CN111849906A

CN111849906A - Cell strain for expressing HLA-G5 isomer standard protein and application thereof

Info

Publication number: CN111849906A
Application number: CN202010452269.9A
Authority: CN
Inventors: 颜卫华; 林爱芬; 许惠惠
Original assignee: Taizhou Enze Medical Center Group
Current assignee: Taizhou Enze Medical Center Group
Priority date: 2020-05-26
Filing date: 2020-05-26
Publication date: 2020-10-30

Abstract

The invention provides a cell strain for expressing HLA-G5 isomer standard protein, which has the following preservation mechanisms: china center for type culture Collection, the collection numbers are: CCTCC NO: C202015. The protein can stably express HLA-G5 isomer standard protein, and can be applied to human leukocyte antigen-G isomer molecule HLA-G5 flow cytometry, immunoblotting, tissue and cell immunohistochemistry, HLA-G isomer function research, specific antibody development and screening as standard reference substances and the like.

Description

Cell strain for expressing HLA-G5 isomer standard protein and application thereof

Technical Field

The invention belongs to the field of bioengineering, and particularly relates to a cell strain constructed by expression vectors of known 7 human leukocyte antigen-G (HLA-G) isomer molecules (HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7) and stably expressed, which can be applied to flow cytometry, immunoblotting, tissue and cell immunohistochemistry, HLA-G isomer function research, specific antibody development and screening as a standard reference substance and the like of specific HLA-G isomer molecules (HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7).

Background

Human leukocyte antigen-G (HLA-G) gene, 6.0kb in full length, is located at 6p21.3 distal to the short arm of human chromosome 6. In the process of protein translation, the 1 st exon of HLA-G mRNA encodes a signal peptide, the 2 nd, 3 rd and 4 th exons encode the alpha 1, alpha 2 and alpha 3 domains of the extracellular region respectively, and the 5 th exon encodes a transmembrane region; exon 6 encodes the intracellular segment of the HLA-G molecule containing only 6 amino acid residues; exon 7 is not transcribed due to the presence of a stop codon in exon 6; exon 8 corresponds to the 3' UTR of the HLA-G gene.

The HLA-G initial transcription product can generate 7 mature mRNAs through alternative splicing, and the mature mRNAs respectively code for 7 isomeric molecules with different molecular weights (HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7). HLA-G1 is encoded by full-length HLA-G mRNA and is structurally similar to HLA Ia antigen molecules. HLA-G2 lacks the alpha 2 domain; HLA-G3 lacks the alpha 2 and alpha 3 domains; HLA-G4 lacks the alpha 3 domain; the extracellular domains of HLA-G5 and HLA-G6 are the same as those of HLA-G1 and HLA-G2, respectively, but they are encoded by HLA-G mRNA containing intron 4, and since intron 4 contains a stop codon, the encoded protein molecule lacks the transmembrane region encoded by exon 5, forming a soluble HLA-G molecule. Since intron 2 of the mRNA encoding HLA-G7 contains a stop codon, the extracellular region contains only the α 1 domain and is linked to 2 amino acid residues encoded by intron 2 (FIG. 1). The molecular weights of HLA-G1-G7 isomer molecules are 39kD, 31kD, 23kD, 30kD, 37kD, 27kD and 16kD respectively.

Under physiological conditions, HLA-G molecules are expressed only in extravillous trophoblast cells at maternal-fetal interfaces, and play an important role in maintaining maternal-fetal immune tolerance. Under pathological conditions, HLA-G molecules can be expressed in various tumor cells and tissue cells infected by viruses in an inductive way, and are closely related to the occurrence and the progression of diseases. It is widely recognized that HLA-G molecule is an important immune tolerogenic molecule in vivo, and the immune suppression function of the molecule is mainly to transmit suppression signals and induce immune tolerance by binding immune suppression receptor immunoglobulin-like transcript-2 (immunoglobulin-like transcript-2, ILT2/LILRB1/CD85j) and immune immunoglobulin-like transcript-4 (ILT4/LILRB2/CD85 d). The concrete function mechanism is as follows: combining with ILT2 expressed on T cell, NK cell and B cell to inhibit the activity of T cell and NK cell in killing and the proliferation of B cell and secretion of antibody. ② the combined with ILT2 and ILT4 on Dendritic Cells (DC) can inhibit maturation and differentiation of DC cells and induce generation of tolerant DC cells. ③ the differentiation of M1, which is a pro-inflammatory anti-tumor agent, into M2 cells, which are immune-induced to be resistant, by binding to ILT2 and ILT4 on myeloid-derived suppressor cells (MDSC) and macrophages (M phi). Therefore, HLA-G molecules are important immune tolerance molecules in the body.

In addition, HLA-G binds to receptors ILT2 and ILT4 and has molecular structure specificity. The receptors ILT2, ILT4 bind to HLA-G at the site of the alpha 3 domain of the extracellular domain of HLA-G. ILT2 binds only to the HLA-G/β 2m complex, whereas ILT4 can bind not only to HLA-G/β 2m but also to free HLA-G molecules that do not contain β 2 m. Since HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 have differences in expression mechanism and molecular structure, for example, HLA-G3, -G4 and HLA-G7 do not contain an alpha 3 domain and cannot bind to ILT2 and ILT 4. Thus, different HLA-G isoform molecules may exert specific immunological effects in pathophysiological processes.

In different pathological states, especially in tumor tissue cells, wide heterogeneity exists in HLA-G isomer expression, and the expression of different HLA-G molecular isomers has specific clinical significance. The analysis of the expression of specific HLA-G isomer molecules and the expression profiles of different HLA-G isomer molecules is of great significance for the elucidation of the biological functions and clinical significance of the specific HLA-G isomer molecules.

However, there is no antibody currently available for detecting a specific HLA-G isoform molecule. The antibody 4H84 for detecting the expression of HLA-G molecules through immunohistochemistry or immunoblotting is widely applied at present, the recognition site of the antibody is positioned in the extracellular region alpha 1 domain of all 7 HLA-G isomer molecules, 7 HLA-G isomer molecules containing the alpha 1 domain can be specifically detected, and the expression of specific HLA-G isomer molecules cannot be distinguished in immunohistochemistry. Meanwhile, the molecular weights of HLA-G1-G7 isomer molecules are respectively 39kD, 31kD, 23kD, 30kD, 37kD, 27kD and 16kD, HLA-G isomer molecules with similar molecular weights such as HLA-G1(39kD) and HLA-G5(37kD), HLA-G2(31kD) and HLA-G4(30kD), HLA-G3 (23kD) and HLA-G6(27kD), and HLA-G7(16kD) with smaller molecular weight, etc., and the expression of specific HLA-G isomer molecules is not easy to distinguish in immunoblotting detection due to lack of standard reference of the specific HLA-G isomer molecules. More importantly, in the development process of the antibody aiming at the HLA-G isomer, the HLA-G isomer antigen reference substance is a necessary condition for screening the specific antibody.

Therefore, cell lines for stably expressing 7 HLA-G (HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7) isomer molecules are established, and the cell lines are used as standard reference substances for HLA-G molecule detection and specific antibody screening and have important application values in HLA-G related basis, clinical research and antibody development processes.

Disclosure of Invention

The invention aims to provide a tumor cell strain with 7 HLA-G isomer molecules (HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7) stably expressed, and the cell strain is named as follows: k562 cell line (K562-HLA-G1) expressing HLA-G1 standard protein, K562 cell line (K562-HLA-G2) expressing HLA-G2 standard protein, K562 cell line (K562-HLA-G3) expressing HLA-G3 standard protein, K562 cell line (K562-HLA-G4) expressing HLA-G4 standard protein, K562 cell line (K562-HLA-G5) expressing HLA-G5 standard protein, K562 cell line (K562-HLA-G6) expressing HLA-G6 standard protein, and K562 cell line (K562-HLA-G7) expressing HLA-G7 standard protein. The preservation information is as follows:

k562 cell line (K562-HLA-G1) expressing HLA-G1 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO: C202004, and the preservation time is 1 month and 9 days in 2020. The nucleotide sequence is the Seq No.1.HLA-G1 nucleotide sequence in the sequence table, and the amino acid sequence is the Seq No.2.HLA-G1 amino acid sequence in the sequence table.

K562 cell line (K562-HLA-G2) expressing HLA-G2 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO: C202012, and the preservation time is 1 month and 9 days in 2020. The nucleotide sequence is the Seq No.3.HLA-G2 nucleotide sequence in the sequence table, and the amino acid sequence is the Seq No.4.HLA-G2 amino acid sequence in the sequence table.

K562 cell line (K562-HLA-G3) expressing HLA-G3 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO of C202013, with preservation time of 2020, 1 month and 9 days. The nucleotide sequence is a Seq No.5.HLA-G3 nucleotide sequence in the sequence table, and the amino acid sequence is a Seq No.6.HLA-G3 amino acid sequence in the sequence table.

K562 cell line (K562-HLA-G4) expressing HLA-G4 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO: C202014, and the preservation time is 1 month and 9 days in 2020. The nucleotide sequence is a Seq No.7.HLA-G4 nucleotide sequence in the sequence table, and the amino acid sequence is a Seq No.8.HLA-G4 amino acid sequence in the sequence table.

K562 cell line (K562-HLA-G5) expressing HLA-G5 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO: C202015, and the preservation time is 1 month and 9 days in 2020. The nucleotide sequence is Seq No.9 HLA-G5 in the sequence table, and the amino acid sequence is Seq No.10 HLA-G5 in the sequence table.

K562 cell line (K562-HLA-G6) expressing HLA-G6 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO of C202016, and the preservation time is 2020, 1 and 9 days. The nucleotide sequence is the Seq No.11.HLA-G6 nucleotide sequence in the sequence table, and the amino acid sequence is the Seq No.12.HLA-G6 amino acid sequence in the sequence table.

K562 cell line (K562-HLA-G7) expressing HLA-G7 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO of C202017, and the preservation time is 1 month and 9 days in 2020. The nucleotide sequence is the Seq No.13.HLA-G7 nucleotide sequence in the sequence table, and the amino acid sequence is the Seq No.14.HLA-G7 amino acid sequence in the sequence table.

The address of the China center for type culture Collection is Wuhan university, Wuhan City, Hubei province, China, zip code 430072.

HLA-G isomer molecular heavy chain produced by K562-HLA-G1, K562-HLA-G2, K562-HLA-G3, K562-HLA-G4, K562-HLA-G5, K562-HLA-G6 and K562-HLA-G7 cell strains respectively has a molecular weight of 39kD, and a molecular weight of a protein,31kD, 23kD, 30kD, 37kD, 27kD and 16 kD; light chain, beta 2 microglobulin (beta)₂m), molecular weight 12kDa, encoded by human chromosome 15. The stably expressed HLA-G isomer molecules (HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7) can be applied as standard reference substances in flow cytometry, immunoblotting, cell and tissue immunohistochemistry, HLA-G isomer function research, specific antibody development and screening, and the like.

The tumor cell strain establishment method comprises the following steps: separating HLA-G1-HLA-G7 isomer encoding genes derived from human choriocarcinoma cell strains JEG-3 by adopting a molecular biology method to recombine with eukaryotic cell expression plasmid vectors pVITRO2-mcs, transfecting the genes into a leukemia cell line K562 with negative HLA expression for expression, identifying the expression of transfected cell line HLA-G1-HLA-G7 isomer molecules by adopting various molecular biology methods, and finishing the first round of preliminary screening. Cloning and culturing the preliminarily screened cell strains of the tumor by a limiting dilution method, rescreening to determine the expression level of proteins HLA-G1-HLA-G7, selecting the cell strains with the highest expression level, namely K562-HLA-G1, K562-HLA-G2, K562-HLA-G3, K562-HLA-G4, K562-HLA-G5, K562-HLA-G6 and K562-HLA-G7, preserving with liquid nitrogen at the temperature of 196 ℃, and recovering one tube of cells every 1-2 months to check the cell activity.

And identifying the screened cell strain by combining the traditional cell strain identification and molecular biology identification. The invention adopts RT-PCR (figure 2-1, figure 2-2, figure 2-3, figure 2-4, figure 2-5, figure 2-6, figure 2-7), immunocytochemistry (figure 3), Western blot (figure 4) and flow cytometry (figure 5) and other technical methods to identify the target gene and protein expression, and the whole invention process has the characteristics of simple operation, complete design and the like. The results prove that the molecular weights of the expressed HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 isomers completely accord with the reports in the literature.

The invention establishes a K562 cell line stably expressing HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7, can be applied to flow cytometry, immunoblotting, tissue and cell immunohistochemistry, HLA-G isomer function research and specific antibody development and screening as standard references and the like of HLA-G isomer molecules (HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7), and has important application value.

In the context of this specification, unless otherwise indicated, any technical terms referred to have the meanings commonly understood in the art by those of ordinary skill in the art, and the experimental procedures not specified are performed according to conventional experimental procedures or according to the manufacturer's recommended practice instructions.

Drawings

FIG. 1 is a schematic diagram showing the molecular structures of HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 isomers.

FIGS. 2-1, 2-2, 2-3, 2-4, 2-5, 2-6 and 2-7 are the result diagrams of successful gene sequence sequencing of HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7, respectively.

FIG. 3 is an electrophoresis diagram of the RT-PCR technology for identifying the expression of stably expressed HLA-G isoform molecules HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 mRNA, wherein the molecular weight of Lane 1: a nucleic acid Marker; lanes 2-8: HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 mRNA.

FIG. 4 is a flow cytometry analysis of HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 expression in transfected cells.

FIG. 5 shows the Western blot technique for identifying HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 isoform protein molecular weights in transfected cells, in lane 1: k562-pv cells; lanes 2-8: k562 cell lines stably expressing HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 isomers, respectively.

FIG. 6 shows HLA-G isoforms as standard proteins in antibody development screening, which are exemplified by HLA-G5 and HLA-G6.

FIG. 7 shows the effect of stable expression of HLA-G1 and HLA-G5 isoforms on NK cell function.

Detailed Description

The following examples provide preferred embodiments for carrying out the invention. It will be understood by those skilled in the art that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention in any way. The techniques disclosed in the following examples represent techniques discovered by the present inventors to be effective in practicing the present invention. However, it will be understood by those skilled in the art that various changes in the specific embodiments may be made without departing from the spirit of the invention and still obtain a similar result.

Example 1: HLA-G1-G7 isomer gene clone and pVITRO2-mcs-HLA-G recombinant plasmid construction

RT-PCR amplification of gene sequences encoding HLA-G1 to-G7 isomers containing enzyme cleavage sites, respectively, was carried out on HLA-G1 to-G7 isomer mRNA under the following conditions using human chorionic carcinoma cell line JEG-3 gene as a template. Primer sequences and amplification product lengths are shown in table 1:

TABLE 1 HLA-G1-G7 RT-PCR amplification primer sequences

Note that the capital letter sequences are the endonuclease EcoR I and Xho I sequences.

And (3) PCR reaction system:

H₂O 50μL；Buffer(10×)5μL；Mg²⁺(25mmol/L)2μL；3′-Primer(25μmol/L)2μL； 5′-Primer(25μmol/L)2μL；dNTP(20mmol/L)1μL；Template(10ng/μL)1μL；Taq Polymerase(5U/μL)1μL。

PCR procedure:

pre-denaturation at 1.95 ℃ for 5min

Denaturation at 2.94 deg.C for 60s, annealing at 60 deg.C for 60s, and extension at 72 deg.C for 2min

3. Circulate 35 times according to step 2

Extension at 4.72 ℃ for 10min

Construction of pGEM-T recombinant plasmid containing Gene sequence encoding HLA-G1-G7 isoforms: the HLA-G1 to-G7 genes obtained by PCR amplification are respectively cloned into pGEM-T plasmids and transformed into escherichia coli DH5 alpha for amplification. Extracting the recombinant plasmid, carrying out enzyme digestion identification, and then carrying out sample sequencing to obtain an HLA-G gene sequence which is compared with an http:// www.anthonynolan.org.uk gene sequence, wherein the HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 coding gene sequences are consistent with the HLA-G01: 01:03 sequence. HLA-G1-G7 isoform gene sequencing results (FIG. 2-1, FIG. 2-2, FIG. 2-3, FIG. 2-4, FIG. 2-5, FIG. 2-6, FIG. 2-7).

Construction of recombinant expression plasmid of HLA-G1-G7 isomer encoding gene pVITRO 2-mcs: and (3) respectively carrying out enzyme digestion on the gene fragment containing the endonuclease sites and encoding HLA-G1 to-G7 isomers and the plasmid pVITRO2-mcs obtained in the step (1) by using EcoR I and XhoI. And respectively recovering the coded HLA-G gene fragment containing the enzyme cleavage site after enzyme cleavage and the pVITRO2-mcs plasmid enzyme cleavage product fragment, connecting the coded HLA-G gene fragment and the pVITRO2-mcs plasmid enzyme cleavage product fragment, and respectively constructing HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 recombinant expression plasmid pVITRO 2-mcs-HLA-G. Transferring the recombinant plasmid into escherichia coli DH5 alpha for amplification, extracting the plasmid, and performing enzyme digestion identification on EcoRI and Xho I to prove that the target gene fragment is inserted into the vector plasmid. The cleavage electrophoresis results of the recombinant plasmid are shown in FIG. 3. The detailed sequences of HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 target genes on pVITRO2-mcs-HLA-G plasmids are shown in the sequence table of the invention.

The nucleotide sequence is the Seq No.1.HLA-G1 nucleotide sequence in the sequence table, and the amino acid sequence is the Seq No.2. HLA-G1 amino acid sequence in the sequence table. The nucleotide sequence is the Seq No.3.HLA-G2 nucleotide sequence in the sequence table, and the amino acid sequence is the Seq No.4.HLA-G2 amino acid sequence in the sequence table. The nucleotide sequence is a Seq No.5.HLA-G3 nucleotide sequence in the sequence table, and the amino acid sequence is a Seq No.6.HLA-G3 amino acid sequence in the sequence table. The nucleotide sequence is Seq No.7 HLA-G4 nucleotide sequence in the sequence table, and the amino acid sequence is Seq No.8 HLA-G4 amino acid sequence in the sequence table. The nucleotide sequence is Seq No.9 HLA-G5 in the sequence table, and the amino acid sequence is Seq No.10 HLA-G5 in the sequence table. The nucleotide sequence is the Seq No.11.HLA-G6 nucleotide sequence in the sequence table, and the amino acid sequence is the Seq No.12.HLA-G6 amino acid sequence in the sequence table. The nucleotide sequence is the Seq No.13.HLA-G7 nucleotide sequence in the sequence table, and the amino acid sequence is the Seq No.14.HLA-G7 amino acid sequence in the sequence table.

Example 2: identification of K562 cell line stably expressing HLA-G1-G7 isomers

RT-PCR was used to identify the mRNA expression of HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 isoforms in transfected cells: after total mRNA of each transfected cell strain is respectively extracted by Trizol reagent, formaldehyde is addedNo degradation is observed in the denaturing agarose gel electrophoresis identification, A_260/280The ratio is 2.0019. Mu.l of total mRNA was taken and synthesized by reverse transcription to the first strand cDNA. The PCR reaction parameters are as follows: pre-denaturation at 94 ℃ for 4 min; at 94 ℃ for 1min, at 60 ℃ for 1min and at 72 ℃ for 2min for 35 cycles; finally, extension is carried out for 10min at 72 ℃. 5. mu.l of the PCR product was subjected to agarose gel electrophoresis, and the results were observed. The specific bands of HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 obtained by RT-PCR amplification all accord with the length of the expected target fragment. The results show that HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 isomer molecules are stably expressed in K562 cells (FIG. 3).

Identifying the molecular weight of HLA-G protein in transfected cells by using a Western blot method: 10 μ l of cell lysate was taken for SDS-PAGE. After electroporation, the membrane was blocked with 5% nonfat dry milk for 4h at room temperature and washed with 0.2% TBS (Teween-20 PBS). Adding HLA-G monoclonal antibody 4H84 (recognition site of the antibody is located in HLA-G molecule alpha 1 domain, and all 7 HLA-G isomer molecules can be detected), incubating overnight at 4 deg.C, and washing; adding HRP-labeled rabbit anti-mouse IgG antibody, incubating at room temperature for 30min, washing, and adding DakoREAL ^TMEnVision^TMAnd (5) incubating the detection system (DAKO) for 1-3 min. The research result shows that: the results show that HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 isomer molecules are successfully and stably expressed in K562 cells, the molecular weights of HLA-G1-G7 isomer molecules are respectively 39kD,31kD,23kD,30kD,37kD,27kD and 16kD, and the molecular weights are in accordance with the expectation (FIG. 4). K562 cell line (K562-HLA-G1) expressing HLA-G1 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO: C202004, and the preservation time is 1 month and 9 days in 2020. K562 cell line (K562-HLA-G2) expressing HLA-G2 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO: C202012, and the preservation time is 1 month and 9 days in 2020. K562 cell line (K562-HLA-G3) expressing HLA-G3 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO of C202013, with preservation time of 2020, 1 month and 9 days. K562 cell line (K562-HLA-G4) expressing HLA-G4 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO: C202014, and the preservation time is 1 month and 9 days in 2020. Expression of HLA-G5 marker The K562 cell line of the pseudoprotein (K562-HLA-G5) has the following preservation organization: china center for type culture Collection, the collection numbers are: CCTCC NO: C202015, and the preservation time is 1 month and 9 days in 2020. K562 cell line (K562-HLA-G6) expressing HLA-G6 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO of C202016, and the preservation time is 2020, 1 and 9 days. K562 cell line (K562-HLA-G7) expressing HLA-G7 standard protein, deposited at the institution: china center for type culture Collection, the collection numbers are: CCTCC NO of C202017, and the preservation time is 1 month and 9 days in 2020.

Flow cytometry was used to identify HLA-G protein expression in transfected cells: after the cells were cultured to the logarithmic growth phase, the cells were collected, washed with PBS, and labeled with MEM-G/9 antibody (which has specificity for detecting membrane-bound HLA-G1 and soluble HLA-G5 isomers), and the results showed that: K562-HLA-G1 and HLA-G5 cell lines were used as examples (FIG. 5).

Example 3: HLA-G isomer as standard protein in antibody development screening (FIG. 6)

New antibody 1 development (panel a in fig. 6): after electrotransformation of HLA-G5 and HLA-G6 standard proteins, blocking was performed with 5% nonfat milk powder at room temperature for 4h, and washing was performed with 0.2% TBS (Teween-20 PBS). Adding the new antibody 1, detecting the recognition specificity of the new antibody, incubating overnight at 4 ℃, and washing; adding HRP-labeled rabbit anti-mouse IgG antibody, incubating at room temperature for 30min, washing, and adding Dako REAL ^TMEnVision^TMAnd (5) incubating the detection system (DAKO) for 1-3 min. The results show that: the results show that the novel antibody 1 can specifically recognize HLA-G5 and HLA-G6 standard proteins.

New antibody 2 development (panel B in fig. 6): after electrophoresis of HLA-G1, -G2, -G3, -G4, -G5, -G6 and HLA-G7 standard proteins, they were blocked with 5% nonfat dry milk at room temperature for 4h and washed with 0.2% TBS (Teween-20 PBS). Adding the new antibody 2, detecting the recognition specificity of the new antibody, incubating overnight at 4 ℃, and washing; adding HRP-labeled rabbit anti-mouse IgG antibody, incubating at room temperature for 30min, washing, and adding Dako REAL^TMEnVision^TMAnd (5) incubating the detection system (DAKO) for 1-3 min. The results show that: the results show that the novel antibody 2 can specifically recognize HLA-G5 and HLA-G6 standard proteins.

Development of novel antibody 3: (Panel C in fig. 6): after electrotransformation of HLA-G5 standard protein, blocking was performed with 5% nonfat dry milk for 4h at room temperature, and washing was performed with 0.2% TBS (Teween-20 PBS). Adding immune mouse serum, detecting the recognition specificity, incubating overnight at 4 ℃, and washing; adding HRP-labeled rabbit anti-mouse IgG antibody, incubating at room temperature for 30min, washing, and adding Dako REAL^TMEnVision^TMAnd (5) incubating the detection system (DAKO) for 1-3 min. The results show that: the results show that the serum #1 and #4 of the new antibody 3 mouse already generates antiserum capable of specifically recognizing HLA-G standard protein, and the other mouse sera are nonspecific sera, so that a basis for judging whether the immunized mouse generates specific antibodies is provided.

Example 4: effect of stably expressing HLA-G1 and HLA-G5 isoforms on NK cell function

And (3) respectively culturing the NK-92 cells and K562 cells stably expressing HLA-G1 and HLA-G5 proteins for 4 hours at a ratio of 1:1, collecting cell culture supernatant, and detecting the concentrations of interleukin-2 (IL-2), IL-6, IL-10 and interferon-gamma (IFN-gamma) released by the NK cells in the cell culture supernatant by a magnetic bead flow cytometer. The results showed that HLA-G1 and HLA-G5 proteins had different effects on the release of NK cell cytokines (FIG. 7).

Sequence listing

<110> Taizhou Enze medical center (group)

<120> cell strain expressing HLA-G5 isomer standard protein and application thereof

<160>20

<170>SIPOSequenceListing 1.0

<210>1

<211>1017

<212>DNA

<213>K562-HLA-G1

<400>1

atggtggtca tggcgccccg aaccctcttc ctgctactct cgggggccct gaccctgacc 60

gagacctggg cgggctccca ctccatgagg tatttcagcg ccgccgtgtc ccggcccggc 120

cgcggggagc cccgcttcat cgccatgggc tacgtggacg acacgcagtt cgtgcggttc 180

gacagcgact cggcgtgtcc gaggatggag ccgcgggcgc cgtgggtgga gcaggagggg 240

ccagagtatt gggaagagga gacacggaac accaaggccc acgcacagac tgacagaatg 300

aacctgcaga ccctgcgcgg ctactacaac cagagcgagg ccagttctca caccctccag 360

tggatgattg gctgcgacct ggggtccgac ggtcgcctcc tccgcgggta tgaacagtat 420

gcctacgatg gcaaggatta cctcgccctg aacgaggacc tgcgctcctg gaccgcagcg 480

gacactgcgg ctcagatctc caagcgcaag tgtgaggcgg ccaatgtggc tgaacaaagg 540

agagcctacc tggagggcac gtgcgtggag tggctccaca gatacctgga gaacgggaag 600

gagatgctgc agcgcgcgga cccccccaag acacacgtga cccaccaccc tgtctttgac 660

tatgaggcca ccctgaggtg ctgggccctg ggcttctacc ctgcggagat catactgacc 720

tggcagcggg atggggagga ccagacccag gacgtggagc tcgtggagac caggcctgca 780

ggggatggaa ccttccagaa gtgggcagct gtggtggtgc cttctggaga ggagcagaga 840

tacacgtgcc atgtgcagca tgaggggctg ccggagcccc tcatgctgag atggaagcag 900

tcttccctgc ccaccatccc catcatgggt atcgttgctg gcctggttgt ccttgcagct 960

gtagtcactg gagctgcggt cgctgctgtg ctgtggagga agaagagctc agattga 1017

<210>2

<211>338

<212>PRT

<213>K562-HLA-G1

<400>2

Met Val Val Met Ala Pro Arg Thr Leu Phe Leu Leu Leu Ser Gly Ala

1 5 10 15

Leu Thr Leu Thr Glu Thr Trp Ala Gly Ser His Ser Met Arg Tyr Phe

20 25 30

Ser Ala Ala Val Ser Arg Pro Gly Arg Gly Glu Pro Arg Phe Ile Ala

35 40 45

Met Gly Tyr Val Asp Asp Thr Gln Phe Val Arg Phe Asp Ser Asp Ser

50 55 60

Ala Cys Pro Arg Met Glu Pro Arg Ala Pro Trp Val Glu Gln Glu Gly

65 70 75 80

Pro Glu Tyr Trp Glu Glu Glu Thr Arg Asn Thr Lys Ala His Ala Gln

85 90 95

Thr Asp Arg Met Asn Leu Gln Thr Leu Arg Gly Tyr Tyr Asn Gln Ser

100 105 110

Glu Ala Ser Ser His Thr Leu Gln Trp Met Ile Gly Cys Asp Leu Gly

115 120 125

Ser Asp Gly Arg Leu Leu Arg Gly Tyr Glu Gln Tyr Ala Tyr Asp Gly

130 135 140

Lys Asp Tyr Leu Ala Leu Asn Glu Asp Leu Arg Ser Trp Thr Ala Ala

145 150 155 160

Asp Thr Ala Ala Gln Ile Ser Lys Arg Lys Cys Glu Ala Ala Asn Val

165 170 175

Ala Glu Gln Arg Arg Ala Tyr Leu Glu Gly Thr Cys Val Glu Trp Leu

180 185 190

His Arg Tyr Leu Glu Asn Gly Lys Glu Met Leu Gln Arg Ala Asp Pro

195 200 205

Pro Lys Thr His Val Thr His His Pro Val Phe Asp Tyr Glu Ala Thr

210 215 220

Leu Arg Cys Trp Ala Leu Gly Phe Tyr Pro Ala Glu Ile Ile Leu Thr

225 230 235 240

Trp Gln Arg Asp Gly Glu Asp Gln Thr Gln Asp Val Glu Leu Val Glu

245 250 255

Thr Arg Pro Ala Gly Asp Gly Thr Phe Gln Lys Trp Ala Ala Val Val

260 265 270

Val Pro Ser Gly Glu Glu Gln Arg Tyr Thr Cys His Val Gln His Glu

275 280 285

Gly Leu Pro Glu Pro Leu Met Leu Arg Trp Lys Gln Ser Ser Leu Pro

290 295 300

Thr Ile Pro Ile Met Gly Ile Val Ala Gly Leu Val Val Leu Ala Ala

305 310 315 320

Val Val Thr Gly Ala Ala Val Ala Ala Val Leu Trp Arg Lys Lys Ser

325 330 335

Ser Asp

<210>3

<211>741

<212>DNA

<213>K562-HLA-G2

<400>3

atggtggtca tggcgccccg aaccctcttc ctgctactct cgggggccct gaccctgacc 60

gagacctggg cgggctccca ctccatgagg tatttcagcg ccgccgtgtc ccggcccggc 120

cgcggggagc cccgcttcat cgccatgggc tacgtggacg acacgcagtt cgtgcggttc 180

gacagcgact cggcgtgtcc gaggatggag ccgcgggcgc cgtgggtgga gcaggagggg 240

ccagagtatt gggaagagga gacacggaac accaaggccc acgcacagac tgacagaatg 300

aacctgcaga ccctgcgcgg ctactacaac cagagcgagg ccaacccccc caagacacac 360

gtgacccacc accctgtctt tgactatgag gccaccctga ggtgctgggc cctgggcttc 420

taccctgcgg agatcatact gacctggcag cgggatgggg aggaccagac ccaggacgtg 480

gagctcgtgg agaccaggcc tgcaggggat ggaaccttcc agaagtgggc agctgtggtg 540

gtgccttctg gagaggagca gagatacacg tgccatgtgc agcatgaggg gctgccggag 600

cccctcatgc tgagatggaa gcagtcttcc ctgcccacca tccccatcat gggtatcgtt 660

gctggcctgg ttgtccttgc agctgtagtc actggagctg cggtcgctgc tgtgctgtgg 720

aggaagaaga gctcagattg a 741

<210>4

<211>246

<212>PRT

<213>K562-HLA-G2

<400>4

Met Val Val Met Ala Pro Arg Thr Leu Phe Leu Leu Leu Ser Gly Ala

1 5 10 15

Leu Thr Leu Thr Glu Thr Trp Ala Gly Ser His Ser Met Arg Tyr Phe

20 25 30

Ser Ala Ala Val Ser Arg Pro Gly Arg Gly Glu Pro Arg Phe Ile Ala

35 40 45

Met Gly Tyr Val Asp Asp Thr Gln Phe Val Arg Phe Asp Ser Asp Ser

50 55 60

Ala Cys Pro Arg Met Glu Pro Arg Ala Pro Trp Val Glu Gln Glu Gly

65 70 75 80

Pro Glu Tyr Trp Glu Glu Glu Thr Arg Asn Thr Lys Ala His Ala Gln

85 90 95

Thr Asp Arg Met Asn Leu Gln Thr Leu Arg Gly Tyr Tyr Asn Gln Ser

100 105 110

Glu Ala Asn Pro Pro Lys Thr His Val Thr His His Pro Val Phe Asp

115 120 125

Tyr Glu Ala Thr Leu Arg Cys Trp Ala Leu Gly Phe Tyr Pro Ala Glu

130 135 140

Ile Ile Leu Thr Trp Gln Arg Asp Gly Glu Asp Gln Thr Gln Asp Val

145 150 155 160

Glu Leu Val Glu Thr Arg Pro Ala Gly Asp Gly Thr Phe Gln Lys Trp

165 170 175

Ala Ala Val Val Val Pro Ser Gly Glu Glu Gln Arg Tyr Thr Cys His

180 185 190

Val Gln His Glu Gly Leu Pro Glu Pro Leu Met Leu Arg Trp Lys Gln

195 200 205

Ser Ser Leu Pro Thr Ile Pro Ile Met Gly Ile Val Ala Gly Leu Val

210 215 220

Val Leu Ala Ala Val Val Thr Gly Ala Ala Val Ala Ala Val Leu Trp

225 230 235 240

Arg Lys Lys Ser Ser Asp

245

<210>5

<211>465

<212>DNA

<213>K562-HLA-G3

<400>5

atggtggtca tggcgccccg aaccctcttc ctgctactct cgggggccct gaccctgacc 60

gagacctggg cgggctccca ctccatgagg tatttcagcg ccgccgtgtc ccggcccggc 120

cgcggggagc cccgcttcat cgccatgggc tacgtggacg acacgcagtt cgtgcggttc 180

gacagcgact cggcgtgtcc gaggatggag ccgcgggcgc cgtgggtgga gcaggagggg 240

ccagagtatt gggaagagga gacacggaac accaaggccc acgcacagac tgacagaatg 300

aacctgcaga ccctgcgcgg ctactacaac cagagcgagg ccaagcagtc ttccctgccc 360

accatcccca tcatgggtat cgttgctggc ctggttgtcc ttgcagctgt agtcactgga 420

gctgcggtcg ctgctgtgct gtggaggaag aagagctcag attga 465

<210>6

<211>154

<212>PRT

<213>K562-HLA-G3

<400>6

Met Val Val Met Ala Pro Arg Thr Leu Phe Leu Leu Leu Ser Gly Ala

1 5 10 15

Leu Thr Leu Thr Glu Thr Trp Ala Gly Ser His Ser Met Arg Tyr Phe

20 25 30

Ser Ala Ala Val Ser Arg Pro Gly Arg Gly Glu Pro Arg Phe Ile Ala

35 40 45

Met Gly Tyr Val Asp Asp Thr Gln Phe Val Arg Phe Asp Ser Asp Ser

50 55 60

Ala Cys Pro Arg Met Glu Pro Arg Ala Pro Trp Val Glu Gln Glu Gly

65 70 75 80

Pro Glu Tyr Trp Glu Glu Glu Thr Arg Asn Thr Lys Ala His Ala Gln

85 90 95

Thr Asp Arg Met Asn Leu Gln Thr Leu Arg Gly Tyr Tyr Asn Gln Ser

100 105 110

Glu Ala Lys Gln Ser Ser Leu Pro Thr Ile Pro Ile Met Gly Ile Val

115 120 125

Ala Gly Leu Val Val Leu Ala Ala Val Val Thr Gly Ala Ala Val Ala

130 135140

Ala Val Leu Trp Arg Lys Lys Ser Ser Asp

145 150

<210>7

<211>741

<212>DNA

<213>K562-HLA-G4

<400>7

atggtggtca tggcgccccg aaccctcttc ctgctactct cgggggccct gaccctgacc 60

gagacctggg cgggctccca ctccatgagg tatttcagcg ccgccgtgtc ccggcccggc 120

cgcggggagc cccgcttcat cgccatgggc tacgtggacg acacgcagtt cgtgcggttc 180

gacagcgact cggcgtgtcc gaggatggag ccgcgggcgc cgtgggtgga gcaggagggg 240

ccagagtatt gggaagagga gacacggaac accaaggccc acgcacagac tgacagaatg 300

aacctgcaga ccctgcgcgg ctactacaac cagagcgagg ccagttctca caccctccag 360

tggatgattg gctgcgacct ggggtccgac ggtcgcctcc tccgcgggta tgaacagtat 420

gcctacgatg gcaaggatta cctcgccctg aacgaggacc tgcgctcctg gaccgcagcg 480

gacactgcgg ctcagatctc caagcgcaag tgtgaggcgg ccaatgtggc tgaacaaagg 540

agagcctacc tggagggcac gtgcgtggag tggctccaca gatacctgga gaacgggaag 600

gagatgctgc agcgcgcgga gcagtcttcc ctgcccacca tccccatcat gggtatcgtt 660

gctggcctgg ttgtccttgc agctgtagtc actggagctg cggtcgctgc tgtgctgtgg 720

aggaagaaga gctcagattg a 741

<210>8

<211>246

<212>PRT

<213>K562-HLA-G4

<400>8

Met Val Val Met Ala Pro Arg Thr Leu Phe Leu Leu Leu Ser Gly Ala

1 5 10 15

Leu Thr Leu Thr Glu Thr Trp Ala Gly Ser His Ser Met Arg Tyr Phe

20 25 30

Ser Ala Ala Val Ser Arg Pro Gly Arg Gly Glu Pro Arg Phe Ile Ala

35 40 45

Met Gly Tyr Val Asp Asp Thr Gln Phe Val Arg Phe Asp Ser Asp Ser

50 55 60

Ala Cys Pro Arg Met Glu Pro Arg Ala Pro Trp Val Glu Gln Glu Gly

65 70 75 80

Pro Glu Tyr Trp Glu Glu Glu Thr Arg Asn Thr Lys Ala His Ala Gln

85 90 95

Thr Asp Arg Met Asn Leu Gln Thr Leu Arg Gly Tyr Tyr Asn Gln Ser

100 105 110

Glu Ala Ser Ser His Thr Leu Gln Trp Met Ile Gly Cys Asp Leu Gly

115 120 125

Ser Asp Gly Arg Leu Leu Arg Gly Tyr Glu Gln Tyr Ala Tyr Asp Gly

130 135 140

Lys Asp Tyr Leu Ala Leu Asn Glu Asp Leu Arg Ser Trp Thr Ala Ala

145 150 155 160

Asp Thr Ala Ala Gln Ile Ser Lys Arg Lys Cys Glu Ala Ala Asn Val

165 170 175

Ala Glu Gln Arg Arg Ala Tyr Leu Glu Gly Thr Cys Val Glu Trp Leu

180 185 190

His Arg Tyr Leu Glu Asn Gly Lys Glu Met Leu Gln Arg Ala Glu Gln

195 200 205

Ser Ser Leu Pro Thr Ile Pro Ile Met Gly Ile Val Ala Gly Leu Val

210 215 220

Val Leu Ala Ala Val Val Thr Gly Ala Ala Val Ala Ala Val Leu Trp

225 230 235 240

Arg Lys Lys Ser Ser Asp

245

<210>9

<211>960

<212>DNA

<213>K562-HLA-G5

<400>9

atggtggtca tggcgccccg aaccctcttc ctgctactct cgggggccct gaccctgacc 60

gagacctggg cgggctccca ctccatgagg tatttcagcg ccgccgtgtc ccggcccggc 120

cgcggggagc cccgcttcat cgccatgggc tacgtggacg acacgcagtt cgtgcggttc 180

gacagcgact cggcgtgtcc gaggatggag ccgcgggcgc cgtgggtgga gcaggagggg 240

ccagagtatt gggaagaggagacacggaac accaaggccc acgcacagac tgacagaatg 300

aacctgcaga ccctgcgcgg ctactacaac cagagcgagg ccagttctca caccctccag 360

tggatgattg gctgcgacct ggggtccgac ggtcgcctcc tccgcgggta tgaacagtat 420

gcctacgatg gcaaggatta cctcgccctg aacgaggacc tgcgctcctg gaccgcagcg 480

gacactgcgg ctcagatctc caagcgcaag tgtgaggcgg ccaatgtggc tgaacaaagg 540

agagcctacc tggagggcac gtgcgtggag tggctccaca gatacctgga gaacgggaag 600

gagatgctgc agcgcgcgga cccccccaag acacacgtga cccaccaccc tgtctttgac 660

tatgaggcca ccctgaggtg ctgggccctg ggcttctacc ctgcggagat catactgacc 720

tggcagcggg atggggagga ccagacccag gacgtggagc tcgtggagac caggcctgca 780

ggggatggaa ccttccagaa gtgggcagct gtggtggtgc cttctggaga ggagcagaga 840

tacacgtgcc atgtgcagca tgaggggctg ccggagcccc tcatgctgag atggagtaag 900

gagggagatg gaggcatcat gtctgttagg gaaagcagga gcctctctga agacctttaa 960

<210>10

<211>319

<212>PRT

<213>K562-HLA-G5

<400>10

Met Val Val Met Ala Pro Arg Thr Leu Phe Leu Leu Leu Ser Gly Ala

1 5 10 15

Leu Thr Leu Thr Glu Thr Trp Ala Gly Ser His Ser Met Arg Tyr Phe

20 25 30

Ser Ala Ala Val SerArg Pro Gly Arg Gly Glu Pro Arg Phe Ile Ala

35 40 45

Met Gly Tyr Val Asp Asp Thr Gln Phe Val Arg Phe Asp Ser Asp Ser

50 55 60

Ala Cys Pro Arg Met Glu Pro Arg Ala Pro Trp Val Glu Gln Glu Gly

65 70 75 80

Pro Glu Tyr Trp Glu Glu Glu Thr Arg Asn Thr Lys Ala His Ala Gln

85 90 95

Thr Asp Arg Met Asn Leu Gln Thr Leu Arg Gly Tyr Tyr Asn Gln Ser

100 105 110

Glu Ala Ser Ser His Thr Leu Gln Trp Met Ile Gly Cys Asp Leu Gly

115 120 125

Ser Asp Gly Arg Leu Leu Arg Gly Tyr Glu Gln Tyr Ala Tyr Asp Gly

130 135 140

Lys Asp Tyr Leu Ala Leu Asn Glu Asp Leu Arg Ser Trp Thr Ala Ala

145 150 155 160

Asp Thr Ala Ala Gln Ile Ser Lys Arg Lys Cys Glu Ala Ala Asn Val

165 170 175

Ala Glu Gln Arg Arg Ala Tyr Leu Glu Gly Thr Cys Val Glu Trp Leu

180 185 190

His Arg Tyr Leu Glu Asn Gly LysGlu Met Leu Gln Arg Ala Asp Pro

195 200 205

Pro Lys Thr His Val Thr His His Pro Val Phe Asp Tyr Glu Ala Thr

210 215 220

Leu Arg Cys Trp Ala Leu Gly Phe Tyr Pro Ala Glu Ile Ile Leu Thr

225 230 235 240

Trp Gln Arg Asp Gly Glu Asp Gln Thr Gln Asp Val Glu Leu Val Glu

245 250 255

Thr Arg Pro Ala Gly Asp Gly Thr Phe Gln Lys Trp Ala Ala Val Val

260 265 270

Val Pro Ser Gly Glu Glu Gln Arg Tyr Thr Cys His Val Gln His Glu

275 280 285

Gly Leu Pro Glu Pro Leu Met Leu Arg Trp Ser Lys Glu Gly Asp Gly

290 295 300

Gly Ile Met Ser Val Arg Glu Ser Arg Ser Leu Ser Glu Asp Leu

305 310 315

<210>11

<211>684

<212>DNA

<213>K562-HLA-G6

<400>11

atggtggtca tggcgccccg aaccctcttc ctgctactct cgggggccct gaccctgacc 60

gagacctggg cgggctccca ctccatgagg tatttcagcg ccgccgtgtc ccggcccggc 120

cgcggggagc cccgcttcat cgccatgggc tacgtggacg acacgcagtt cgtgcggttc 180

gacagcgact cggcgtgtcc gaggatggag ccgcgggcgc cgtgggtgga gcaggagggg 240

ccagagtatt gggaagagga gacacggaac accaaggccc acgcacagac tgacagaatg 300

aacctgcaga ccctgcgcgg ctactacaac cagagcgagg ccaacccccc caagacacac 360

gtgacccacc accctgtctt tgactatgag gccaccctga ggtgctgggc cctgggcttc 420

taccctgcgg agatcatact gacctggcag cgggatgggg aggaccagac ccaggacgtg 480

gagctcgtgg agaccaggcc tgcaggggat ggaaccttcc agaagtgggc agctgtggtg 540

gtgccttctg gagaggagca gagatacacg tgccatgtgc agcatgaggg gctgccggag 600

cccctcatgc tgagatggag taaggaggga gatggaggca tcatgtctgt tagggaaagc 660

aggagcctct ctgaagacct ttaa 684

<210>12

<211>227

<212>PRT

<213>K562-HLA-G6

<400>12

Met Val Val Met Ala Pro Arg Thr Leu Phe Leu Leu Leu Ser Gly Ala

1 5 10 15

Leu Thr Leu Thr Glu Thr Trp Ala Gly Ser His Ser Met Arg Tyr Phe

20 25 30

Ser Ala Ala Val Ser Arg Pro Gly Arg Gly Glu Pro Arg Phe Ile Ala

35 40 45

Met Gly Tyr Val AspAsp Thr Gln Phe Val Arg Phe Asp Ser Asp Ser

50 55 60

Ala Cys Pro Arg Met Glu Pro Arg Ala Pro Trp Val Glu Gln Glu Gly

65 70 75 80

Pro Glu Tyr Trp Glu Glu Glu Thr Arg Asn Thr Lys Ala His Ala Gln

85 90 95

Thr Asp Arg Met Asn Leu Gln Thr Leu Arg Gly Tyr Tyr Asn Gln Ser

100 105 110

Glu Ala Asn Pro Pro Lys Thr His Val Thr His His Pro Val Phe Asp

115 120 125

Tyr Glu Ala Thr Leu Arg Cys Trp Ala Leu Gly Phe Tyr Pro Ala Glu

130 135 140

Ile Ile Leu Thr Trp Gln Arg Asp Gly Glu Asp Gln Thr Gln Asp Val

145 150 155 160

Glu Leu Val Glu Thr Arg Pro Ala Gly Asp Gly Thr Phe Gln Lys Trp

165 170 175

Ala Ala Val Val Val Pro Ser Gly Glu Glu Gln Arg Tyr Thr Cys His

180 185 190

Val Gln His Glu Gly Leu Pro Glu Pro Leu Met Leu Arg Trp Ser Lys

195 200 205

Glu Gly Asp Gly Gly Ile Met Ser Val Arg Glu Ser Arg Ser Leu Ser

210 215 220

Glu Asp Leu

225

<210>13

<211>363

<212>DNA

<213>K562-HLA-G7

<400>13

atggtggtca tggcgccccg aaccctcttc ctgctactct cgggggccct gaccctgacc 60

gagacctggg cgggctccca ctccatgagg tatttcagcg ccgccgtgtc ccggcccggc 120

cgcggggagc cccgcttcat cgccatgggc tacgtggacg acacgcagtt cgtgcggttc 180

gacagcgact cggcgtgtcc gaggatggag ccgcgggcgc cgtgggtgga gcaggagggg 240

ccagagtatt gggaagagga gacacggaac accaaggccc acgcacagac tgacagaatg 300

aacctgcaga ccctgcgcgg ctactacaac cagagcgagg ccagtgagta actccggccc 360

agg 363

<210>14

<211>116

<212>PRT

<213>K562-HLA-G7

<400>14

Met Val Val Met Ala Pro Arg Thr Leu Phe Leu Leu Leu Ser Gly Ala

1 5 10 15

Leu Thr Leu Thr Glu Thr Trp Ala Gly Ser His Ser Met Arg Tyr Phe

20 25 30

Ser Ala Ala Val Ser Arg Pro Gly Arg Gly Glu Pro Arg Phe IleAla

35 40 45

Met Gly Tyr Val Asp Asp Thr Gln Phe Val Arg Phe Asp Ser Asp Ser

50 55 60

Ala Cys Pro Arg Met Glu Pro Arg Ala Pro Trp Val Glu Gln Glu Gly

65 70 75 80

Pro Glu Tyr Trp Glu Glu Glu Thr Arg Asn Thr Lys Ala His Ala Gln

85 90 95

Thr Asp Arg Met Asn Leu Gln Thr Leu Arg Gly Tyr Tyr Asn Gln Ser

100 105 110

Glu Ala Ser Glu

115

<210>15

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

tcgagaattc atggtggtca tggcgccccg aa 32

<210>16

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

tcgactcgag tcaatctgag ctcttctt 28

<210>17

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

tcgagaattc atggtggtca tggcgccccg aa 32

<210>18

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

tcgactcgag ccaccgaccc tgtta 25

<210>19

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

tcgagaattc atggtggtca tggcgccccg aa 32

<210>20

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

tcgactcgag cctgggccgg agtta 25

Claims

1. Cell lines expressing HLA-G5 isomer standard protein, the preservation organization is: china center for type culture Collection, the collection numbers are: CCTCC NO: C202015.

2. The cell line of claim 1, which expresses HLA-G5 isomer standard protein, and is used as standard protein for expressing HLA-G5 isomer, and the expressed HLA-G5 isomer standard protein is used as standard reference substance.

3. The cell line of claim 1, which expresses HLA-G5 isomer standard protein, is used as standard protein for expressing HLA-G5 isomer, and the expressed HLA-G5 isomer standard protein is used as standard reference for human leukocyte antigen-G isomer molecule HLA-G5 flow cytometry, immunoblotting, tissue and cell immunohistochemistry, HLA-G isomer function research and specific antibody development and screening.