CN111849787A - Endophytic fungus and application thereof in dye pollutant treatment - Google Patents

Abstract

The invention provides an endophytic fungus and application thereof in dye pollutant treatment, wherein the endophytic fungus is a pure culture strain separated from blueberry fruits by adopting a tissue imprinting method, is determined to be Penicillium janthinillum (Penicillium janthinillum) through molecular biological identification, and is named as Penicillium janthinillum LM 5; is preserved in China center for type culture Collection with the preservation number of CCTCC NO: m2019965; the endophytic fungi can be used for treating dye pollutants, and has the characteristics of good adsorption effect, multiple types of degradation substrates, simple operation, easy solid-liquid separation, low cost, environmental protection and the like.

Description

Endophytic fungus and application thereof in dye pollutant treatment

Technical Field

The invention relates to the technical field of endophytic fungi, and particularly relates to an endophytic fungus and application thereof in dye pollutant treatment.

Background

The problem of resource environmental constraints accumulated in the long-term rapid development is increasingly highlighted, wherein fresh water pollution caused by dyes has become one of the prominent environmental problems. The pollutants not only pollute water body and aggravate the situation of water resource shortage in China, but also seriously destroy ecological balance and harm human health due to biotoxicity and three causing effects (teratogenicity, carcinogenicity and mutagenicity). According to statistics, the dye variety on the market is more than 10 ten thousand, the annual dye yield is more than 70 ten thousand tons, wherein more than 10 percent of the dye is directly discharged into rivers and lakes during the production and use processes, so that the water environment pollution is deep from the surface to the underground.

The biological treatment method mainly completes the separation and degradation of pollutants in the wastewater through flocculation, adsorption, biotransformation and biological degradation of microbial thalli. The method has the advantages of low treatment cost, small sludge production, small secondary pollution to the environment, no need of special equipment, good economic effect and environmental effect, and the like, and is a research hotspot for treating dye wastewater. A large amount of dye degradation microorganisms are screened at home and abroad. To date, a number of strains have been isolated that have the ability to degrade organic dyes. However, the currently reported dye-degrading strains generally have the problems of narrow degradation spectrum, difficulty in recycling and the like, so that the application of the dye-degrading strains is limited.

Disclosure of Invention

Aiming at the problems in the background technology, the invention provides an endophytic fungus and application thereof in dye pollutant treatment, wherein the endophytic fungus can be used for dye pollutant treatment and has the characteristics of good adsorption effect, multiple degradation substrate types, simple operation, easy solid-liquid separation, low cost, environmental protection and the like.

In order to achieve the purpose, the invention is realized by the following technical scheme:

an endophytic fungus, wherein the endophytic fungus is deposited in the China center for type culture Collection. The endophytic fungus is a new strain LM5 of Penicillium microphyllum (Penicillium janthinellum) of Calycoaceae (Discellaceae) of Chitosales (Sphaeropsidales). Blueberry fruits collected from post-: CCTCC NO: m2019965, deposited under the name Penicillium janthinellum LM5, and the ITS sequence of the endophytic fungus has the accession number MT459414 in the Genbank database.

In addition, the invention provides a preparation method of the endophytic fungi, and the endophytic fungi are pure culture strains separated from blueberry fruits by adopting a tissue blotting method.

The endophytic fungus strain has the ability of utilizing dye pollutant to grow and can be used for biological treatment of printing and dyeing wastewater.

The endophytic fungus strain forms mycelium pellets in a PDB culture solution containing dye, and the surface of the mycelium is in a wrinkle shape.

The dye contaminants are azo dyes, triphenylmethane, metal complex structures and heterocyclic dyes.

The dye contaminants are selected from Congo Red, chrome Black T, amide Black 10B, methyl Red, Crystal Violet, acid fuchsin, Peacock Green, Naphthol Green B, and neutral Red.

The invention has the beneficial effects that:

the endophytic fungus is a pure culture strain separated from blueberry fruits by adopting a tissue imprinting method, has a good degradation treatment effect on dye pollutants such as azo dyes, triphenylmethane, metal complex structures, heterocyclic dyes and the like, is good in adsorption effect, short in treatment time and high in efficiency, can effectively degrade various dye pollutants, and has a good use effect in dye pollutant treatment. The endophytic fungi for treating dye pollutants has the advantages of simple integral operation, low cost, easy solid-liquid separation and environmental protection.

Drawings

FIG. 1 is a diagram showing the growth of the endophytic fungi of the invention after 8 days of culture.

FIG. 2 is an optical microscope photograph of an endophytic fungal spore according to the invention.

FIG. 3 is a scanning electron micrograph of a mycelial sphere in a liquid medium of an endophytic fungus of the present invention.

FIG. 4 is a graph showing the effect of fungal endophytes on treatment with different dyes.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1: isolation and screening of endophytic fungi

Separating and screening by adopting a tissue blotting method, wherein the separating and screening method comprises the following steps: taking a proper amount of fresh blueberries, cleaning, sterilizing the blueberries in 75% ethanol for 1min on a superclean bench, soaking the blueberries in sterile water for 20s, sterilizing the blueberries in 10% sodium hypochlorite solution for 3min, washing the blueberries with the sterile water for 5 times, and coating the sterile water washed for the last time on a TWA solid separation culture medium to detect whether the sterilization is complete or not. And (3) sucking up liquid remained on the blueberries by using sterile filter paper, then cutting each blueberry into 3-4 pieces, and blotting the blueberry onto TWA solid separation culture medium, wherein each culture dish filled with the TWA solid separation culture medium is blotted for 5 pieces. The formula of the TWA solid separation culture medium is 8g of agar powder and 1000mL of deionized water, and the TWA solid separation culture medium is autoclaved at 121 ℃ for 15 min.

After inoculation, the culture dish is sealed by a sealing film and is placed in a constant temperature incubator at 28 ℃ for 8-10 days in a dark place. Meanwhile, a sterile water detection method is adopted to check the disinfection effect, a pipette is used to suck 1mL of sterile water washed for the last time in the disinfection process to the surface of the TWA culture medium, a coating rod is used to coat the sterile water evenly, the TWA culture medium is placed in a thermostat at 28 ℃ for culture for 8-10 days, and if no bacterial colony appears in a culture dish, the disinfection is proved to be thorough.

Then pure culture is carried out by adopting PDA solid culture medium or PDB liquid culture medium.

Pure culture is carried out by adopting a PDA solid culture medium, and the preparation method of the PDA solid culture comprises the following steps: cleaning and peeling potato, weighing 100g, slicing, adding 500mL of water, boiling for about 30min, filtering with three layers of gauze to 500mL of conical flask, adding 10g of glucose and 10g of agar, stirring and mixing uniformly with a glass rod, slightly cooling, adding water to 500mL, sealing with a cotton plug, autoclaving at 121 ℃ for 20min, cooling to 60 ℃, taking out, pouring a flat plate or placing an inclined plane under aseptic condition, and preparing into a flat plate or inclined plane test tube culture medium.

After the culture, the bacterial colony (the endophytic fungi of the invention) on the culture medium is grayish green, the edge is light yellow, the matrix is yellow, the aerial hyphae are rich, dense and flocculent, and the edge is clear, as shown in figure 1. The hyphae contain transverse septa, when spores are produced, the conidiophores at the top of the hyphae consist of a plurality of cells, the terminal cells of each branch form broom-shaped and contain conidia which are divided into clusters, as shown in figure 2.

When pure culture is performed by using PDB liquid culture medium, mycelium pellet is formed in the culture medium, and the mycelium pellet is fluffy and fluffy under an electron microscope, as shown in figure 3.

The endophytic fungus is a new species of penicillium microphyllum (Penicillium janthinellum) of Califormes (Discellaceae) of Chimonales by adopting a pure culture strain separated from blueberry fruits by a tissue blotting method.

DNA of endophytic fungi is extracted by the kit, and the DNA is amplified and sequenced by ITS1/ITS4 primers, and the rDNA-ITS sequence of the endophytic fungi is as follows:

CTGGGTCCACCTCCCACCCGTGTTTATCGTACCTAGTTGCTT CGGCGGGCCCGCCGTTAAGGCCGCCGGGGGCATCTGCCCCCGG GCGCGCGCCCGCCGAAGACCCCCCTGAACGCTGTCTGAAGATT GTCGTCTGAGCGATTAGCTAAATCAGTTAAAACTTTCAACAACG GATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTT GAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTC CGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCT TCGCCCCCCGGCTCCCGGGGGGCGGGCCCGAAAGGCAGCGGC GGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCG CTCTGCAGGCCCGGCCGGCGCCCGCCGGCGACCCCCCTCAATC TTTCTCAGGTGACCT

the pure culture strain obtained by tissue blotting separation is the endophytic fungi of the embodiment, and is preserved in China center for type culture Collection (address: China, Wuhan university, zip code 430072) in 11 months and 22 days in 2019, with the preservation number: CCTCC NO: m2019965, deposited under the name Penicillium janthinellum LM5, the ITS sequence of this endophytic fungus has the accession number MT459414 in the Genbank database.

Example 2: application of endophytic fungi in dye pollutant treatment

The preparation method of the endophytic fungi liquid culture medium comprises the following steps: PDB liquid culture media containing neutral red, congo red, amido black 10B, fuchsin, methyl red, naphthol green B and cadmium black T dyes at a concentration of 500mg/L were prepared, respectively: cleaning and peeling potatoes, weighing 100g, cutting into slices, adding 500mL of water, boiling for about 30min, filtering to 500mL of conical bottles by using gauze, adding 10g of glucose and 10g of agar, uniformly stirring by using a glass rod, slightly cooling, then adding water to 500mL, subpackaging to 100mL of triangular bottles, quantifying 30mL of each triangular bottle, sealing by using a rubber plug, carrying out autoclaving at 121 ℃ for 20min, taking out the triangular bottles when the temperature is reduced to 50 ℃ after the sterilization is finished, transferring to a clean bench, cooling to room temperature, respectively taking 1.5mL of 10g/L neutral red, fruit red, amide black 10B, fuchsin, methyl red, naphthol green B and cadmium black T dyes filtered by a 0.22 mu m membrane to 30mL of PDB liquid culture solution, and carrying out natural pH condition.

The method for treating the dye by the endophytic fungi comprises the following steps: 0.1mL of 10⁸Adding cfu/mL endophytic fungal spore suspension into the liquid culture medium, shaking and culturing at 28 deg.C and 150rpm for 24-72h,the color change of the dye was observed, and the result is shown in FIG. 4. Wherein endophytic fungi strains form mycelium pellets in the PDB culture solution containing dye, and the surface of the mycelium is in a wrinkle shape.

As can be seen from figure 4, the endophytic fungi of the invention have different degrees of decolorization effects on 7 dyes, wherein the decolorization effect on Congo red is the best, and the decolorization rate reaches 100% in 24 hours. Therefore, the endophytic fungi can effectively remove various dyes and can be used for treating the dyes.

The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.

Claims (6)

1. The endophytic fungi is preserved in China center for type culture Collection, and the preservation number is CCTCC NO: m2019965; the endophytic fungus is a novel strain LM5 of Penicillium janthinellum.

2. The endophytic fungus according to claim 1, wherein the endophytic fungus is a pure culture strain isolated from blueberry fruit by a tissue blotting method.

3. Use of an endophytic fungus according to claim 1 in the treatment of dye contaminants, wherein the strain of endophytic fungus has the ability to grow on dye contaminants and can be used for the biological treatment of printing and dyeing wastewater.

4. The use of an endophytic fungus according to claim 3 in dye contamination treatment, wherein the endophytic fungus strain forms mycelial pellets in a dye-containing PDB culture solution, and the surface of the mycelial pellets is wrinkled.

5. Use of an endophytic fungus according to claim 3 in the treatment of dye contaminants, wherein the dye contaminants are azo dyes, triphenylmethane, metal complex structures and heterocyclic dyes.

6. Use of an endophytic fungus according to claim 5 in the treatment of dye contaminants, wherein the dye contaminants are selected from the group consisting of Congo red, chrome Black T, amido Black 10B, methyl Red, Crystal Violet, acid fuchsin, Malachite Green, Naphthol Green B and neutral Red.

Images