CN111849925B - Vaccine against colon cancer and its preparation method - Google Patents

Abstract

The invention discloses an anti-colon cancer vaccine strain and a preparation method thereof. The anti-colon cancer vaccine strain is named as SVA-20 and is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and the microorganism preservation number is as follows: CGMCC NO. 18698. The anti-colon cancer vaccine strain SVA-20 is obtained by naturally selecting attenuation and in vitro domestication. The virus can be produced on MRC-5 cell, has effects of resisting colon cancer tumor cell in vitro, and is prepared by mixing 1 × 10¹⁴The virus particles/kilogram are injected into colon cancer tumor-bearing mice intravenously, do not cause death and visible clinical symptoms, can regress tumors, and are safe and stable, and the effective period can reach 2 years. The invention provides a new technical means for the immunotherapy of tumors.

Description

Vaccine against colon cancer and its preparation method

Technical Field

The invention relates to an oncolytic virus strain, in particular to an anti-colon cancer vaccine strain obtained by natural selection attenuation and in vitro domestication, a colon cancer vaccine prepared from the vaccine strain and a preparation method thereof. The invention belongs to the technical field of biological medicines.

Background

Oncolytic viruses are a class of viruses that replicate on and kill tumors on tumor cells. Compared with chemical drugs and radiotherapy of tumors, the oncolytic virus belonging to immunotherapy can directionally infect and kill tumor cells, and the natural oncolytic virus is more effective and less toxic compared with the engineered oncolytic virus.

The invention naturally selects attenuated and in vitro domesticated anti-colon cancer vaccine strain, the virus can be replicated in MRC-5 cells, and the anti-colon cancer tumor cells in vitro are as follows: 1X 10¹⁴Systemic injection of viral particles per kilogram into colon cancer-bearing mice did not cause death and visible clinical symptoms, but could regress the tumor. The vaccine is safe and stable, and the validity period can reach 2 years.

Disclosure of Invention

The invention aims to provide an anti-colon cancer vaccine strain obtained by natural selection attenuation and in vitro domestication and a preparation method of the vaccine.

In order to achieve the purpose, the invention adopts the following technical means:

the invention relates to an anti-colon cancer vaccine strain which is named as SVA-20 and classified and named as type A senica virus, is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and is addressed to the microorganism research institute of China academy of sciences No. 3, West Lu No.1 Hospital, Beijing, and the area facing the Yang, and the microorganism preservation number is as follows: CGMCC NO.18698, with preservation time of 2019, 10 months and 29 days.

Furthermore, the invention also provides an anti-colon cancer vaccine, which contains the anti-colon cancer vaccine strain SVA-20.

Wherein, preferably, the vaccine is a freeze-dried vaccine.

Among them, the lyoprotectant used preferably contains 1.25-2% (w/v) sucrose, 1.25-3.0% (w/v) sorbitol, 0.08(w/v) cysteine, 0.01-5.0% (w/v) sodium glutamate, 6.25-18.7% (w/v) gelatin, 1-5% (w/v) hydrolyzed gelatin, 0.06% (w/v) F68, and is formulated with a 50mM potassium phosphate solution having a pH of 7.

Furthermore, the invention also provides a method for preparing the anti-colon cancer vaccine, which comprises the following steps:

a) culturing MRC-5 cells, wherein the culture solution is DMEM containing 8% fetal calf serum and a proper amount of antibiotics, the pH value is 7.2 +/-0.2, the MRC-5 cells are cultured at 37 ℃, the cells form a monolayer after 5 days, the culture solution is poured out, the anti-colon cancer vaccine strain SVA-20 is infected by 0.01MOI for 4 hours, the cells are washed three times by physiological saline, Ehrlich solution is added, the human serum albumin contains 0.01%, the pH value is 7.2, the cells are cultured for 7 days at 32 ℃, a preparative low-speed continuous flow centrifuge is used for centrifuging to remove cell fragments, simultaneously supernatant and sediment are harvested, the sediment is used for cracking foot-and-mouth disease virus infected cells and cell membrane fragments in the presence of 0.2% Triton-X-100, and the cells and the cell membrane fragments are repeatedly frozen and thawed 3 times and then subjected to ultrasound; centrifuging with a preparative low-speed continuous flow centrifuge to collect supernatant, mixing the supernatants to obtain 100L supernatant with SVA-20 titer of 10 or more^9.0logTCID₅₀/mL；

b) Deep filtering;

filtering the virus liquid obtained in the step a) by a filter membrane of 0.8 mu m, sampling and determining that the virus titer of SVA-20 is more than or equal to 10^8.2logTCID₅₀/mL；

c) Performing density gradient centrifugation purification on the sucrose;

purifying the virus liquid obtained in the step b) by sucrose density gradient ultracentrifugation, wherein the centrifugal machine is a preparative series, the volume of a large-capacity rotary head is 3.2-8 liters, and the volume of batch treatment is 200 liters; comprises (1) a gradient formed by centrifugal force 36000-; (2)90000-120000g formed gradient; (3) the flow rate of SVA-20 virus liquid is 20L/h; the equilibration buffer used was 0.04M PBS (pH 7.2-7.6), 60wt% sucrose buffer (0.04M phosphoric acid, 100mM NaCl, 0.1% Triton-X-100, pH 7.6) at 20 liters/hour loading, 32000 rpm;

d) ultrafiltering, dialyzing, changing liquid, diluting, sterilizing and filtering

Dialyzing the virus solution obtained in the step c) by adopting a 100KD ultrafiltration membrane, dialyzing by using 50L cold dialysis buffer solution [200mM Tris-HCl, 50mM HEPES pH 8.0, 10% (v/v) glycerol ], and then sterilizing and filtering by using a 0.22 mu m membrane;

e) freeze-drying

Adjusting the virus titer of the vaccine stock solution to be more than 9.0 by adopting 7.2 percent (w/v) of sucrose and 10mM potassium phosphate with the pH value of 7, wherein the used freeze-drying protective agent comprises 1.25-2 percent (w/v) of sucrose, 1.25-3.0 percent (w/v) of sorbitol, 0.08(w/v) of cysteine, 0.01-5.0 percent (w/v) of sodium glutamate, 6.25-18.7 percent (w/v) of gelatin, 1-5 percent (w/v) of hydrolyzed gelatin and 0.06 percent (w/v) of F68, and is prepared by using 50mM potassium phosphate solution with the pH value of 7;

adjusting the pH of the solution to 6.8-7.2, subpackaging into 10mL penicillin bottles with 1.1mL each, freezing to-50 ℃ by a Virtis Advantage XL-70 freeze dryer, and maintaining for 140 minutes, wherein the primary drying comprises secondary drying:

maintaining at-35 deg.C and 50mTorr pressure for 64 hr, maintaining at 0 deg.C and 50mTorr pressure for 8 hr, secondary drying at 28 deg.C and 50mTorr pressure for 6 hr, and sealing with stopper under gas condition.

Compared with the prior art, the invention has the beneficial effects that:

the invention obtains an anti-colon cancer vaccine strain by naturally selecting attenuation and in vitro domestication, the vaccine strain can be replicated on MRC-5 cells, and is used for human body safety and large yield, and the test of in vitro colon cancer tumor cells and in vivo colon cancer tumor-bearing mice proves that: will be 1 × 10¹⁴Intravenous injection of viral particles per kilogram to mice did not cause death and visible clinical symptoms in immunodeficient or normal mice, but could lead to tumor regression. The vaccine is safe and stable, and the validity period can reach 2 years. The invention provides a new technical means for treating the tumor.

Drawings

FIG. 1 is a graph of the blood neutralizing antibody content of healthy mice after exposure to various amounts of SVA-20 virus.

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

Example 1 acclimatization of Senica virus type A

1.1SVA culture method and acclimation

The inventor separates a Seneca Valley virusA (SVA) type A from the nasal vesicle fluid of a swine (Lanzhou) suffering from the vesicular disease, and the virus strain is separated by PK-15 and is passaged for 3 generations and has no pathogenicity to the infection of a swine laboratory.

75cm²Culturing ST cells in a square flask, culturing the ST cells in a cell culture solution containing 10% fetal calf serum, 10mM potassium chloride and 100 units of streptomycin-qing DMEM at 37 ℃, inoculating 1ml of PK-15 culture domestication and plaque purification cultured SVA virus solution after cell monolayer culturing for 2 weeks, continuously culturing in 2% fetal calf serum DMEM at 32 ℃, sampling every day and detecting TCID₅₀Cytopathic effect (CPE) was observed. The generation is continuously passaged for 10 generations, and the genetic stability detection is carried out every 5 generations.

75cm²Culturing Vero cells in a square bottle, wherein a cell culture solution is DMEM containing 10% fetal calf serum, 10mM potassium chloride and 100 units of streptomycin, culturing at 37 ℃, inoculating 1ml of SVA virus solution cultured after ST culture acclimatization and plaque purification after cell monolayer, culturing for 2 weeks, continuously culturing in DMEM culture solution containing 2% fetal calf serum at 32 ℃, and observing cytopathic effect (CPE) every day. The cells were continuously passaged for 20 generations, and genetic stability tests were performed every 5 generations.

75cm²Culturing MRC-5 cells in a square bottle in a cell culture medium DMEM containing 10% fetal calf serum, 10mM potassium chloride and 100 units of streptomycin at 37 deg.C, inoculating 1ml of Vero cells after cell monolayer acclimatization, purifying plaque, and culturingCulturing SVA virus solution for 2 weeks, culturing in DMEM (DMEM) containing 2% fetal calf serum at 32 deg.C, sampling daily, and detecting TCID₅₀Cytopathic effect (CPE) was observed. The generation is continuously passaged for 25 generations, and the genetic stability detection is carried out every 5 generations.

1.2 Virus plaque purification and particle calculation

The virus of each cell passage is plaque purified by ST, MRC-5 and Vero cells according to 2X 10⁶Cells/well were seeded on 6-well plates in DMEM containing 10% fetal bovine serum, 10mM potassium chloride, 100 units of streptomycin, 2 days later, the passaged SVA was seeded, 1 hour after infection, 1% agarose was plated, and 2 days later, plaques were selected. Plaque-purified SVA was expanded on NUNC cell factories using Vero cells. Harvesting 2-3 days later, and freeze thawing the harvest solution for 3 times, each time at-70 deg.C and 37 deg.C. The freeze-thaw solution was stored in a sterile 2 ml vial with a cap and placed at-70 ℃ until use. The determination of the concentration of the purified virus, a260 ═ 1, by spectrophotometer corresponds to 9.5 × 10¹²Particles, virus titer TCID50 was determined using Vero cells. The ratio of the three batches of particles to the infectious titer was 62.5 ± 37.5.

1.3 detection of genetic stability of SVA

SVA gene RNA genome RNA is extracted according to an operation instruction provided by Trizol kit manufacturers, 250 microliters of purified SVA is mixed with 3 times of volume of TRIZOL and 240 microliters of chloroform, 600 microliters of isopropanol is used for precipitation, RNA precipitation is washed with 70% ethanol for three times, the RNA precipitation is dissolved in DEPC water, cDNA is synthesized by RT-PCR, and the cDNA is cloned in plasmid for sequencing. The sequencing primers are shown in Table 1.

TABLE 1 sequencing primers for different clones

TABLE 2 Adaptation, passage and growth of SVA in different cell lines

Inoculating the A-type seneca valley virus into a single-layer diploid ST cell according to 0.1MOI, transmitting to 5-10 generations, and enabling the virus titer to reach 10^9.0logTCID₅₀And/ml. As shown in Table 2, the virus titer reached a peak at 2-3 days, and the primers shown in Table 1 were sequenced, and the homology with 100% virus isolated from PK-15. The SVAs, which were shown to be non-pathogenic to swine, were adapted to swine diploid cells.

Inoculating the 6-generation culture solution at 0.1MOI to 75cm²The Vero cell monolayer cultured in the square bottle is cultured at 37 ℃, the Vero cell monolayer is cultured for one passage of 2 weeks, each passage cell is titrated after freeze thawing and ultrasonic treatment, after 15-25 passages, the SVA has enhanced Vero cytopathic effect, and the virus titer reaches 10^7.8logTCID₅₀The virus titer peaked at 4-5 days per ml, see Table 2. Indicating that the adaptation of the SVA was acclimatized to Vero cells.

Inoculating the above 10-generation Vero cell culture solution at 0.1MOI to 75cm²Culturing Vero cell monolayer in a square bottle, culturing at 37 ℃, culturing for 3 weeks for passage once, and titrating after freeze thawing and ultrasonic treatment of the passage cells each time. After 10-20 passages, the effect of SVA on MRC-5 cytopathic effect is enhanced, and the virus titer reaches 10^9.0logTCID₅₀The virus titer peaked at 6-7 days per ml, see Table 2. Indicating that the SVA was acclimatized to MRC-5 cells. Through genetic stable genome detection, the nucleotide homology is 99.8 percent and 99.6 percent and the amino acid homology is 99.7 percent and 99.6 percent respectively when the virus genome sequence is compared with the original SVA separated from PK-15. It contained 7297 base pairs (3-terminal Poly A40bp), indicating genetic stability.

The invention obtains a Seneca Valley virus A (SVA) through natural selection attenuation and in vitro domestication, which is named as SVA-20 and is preserved in the China general microbiological culture Collection center, and the preservation number of the microorganism is as follows: CGMCC NO. 18698.

Example 2 preparation of an anti-colon cancer vaccine

2.1 preparation of vaccine stock solution

a) Culturing MRC-5 cells in a 100L cell factory, wherein the culture solution is DMEM containing 8% fetal calf serum and a proper amount of antibiotics, the pH is 7.2 +/-0.2, the MRC-5 cells are cultured at 37 ℃ for 5 days to form a monolayer, pouring out the culture solution, infecting SVA-20(CGMCC NO.18698) with 0.01MOI for 4 hours, washing with physiological saline for three times, changing to Ehrlich's solution containing 0.01% human serum albumin, culturing at 32 ℃ for 7 days, centrifuging by using a preparative low-speed continuous flow centrifuge to remove cell debris, simultaneously harvesting supernatant and precipitate, cracking the cell membranes of foot-and-mouth disease virus infected cells and debris in the presence of 0.2% Triton-X-100, repeatedly freezing and thawing for 3 times, and performing ultrasound for 3 times (the maximum output power is 3 multiplied by 30 s); centrifuging with a preparative low-speed continuous flow centrifuge to collect supernatant, mixing the supernatants to obtain 100L supernatant with SVA-20 titer of 10 or more^9.0logTCID₅₀/mL；

b) Deep filtering;

filtering the virus liquid obtained in the step a) by a filter membrane of 0.8 mu m to obtain 100L of virus liquid, and sampling to determine that the virus titer of SVA-20 is 10^8.2logTCID₅₀/mL。

c) Performing density gradient centrifugation purification on the sucrose;

purifying the virus liquid obtained in the step b) by sucrose density gradient ultracentrifugation to obtain 4L virus liquid, wherein the used centrifugal machine is a preparative series, the volume of a large-capacity rotary head is 3.2-8L, and the batch processing volume is 200L; comprises (1) a gradient formed by centrifugal force 36000-; (2)90000-120000g formed gradient; (3) the flow rate of SVA-20 virus liquid is 20L/h; the equilibration buffer used was 0.04M PBS (pH 7.2-7.6), 60wt% sucrose buffer (0.04M phosphoric acid, 100mM NaCl, 0.1% Triton-X-100, pH 7.6) at 20 liters/hour loading, 32000 rpm;

d) ultrafiltering, dialyzing, changing liquid, diluting, sterilizing and filtering

Dialyzing with 100KD ultrafiltration membrane to obtain 10L SVA-20 virus solution, dialyzing with 50L cold dialysis buffer [200mM Tris-HCl, 50mM HEPES pH 8.0, 10% (v/v) glycerol ], and sterilizing and filtering with 0.22 μm membrane.

2.2 vaccine stock solution detection method

Measuring the light absorption value at 260nm, 1OD, of the SVA-20 stock solution by an ultraviolet spectrophotometer_260nm＝9.5×10¹²A viral particle.

Exogenous DNA residual quantity assay: the appendix 46IXB of the Chinese pharmacopoeia version 2005, the method for measuring the antibiotic residue, the appendix 45IX A of the Chinese pharmacopoeia version 2005, and the detection of MRC-5 cell residual DNA by PicoGreen^TMA quantification kit (Invitrogen Corp.; Carlsbad, Calif.), lambda DNA was used as a standard. The MRC-5 host cell protein assay kit (Cygnus Technologies, Inc.4701 Southport Supply Rd. SE, Suite 7Southport, NC 28461 USA) was performed according to the protocol.

The yields of 3 steps of SVA-20 virus particles (vaccine stock) production are shown in Table 3.

TABLE 3SVA-20 Virus particle (vaccine stock) manufacture 3 times each step yield

Three batches of vaccine were prepared according to the above procedure, and the quality of the 3 batches of purified SVA-20 vaccine stock is shown in Table 4.

TABLE 43 quality of batch purified SVA-20 vaccine stock solution

Three batches of vaccine prepared as described above, mean viral titer of vaccine stock (10 logTCID)₅₀mL) of 9.4, an average number of 1mL of virus-containing particles of 1.82, an average endotoxin content of 5 EU/mL, an average residual quantity of MRC-5 cell protein of 20 ng/mL, an average residual quantity of MRC-5 cell DNA of 28.3 pg/mL, an average residual quantity of bovine serum albumin of 8 ng/mL, and an average residual quantity of TritonX-100 of 15. mu.g/mmThe average of the amount of antibiotic residues was 6 ng/ml.

2.3 preparation of lyoprotectant and lyophilization

The virus titer of the vaccine stock solution was adjusted to 9.0 or more using 7.2% (w/v) sucrose and 10mM potassium phosphate at pH7, and the compounds L-alanine, L-arginine, calcium chloride, glycerol, L-histidine, human serum albumin, Hydranal solution, magnesium chloride, mannitol, inositol, zinc chloride, d-sorbitol, dipotassium phosphate, disodium citrate, and gelatin were purchased from the same company.

The SVA freeze-drying protective agent contains 1.25-2% (w/v) of sucrose, 1.25-3.0% (w/v) of sorbitol, 0.08(w/v) of cysteine, 0.01-5.0% (w/v) of sodium glutamate, 6.25-18.7% (w/v) of gelatin, 1-5% (w/v) of hydrolyzed gelatin, and 0.06% (w/v) of F68 prepared by 50mM potassium phosphate with pH7, wherein the gelatin and the hydrolyzed gelatin do not contain divalent calcium and magnesium ions.

Freeze-drying:

the stock vaccine solution prepared above is sterilized and filtered before adjusting the virus titer, and the pH of the solution is adjusted to 6.8-7.2. Subpackaging into 10mL penicillin bottles with 1.1mL each, freezing to-50 ℃ by using a Virtis Advantage XL-70 freeze dryer, and maintaining for 140 minutes, wherein primary drying comprises secondary drying:

maintaining at-35 deg.C and 50mTorr pressure for 64 hr, 0 deg.C and 50mTorr pressure for 8 hr, and secondary drying at 28 deg.C and 50mTorr pressure for 6 hr. The bottle was closed with a stopper under atmosphere.

And (3) moisture detection:

the residual moisture of all freeze-dried samples is detected by an apparatus AQ-300Karl Fischer trapor and a Karl Fischer method conforming to pharmacopeia in a sealed system with controllable temperature and humidity.

The freeze-dried vaccine has storage stability:

the lyophilized vaccine is present partly at 37 ℃ for 2 months and partly at 4 ℃ for 25 ℃ to 30 months.

The titer of the cenecar virus stock solution mixed with the SVA freeze-drying protective agent is 9.5log TCID₅₀mL, a 0.4 reduction in viral titer after lyophilization, a 1.0log TCID50 reduction for one week at 37 ℃, a 1.3log TCID50 reduction for two weeks, a 1.5log TCID50 reduction for 4 weeks at 37 ℃, a 1.5log TCID50 reduction for 6 weeks,the residual water content after freeze-drying is about 3-1%

The vaccine titer was 9.8logTCID₅₀The vaccine, at a residual moisture of about 3%, dropped about 0.1log TCID50 in virus titer when stored at 4 ℃ for 3 months. At 6 months of storage, the virus titer dropped about 0.2log TCID50, at 9 months of storage, the virus titer dropped about 0.3log TCID50, and at 12 months of storage, the virus titer dropped about 0.5log TCID 50.

The vaccine titer was 9.2logTCID₅₀mL, residual moisture of about 2% vaccine, about 0.1log TCID50 reduction in viral titer after 1 month at 25 ℃, 0.3log TCID50 reduction in viral titer after three months of storage, and about 2.2log TCID50 reduction in viral titer after 6 months of storage. At 9 months of storage, the virus titer dropped by about 3.0log TCID 50.

The vaccine titer was 9.7logTCID₅₀mL, residual moisture of about 2.6% vaccine, and a drop in viral titer of about 0.6log TCID50 after 1 month storage at 37 ℃. At 2 months of storage, the viral titer dropped about 1.2log TCID50, and at 6 months of storage, the viral titer dropped about 2.1log TCID 50. At 9 months, the viral titer dropped about 3.6log TCID50, and at 12 months, the viral titer dropped about 4.0log TCID 50.

The results show that the anti-colon cancer live vaccine has good stability, can be stored for 2 years at 4 ℃, can be stored for 2 months at 25 ℃ and can be stored for 1 month at 37 ℃. Meanwhile, the freeze-drying protective agent has a good protective effect on the Seneca live virus.

Example 3 anti-colon cancer vaccine maximum and minimum tolerated dose in immunodeficient mice

The Maximum Tolerated Dose (MTD) is the limiting toxic dose in animal models following SVA-20 injection, and is the dose that causes weight loss, symptoms, and death throughout the treatment.

In ascending dose (1X 10)⁸-1×10¹⁴SVA virus particles/kg) 10 each of 10 Balb/c nude mice were intravenously administered MTD at each dose. All doses tested did not cause weight loss, any symptoms. Balb/c nude mice were injected intravenously with SVA neutralizing antibodies between 1/1024-1/4096 titers in 15 and 21 days of serum.

8-10 week old mice were injected tail vein with SVA. HB for taking out SVA-20 vaccine stock solution stored at-4 to 8 DEG CSS (Hank's salt solution) dilution to a final concentration of 10⁷particle/mL, 10¹⁰particle/mL, 10¹³particles/mL were injected into 2, 3, 4 groups of mice, respectively, and HBSS was injected into 1 group of mice as a vehicle control.

The injection is made at 10mL/kg body weight. Mice were observed for morbidity and mortality 2 times daily and weighed 2 times a week for immediate record of mice dying and unusual symptoms (physical or behavioral). Standard hematology and serum chemistry (AST, ALT, BUN, CK, LDH) tests were performed from all surviving mice sacrificed according to standard methods, brain, heart, lung, kidney, liver, gonads were taken, half of the organ samples were flash frozen with dry ice, and half of the organ samples were placed in formalin.

Table 5 shows that the SVA-20 low, medium and high dose systemic injection and the Balb/c non-injected nude mice have no hematology abnormal reaction, which indicates that the Balb/c nude mice injected with the SVA systemic injection do not have detectable toxicity.

Example 4 safety of anti-colon cancer vaccine against Balb/c nude mice

100 Balb/c nude mice 6-8 weeks old are weighed, earmarked, randomly grouped according to body weight, and respectively injected into vein with single dose of 1 × 10⁹、3×10¹¹、1×10¹⁴vp/kg (n 25/dose/sex), weighed weekly, and observed. Balb/c nude mice were evaluated for blood and serum chemistry 24 hours, 1, 3, 6, and 12 weeks after injectionEstimating, analyzing orbital bleeding by organ weight, macroscopic pathology and microscopic pathology examination 1, 3, 6 and 12 weeks after injection, and performing blood phase separation counting, wherein the method comprises the following steps: hemoglobin (similar to text), the analytical instruments, the VetScan HMT hematology System (Abaxis, Union City, Calif.), the VetScan chemical Analyzer (Abaxis, Union City, Calif.), and the SCA2000 veterinary hemagglutination Analyzer (Synbiotics, San Diego, Calif.) were operated according to the manufacturer's instructions. Adrenal gland, femur, bone marrow, brain, cecum, colon, duodenum, epididymis, esophagus, eye, gall bladder, gonad (testis or ovary), macroscopic lesions, heart, ileum, jejunum, kidney, liver, lung, lymph nodes (mandible and mesentery), breast, pituitary, salivary glands (mandible, sublingual, parotid), sciatic nerve, skeletal muscle, skin (ventral abdomen), spinal cord, spleen, stomach, thymus, thyroid, trachea, bladder, uterine horn for examination and analysis, eye preserved in Davidson solution, others preserved in 10% s formalin solution, cut to 5 μm with wax embedding, stained with hematoxylin and eosin, and microscopic observation.

Distribution on mice:

160 (5/sex/group/time point) 6-8 weeks old Balb/c nude mice, which were weighed, eared, and randomly grouped by body weight. 1 group of intravenous injection control solution, 2-4 groups of single intravenous injection 10⁷，10⁷，10⁵TCID50 SVA-20. After injection, the rhizoma Gastrodiae 2, 5, 22, and 91 is drunk, and blood, bronchoalveolar lavage fluid, urine, thyroid gland, brain, lung, liver, kidney, pancreas, spleen and gonad (ovary or testis), heart, quadriceps, stomach, and small intestine are frozen and stored for use.

RNA isolation:

the blood RNA was extracted using a QIAamp RNA blood micro-extraction cassette, and the bronchoalveolar and urinary RNA were extracted using a QIAamp viral RNA micro-extraction cassette, according to the instructions provided by the manufacturer. RNA extraction from tissues was performed using RNeasy tissue cassettes (thymus, brain, lung, liver, kidney, pancreas, gonads) or RNeasy fibrous tissue cassettes (heart, quadriceps, stomach, small intestine), all according to the instructions provided by Qiagen. All samples were quantitated by uv spectrophotometer for DNA-free treatment.

Quantitative qRT-PCR of SVA-20:

amplification procedure for VP1 of SVA-20: probes using the iScript one-step RT-PCR cassette, reaction volume 25. mu.l, 300nM forward primer: 5'-TGCCTTGGATACTGCCTGATAG-3' contained 200nM5 '-FAM/CGACGGCCTAGTCGGTCGGTT/3 BHQ-1/-3' double-labeled probe, 300nM reverse primer s 5'-GGTGCCAGAGGCTGTATCG-3'. The 1 Xreverse transcription PCR mixture is added with probe, nuclease-free water, transcriptive enzyme and RNA template. First, a cycle of reverse transcription reaction was performed at 50 ℃ for 10 minutes, followed by denaturation at 95 ℃ for 5 minutes, and then amplification was performed for 45 cycles of 95 ℃ for 15 seconds and 60 ℃ for 30 seconds, and the annealing and extension steps were detected by fluorescence using an iCycler real-time instrument (Bio-Rad). RNA samples were diluted to below 1. mu.g per reaction tissue and the amounts were determined by standard linear curve comparison.

Balb/c nude mice were injected with 10mL/kg single dose intravenous injection containing 1X 10⁹、3×10¹¹Or 1X 10¹⁴In the case of vp, the frequency of occurrence of clinical symptoms was the same as in the case of the saline mice, and all of the injected mice had a slight decrease in body weight and a transient decrease in net weight as in the case of the saline-injected mice compared with the higher dose mice. Physiological saline (n ═ 25), 1 × 10⁹vp/kg(n＝25)，3×10¹¹vp/kg(n＝25)、1×10¹⁴vp/kg (n 25), and body weight change per week and group was calculated at 1 × 10¹⁴The body weight of the mice in the vp/kg (n-25) injection group is less than 0.05 compared with the body weight of the mice in the physiological saline injection group. The body weights of the male mice receiving all doses injected for 1 week were significantly different from those of the female mice receiving all doses for 3 weeks, and the body weights of the mice of the other groups received all doses without significant difference, and all mice gained weight at 12 weeks. The leucocytes including monocyte, lymphocyte and neutrophil granulocytes have dose-dependent reduction phenomenon in 24 hours after the injection of high-dose group mice, and the growth is recovered after one week, 1 × 10¹⁴The body weight of the mice in the vp/kg (n-25) injection group is less than 0.01 compared with the body weight of the mice in the physiological saline injection group. The chemistry of the serum comprises that the liver aspartate aminotransferase, the alanine aminotransferase, the gamma-glutamyltransferase and the like have no toxicologically significant changes. No gross or microscopic pathological changes were observed in all organs including normal neuroendocrine organs such as brain, adrenal gland, etc. within 12 weeks of SVA-20 injectionParathyroid, thyroid, carotid body pancreas.

Example 5 safety and pharmacokinetics of anti-colon cancer vaccines in monkeys

9 (3 per group) SVA negative adult male monkeys were divided into three groups, group c was given a single intravenous dose of saline, group h1 and group h2 were given 1X 10 intravenous doses⁹vp/kg、1×10¹⁴vp/kgSVA-20, body weight, body temperature and clinical symptoms. Blood was taken on days 3, 10, 15, 29, 91 for hematology and clinical chemistry basic tests, and serum SVA antibody levels were tested on days 8, 15, 29, 91. Oral mucosal swabs containing epidermal cells and saliva were taken on days 1, 2, 8, 15, 29, and 91. Complete necropsy and histopathological analysis were performed on day 29 and 91 for 2 monkeys per group, and the following tissues were examined, sampled and fixed in 10% neutral formalin: adrenal gland, aorta, bone marrow, brain, cecum, colon, duodenum, epididymis, esophagus, eye, gall bladder, gonad, macroscopic lesion, heart, ileum, jejunum, kidney, lip, liver, lung, lymph node, breast, pancreas, parathyroid gland, prostate, salivary gland, sciatic nerve, skeletal muscle, skin (including injection site), spinal cord, spleen, stomach, thymus, thyroid, tongue, tonsil, trachea, bladder, preserved in 10% formalin solution, cut into 5 μm with wax embedding, stained with hematoxylin and eosin, and microscopic observation.

Mouse and monkey serum SVA antibodies:

and (3) performing immunofluorescence assay, using SVA as a substrate, and using a goat anti-mouse propyl isothiocyanate coupling antibody to detect mouse IgG and a goat anti-human propyl isothiocyanate coupling antibody to detect monkey IgG.

Oral swab RNA isolation:

the samples were taken 10 times by wiping them with a sterile swab in the mouth, vortexing for 1 min in a microfuge tube containing 0.4ml of buffer RLT and beta-mercaptoethanol, disrupting with a QIA disrupter, centrifuging for 5 min, freezing the fluid at-65 deg.C, and taking out the fluid for testing using the RNeasy Total RNA cassette (Qiagen).

The buccal swab RNA detection method was the same as in example 4.

As a result:

the injected animals had no behavioral and obvious disease symptoms, no conjunctivitis was observed, no secretion flowed out from the nose and mouth, and the appetite was normal. Normal feces or color, stable weight of injected animal, 1 × 10¹⁴The body temperature of the animals injected with vp/kg exceeds 40 ℃ on day 2, and decreases sharply on the same day, the control group and 1X 10⁹The animals per kg had transient fever peaks of 39.5 ℃ in 1-2 days, and rapidly returned to normal body temperature on day 5.

Blood and serum chemistry:

all SVA-20 injected animals dropped in blood cell concentration from the mean of 10.0mmol/l at the start to the mean of 7.1mmol/l on day four, but still within normal limits, with reference values of 6.7-9.7 mmol/l. All SVA-20-injected animals had a slightly lower white blood cell count, but were within the normal range, and no reduction in abnormal white blood cells or leukocytosis was observed. The platelet count was not abnormal. All animals injected with SVA-20 had deteriorated renal function, such as terminal blood urea nitrogen and inosinic acid, and 1X 10 injections⁹The concentration of liver enzymes such as alanine aminotransferase in/kg animals can reach 94U/1 at maximum (reference value (11-78U/l-1), the concentration of aspartate aminotransferase can reach 184U/l (reference value: 23-71U/l-1), the concentration of aspartate aminotransferase is sharply reduced and recovered to normal at the 4 th day, the gamma-glutamyl transferase is maintained to be stable and not increased, but is slightly higher than the reference value of 18-65U/l, the concentration of amylase has a peak, the C-reactive protein can be detected in the injected animals, the limit value is 45mg/l, and no peak is generated.

Virology data:

all animals injected with SVA-20 were anesthetized for 4 days of injection and blood was taken, SVA-RNA was detected in plasma, and no SVA-RNA was detected in eyes, nose, throat, anus, Table 6.

Autopsy and histopathology:

SVA-RNA was detected in each organ as shown in Table 7, and after receiving SVA-20 and injecting physiological saline for 21 days, no SVA-RNA was detected in each organ and no pathological change was observed.

TABLE 6 Virus parameters of monkey samples 2 hours before and after injection

TABLE 7 monkey infection 4 days Ordovirus parameters

Example 6 in vivo and in vitro Activity assay of anti-colon cancer vaccine

6.1 detection of tumor cytotoxicity by SVA-20

Human colon cancer cells: HCT116, CCD-841CON, HT-29, SW480, endocrine tumor cells SVV-13, breast tumor cells Hs578T, brain tumor cells M059K, ovarian tumor cells OVCR-3, skin tumor cells LOXIMVI, fetal lung tumor cells HEK293, adult tumor cells PHH all from ATCC, Promocell, Cambrex, all cultured according to the medium and conditions recommended by the supplier. l x 10⁴Vero cells were grown in 96-well plates containing 180. mu.L of growth medium per well, SVA was serially diluted with RPMI 1640 the next day, 20. mu.L was added to the wells, incubated for 3 days, 3- (4, 5-dimethylthiozol-2-yl) -5- (3-carboxymethyloxyphenyl) -2- (4-sulfopheny) -2H-tetrazolium) (MTS) reagent (96-well plate nonradioactive cell proliferation assay, available from Promega) was added, and the adsorption was recorded and the virus dose was plotted against the percentage of control non-infected cells as adsorption. The data were fitted to a sigmoidal dose-response curve and the software was used to calculate the effective concentration (EC50), the EC50 value being the dose per cellular viral particle (ppc) at which SVA can achieve the maximum reduction in 50% exposed cellular light absorbance. All cytotoxicity assays were repeated 3 times.

6.2 replication curves of SVA-20 on growable tumor cells

After SVA-20 infects tumor cells for 1 hour, unadsorbed virus is washed away to prepare a crude virus lysate, Vero cells are used for detecting SVA titer as above, and meanwhile, an uninfected cell group is set as background. After 1, 3, 5 and 7 days of SVA incubation, preparing tumor cell infection lysate, determining SVA-20 titer by using Vero cells, mapping each acting time point and the generated virus quantity (TCID50/mL), performing 2-time multi-well test, and performing 3-time detection on each cell by using the virus titer of the tumor cell infection lysate.

6.3 Effect of SVA-20 on colon cancer mouse model

SW480, HT-29, HCT116 were purchased from ATCC of USA, cultured in RPMI-1640 medium containing 10% inactivated fetal bovine serum, 100mg/mL streptomycin, 50mg/mL amphotericin B at 37 deg.C and 5% CO₂Culturing under the condition, staining placenta blue to observe activity, and counting by using a hemocytometer. Athymic female mice (n 1230) of 6-7 weeks of age were 10 per group. Weighing, cutting ears, and dividing into groups according to weight. Right subcutaneous injection of tumor cells 5X 10⁶Human colon cancer cells HCT116 or 1X 10⁶SW48 cells. Tumor volume was measured with a digital caliper, and the volume calculation formula ═ pi/6 × width × length. To establish an early stage small tumor model, tumor-bearing HCT116 mice (n-10 or SW48 (n-7-8)) were injected with tumors for 15 days (tumor volume 73-210 mm)³) The latter group was 1, or the mice were loaded with SW48 and injected with tumors for 20 days (64-239 mm)³) Is 1 group. To establish a late-stage large tumor model, mice with tumor load HCT116 were injected with tumor for 48 days of growth (tumor volume 486-³) The latter were randomly divided into 1 group. The mice were injected into tail vein at 10mL/kg, and small volume HCT116 mice were injected at 1X 10⁷、1×10⁸、1×10⁹、1×10¹⁰、1×10¹¹、1×10¹²、1×10¹³vp/kg SVA-20, large volume HCT116 mice as 1X 10¹³vp/kg SVA-20, SW48 mice were injected at 1X 10⁸、1×10¹¹、1×10¹⁴vp/kg SVA-20. Control groups were injected with 200. mu.l or equal volume of UV-inactivated SVA, respectively, and tumors were examined 2 times per week after injection. Mice were anesthetized with carbon dioxide asphyxiation when tumors grew to 2000mm3 or at the end of the experiment (small HCT116 tumor: 20 days, SW48 tumor: 84 days, HCT116 tumor: 77 days). The end of the experiment means that the mice were anesthetized due to tumor burden or there was no first time point for tumor development.

The results show that: SVA-20 has a large cytolytic effect on SW480 rectal cancer, with EC50 being 0.0007 ppc. Dosage is 1 × 10⁷-1×10¹³vp/kg intravenous injection of established HCT116 tumor-bearing mice, saline-injected mice tumors grown to 1405mm in length 20 days³，1×10⁸vp/kg and high dose injection groups of 60 mice with complete tumor elimination, 1X 10⁷In 10 mice injected with vp/kg, 8 tumors disappeared, 1 still had larger tumors, and 1 had obvious small tumors (23 mm in volume) in 30 days³). The virus was not detectable in the blood 6 hours after injection, indicating a high targeting of SVA-20 to small cell lung cancer cells. Compared with the normal saline group, the tumor of the nude mice of different dose groups has P less than 0.01.

Receive 1X 10⁸vp/kg 8 mice, 6 SW480 tumors resolved completely and received 1X 10¹¹vp/kg in all 7 mice, SW480 tumor had completely regressed and received 1X 10¹⁴vp/kg 7 mice, 5 SW480 tumors completely regressed, and all SW480 tumor regressed mice survived at 84 days with prolonged survival (P < 0.01) per dose of SVA-20 injection.

Large tumor-bearing nude mice (486-¹³The tumor volume is obviously reduced by vp/kg injection, all 10 nude mice completely regress in 49 days, and the tumor growth of the nude mice injected with physiological saline can quickly reach 2000mm³。

6.4SVA-20 replication kinetics analysis

1×10⁶TCID₅₀the/mL can be produced by replication on HCT116, SW480, HT-29 cells. The amount of virus produced EC50 was inversely proportional at 1 and 3 days of infection, and was peaked at 5 days post-infection, indicating that these cells were susceptible to lysis by SVA-20 infection, and the results are shown in Table 8.

TABLE 8SVA-20 replication kinetics analysis

6.5 neutralizing antibodies in tumor-bearing mice

Serum neutralizing antibody detection method:

neutralizing and bleeding by SVA/MRC-5 virus and mouse serumThe serum neutralizing antibodies of the mice are determined by a 100% neutralization titration (NT 100) method. MRC-5 cells were cultured in 96-well plates for 1 day at 15,000 cells per well. Serum was diluted in multiple proportions and 500TCID separately₅₀SVA-20 was mixed, incubated at 37 ℃ for 1 hour, added with a monolayer of MRC-5 cells, incubated at 37 ℃ for 3 days, fixed and stained with staining solution (0.05% crystal violet, 20% methanol), and the reciprocal of the highest dilution of serum corresponding to the cell-free lesion was determined by comparison with uninfected cells. Plotted using GraphPad Prism 5 software package and statistically analyzed. The average antibody titers in each group, and the serum titers of the mice injected at different doses were compared by group.

Healthy mice were exposed to different amounts of SVA-20 virus and blood neutralizing antibodies were measured and the results are shown in FIG. 1, with one week (7-9 days of infection) and the onset of neutralizing antibody rise, peaking at 3 weeks (18-20 days).

Claims (5)

1. The colon cancer resistant vaccine strain is named as SVA-20 and is preserved in the China general microbiological culture Collection center, and the microbiological preservation number is as follows: CGMCC NO. 18698.

2. An anti-colon cancer vaccine comprising the anti-colon cancer vaccine strain according to claim 1.

3. The vaccine of claim 2, wherein the vaccine is a lyophilized vaccine.

4. The anti-colon cancer vaccine according to claim 3, wherein the lyoprotectant used comprises 1.25-2% (w/v) sucrose, 1.25-3.0% (w/v) sorbitol, 0.08(w/v) cysteine, 0.01-5.0% (w/v) sodium glutamate, 6.25-18.7% (w/v) gelatin, 1-5% (w/v) hydrolyzed gelatin, 0.06% (w/v) F68, formulated with 50mM potassium phosphate solution pH =7.

5. A method of preparing a vaccine against colon cancer comprising the steps of:

a) culturing MRC-5 cells in DMEM containing 8% fetal calf serum and a proper amount of antibiotics, pH7.2 +/-0.2, culturing the MRC-5 cells at 37 ℃, forming a monolayer after 5 days, pouring out the culture solution, infecting the anti-colon cancer vaccine strain SVA-20 of claim 1 with 0.01MOI for 4 hours, washing with physiological saline three times, changing to Ehrlich solution containing 0.01% human serum albumin, culturing at pH =7.2 and 32 ℃ for 7 days, centrifuging by using a preparative low-speed continuous flow centrifuge to remove cell fragments, simultaneously harvesting supernatant and precipitate, cracking foot-and-mouth disease virus infected cells and cell membrane fragments in the presence of 0.2% Triton-X-100, repeatedly freezing and thawing for 3 times, and performing ultrasound for 3 times; centrifuging with a preparative low-speed continuous flow centrifuge to collect supernatant, mixing the supernatants to obtain 100L supernatant with SVA-20 titer of 10 or more^9.0logTCID₅₀/mL；

b) Deep filtering;

filtering the virus liquid obtained in the step a) by a filter membrane of 0.8 mu m, sampling and determining that the virus titer of SVA-20 is more than or equal to 10^8.2logTCID₅₀/mL；

c) Performing density gradient centrifugation purification on the sucrose;

purifying the virus liquid obtained in the step b) by sucrose density gradient ultracentrifugation, wherein the centrifugal machine is a preparative series, the volume of a large-capacity rotary head is 3.2-8 liters, and the volume of batch treatment is 200 liters; comprises (1) a gradient formed by centrifugal force 36000-; (2)90000-120000g formed gradient; (3) the flow rate of SVA-20 virus liquid is 20L/h; the used equilibrium buffer solution is 0.04M PBS with pH value of 7.2-7.6, 60wt% sucrose is loaded with the buffer solution at 20L/h, and the rotating speed is 32000 rpm; the buffer solution for 60wt% of sucrose is as follows: 0.04M phosphoric acid, 100mM NaCl, 0.1% Triton-X-100, pH 7.6;

d) ultrafiltering, dialyzing, changing liquid, diluting, sterilizing and filtering

And c) performing ultrafiltration dialysis on the virus liquid obtained in the step c) by adopting a 100KD membrane, performing dialysis by using 50L of cold dialysis buffer solution, and performing aseptic filtration by using a 0.22 mu m membrane, wherein the cold dialysis buffer solution is as follows: 200mM Tris-HCl, 50mM HEPES pH 8.0, 10% (v/v) glycerol;

e) freeze-drying

Adjusting the virus titer of the vaccine stock solution to be more than 9.0 by adopting 7.2 percent (w/v) of sucrose and 10mM potassium phosphate with the pH =7, wherein the used freeze-drying protective agent contains 1.25-2 percent (w/v) of sucrose, 1.25-3.0 percent (w/v) of sorbitol, 0.08(w/v) of cysteine, 0.01-5.0 percent (w/v) of sodium glutamate, 6.25-18.7 percent (w/v) of gelatin, 1-5 percent (w/v) of hydrolyzed gelatin and 0.06 percent (w/v) of F68 and is prepared by using 50mM potassium phosphate solution with the pH = 7;

adjusting the pH of the solution to 6.8-7.2, subpackaging into 10mL penicillin bottles with 1.1mL each, freezing to-50 ℃ by a Virtis Advantage XL-70 freeze dryer, and maintaining for 140 minutes, wherein the primary drying comprises secondary drying:

maintaining at-35 deg.C and 50mTorr pressure for 64 hr, maintaining at 0 deg.C and 50mTorr pressure for 8 hr, secondary drying at 28 deg.C and 50mTorr pressure for 6 hr, and sealing with stopper under gas condition.

Images