, no. 6, pages 1014 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP5874949B2 (en) | Mutant plant, method for producing the same, and method for increasing the frequency of genetic recombination | |
CN111187789B (en) | Rice MYB transcription factor and application of recombinant expression vector thereof | |
AU6262394A (en) | Dna, dna constructs, cells and plants derived therefrom | |
US11613760B2 (en) | Compositions and methods for increasing plant growth and improving multiple yield-related traits | |
US11952404B2 (en) | Tomato mSIBZR1L gene and use thereof | |
JP2003525030A (en) | Flax seed-specific promoter | |
CN108707623B (en) | Strawberry apical meristem related gene FvMYB17 and application thereof | |
Nie et al. | CRISRP/Cas9-mediated targeted mutagenesis of tomato polygalacturonase gene (SlPG) delays fruit softening | |
CN113862265A (en) | Method for improving rice grain shape and appearance quality | |
CN111511916A (en) | Flowering phase regulation gene CMP1 and related vector and application thereof | |
CN112280786A (en) | Herbicide-tolerant corn with HH2823 transformation event with high nutrient utilization efficiency and specificity identification method and application thereof | |
US11795465B2 (en) | Meiotic promotors and uses thereof | |
WO2021147134A1 (en) | Method for cultivating and screening rice on basis of amylose content and use of novel wx promoters created thereby | |
CN110777150B (en) | Application of protein GmPLATZ in regulation and control of plant seed yield | |
CN111849974B (en) | Promoter Wx of rice Wx geneb7Application of the same | |
CN111849975B (en) | Promoter Wx of rice Wx geneb2Application of the same | |
CN111849976A (en) | Promoter Wx of rice Wx geneb6And use thereof | |
CN102395265A (en) | Hydroperoxide lyase genes and tolerance to abiotic stress in plants | |
CN111849969A (en) | Promoter Wx of rice Wx geneb1And use thereof | |
CN111849973A (en) | Promoter Wx of rice Wx geneb5And use thereof | |
CN111849971A (en) | Promoter Wx of rice Wx geneb4And use thereof | |
CN111849972A (en) | Promoter Wx of rice Wx geneb3And use thereof | |
CN111849970A (en) | Rice cultivation and screening method based on amylose content | |
CN108841855B (en) | Method for editing rice Ehd1 gene to cultivate japonica rice variety in long-term growth period | |
CN107384953B (en) | Arabidopsis glycosyl transferase UGT84A2 is adjusting the application in the flowering of plant time |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |