CN111840355B - Application of tripterygium glycosides tablets in preparation of medicine for treating CAR-T induced cytokine release syndrome - Google Patents

Application of tripterygium glycosides tablets in preparation of medicine for treating CAR-T induced cytokine release syndrome Download PDF

Info

Publication number
CN111840355B
CN111840355B CN202010778038.7A CN202010778038A CN111840355B CN 111840355 B CN111840355 B CN 111840355B CN 202010778038 A CN202010778038 A CN 202010778038A CN 111840355 B CN111840355 B CN 111840355B
Authority
CN
China
Prior art keywords
tripterygium glycosides
car
crs
patients
treatment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010778038.7A
Other languages
Chinese (zh)
Other versions
CN111840355A (en
Inventor
朱学军
孔祥图
徐祖琼
代兴斌
陈碧清
田芳
姜鹏君
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu Provincial Hospital of Chinese Medicine
Original Assignee
Jiangsu Provincial Hospital of Chinese Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Provincial Hospital of Chinese Medicine filed Critical Jiangsu Provincial Hospital of Chinese Medicine
Priority to CN202010778038.7A priority Critical patent/CN111840355B/en
Publication of CN111840355A publication Critical patent/CN111840355A/en
Application granted granted Critical
Publication of CN111840355B publication Critical patent/CN111840355B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/37—Celastraceae (Staff-tree or Bittersweet family), e.g. tripterygium or spindletree
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/20—Pills, tablets, discs, rods
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Abstract

The invention discloses application of tripterygium glycosides tablets in preparing a medicine for treating CAR-T induced cytokine release syndrome. The research of the invention finds that the tripterygium glycosides tablet taking tripterygium glycosides as the main component can quickly restrain IL-6, IL-8, IL-2, IL-10, IL-1 beta, IFN alpha, IFN gamma and the like, has quick effect, can selectively clear mononuclear cells activated by peripheral blood by taking the tripterygium glycosides tablet with low dosage orally, quickly restrain CRS generated after CAR-T treatment, has no influence on CAR-T cells in vivo, can provide a treatment method with quick effect, effectiveness, safety and convenience for CRS, has good cost-benefit ratio and can greatly reduce the clinical treatment cost of patients. In addition, CRS, which occurs in severe patients after infection with the novel coronavirus (COVID-19), is expected to have a positive therapeutic effect.

Description

Application of tripterygium glycosides tablets in preparation of medicine for treating CAR-T induced cytokine release syndrome
Technical Field
The invention belongs to the field of medicines, and particularly relates to a new medical application of triptolide tablets, more particularly to an application of triptolide in preparing a medicine for treating CAR-T-induced cytokine release syndrome.
Background
The main component of the tripterygium glycosides tablet is tripterygium glycosides (tripterygium glycosides), which is a stable glucoside extracted and refined from tripterygium wilfordii Hook F (TwHF, LeigongTeng, Thunder God Vine) root of Celastraceae by chloroform/methanol, the physiological activity of the tripterygium glycosides tablet is synergistically generated by various components (diterpene lactone, alkaloid, triterpene, etc.), the immunosuppressive effect of tripterygium crude drug is kept, and a plurality of toxic components are removed. Tripterygium glycosides tablets, as a Chinese patent drug, have proven to be an effective anti-inflammatory and immunomodulatory drug approved by the Chinese food and drug administration (Z32021007) for the treatment of autoimmune and inflammatory diseases, and since 1982 have been widely used in China as prescription drugs for the treatment of rheumatoid arthritis, primary glomerulonephritis, nephrotic syndrome, purpuric and lupus nephritis, lupus erythematosus, subacute and chronic severe hepatitis, chronic active hepatitis; it can also be used for treating allergic cutaneous vasculitis, dermatitis and eczema, as well as psoriatic arthritis, leprosy, behcet's disease, recurrent aphtha, ankylosing spondylitis, etc., and in recent years, with the deepening of clinical research, the application range thereof is continuously expanded, such as treating children anaphylactoid purpura nephritis, chronic urticaria, sicca syndrome, Graves eye disease, etc., all of which have certain curative effect.
Transgenic T cells expressing chimeric antigen receptors open up a new field of cancer immunotherapy, but often complicated by Cytokine Release Syndrome (CRS), have high incidence, show transient and significant increase of a large amount of cytokines and a series of clinical symptoms, seriously endanger the life of patients, and are main adverse events limiting the wide application of CAR-T cell therapy.
Treatment of CRS is usually preceded by steroids, which may be combined with trastuzumab infusion therapy for CRS characterized by hyperthermia, hypotension and hypoxia. In recent years, a series of improved strategies have been proposed, including modification of CAR-T to reduce the occurrence of CRS, neutralization to remove GM-CSF in vivo, inhibition of CAR-T cells using dasatinib, etc., but these strategies are still difficult to control CRS well at present. Current methods of treating CRS are primarily using tocilizumab (tocilizumab) and hormones. The efficacy of treatment of CRS with tuzumab is not ideal and may be associated with its ability to only clear IL-6; the hormone can effectively inhibit CRS, but when the hormone is used for treating CRS, most CAR-T cells can be subjected to apoptosis, the long-term curative effect of CAR-T is influenced, and the infection is easy to be complicated or aggravated.
Two recent independent model systems prove that monocytes/macrophages in mice are the main source of CRS cytokines, and the application of the clodronate liposome to remove the macrophages and monocytes in the mice can prevent the generation and death of CRS, but the clodronate liposome cannot be used for human bodies due to great toxic and side effects; etoposide is thought to be more capable of removing activated monocytes than other chemotherapeutic agents, but is less effective and has the potential to exacerbate hematopoietic suppression. Therefore, effective drugs capable of selectively removing monocytes in the human body are still lacking at present.
Previous studies show that tripterygium glycosides and triptolide have immunosuppressive effects, mainly focusing on the immunoregulation of T cells and B cells, and have few studies on myeloid cells. In 2011 Titov and the like prove that the triptolide has an XPB action target spot and realizes the biological effect by inhibiting RNA enzyme transcription; in 2013, Lu et al report that TAB1 is an action target of triptolide, and 30nM triptolide can inhibit the activity of mouse macrophage TAK1 kinase after being treated in vitro for 12h, which suggests that TAB1 may be a potential therapeutic target of inflammatory diseases. However, it is not clear whether Tripterygium glycosides can suppress CRS by eliminating monocytes in humans.
Disclosure of Invention
The purpose of the invention is as follows: the invention unexpectedly discovers the application of tripterygium glycosides tablets in preparing medicines for treating CAR-T induced cytokine release syndrome.
In particular, the invention finds that CAR-T induced cytokine release syndrome can be effectively treated by administering a safe and effective amount of tripterygium glycosides tablets.
The main component of the tripterygium glycosides tablet is tripterygium glycosides.
The tripterygium glycosides tablet of the invention is a tablet prepared by taking tripterygium glycosides as a main component, and comprises but is not limited to a finished product of tripterygium glycosides tablet sold in the market.
The study shows that the dosage of tripterygium glycosides tablet is 0.25-2mg/kg body weight per day, preferably 0.5-1mg/kg body weight per day.
The research of the invention proves that the tripterygium glycosides tablets can selectively eliminate mononuclear cells in peripheral blood of CRS patients.
Furthermore, the research of the invention finds that the tripterygium glycosides tablet improves high fever, hypoxia, hypotension and cytokine storm caused by CRS after CAR-T treatment, and inhibits IL-6, IL-8, IL-2, IL-10, IL-1 beta, IFN alpha and IFN gamma, thereby relieving CRS and reducing mortality.
Has the advantages that:
the research of the invention finds that the tripterygium glycosides tablet can quickly restrain IL-6, IL-8, IL-2, IL-10, IL-1 beta, IFN alpha, IFN gamma and the like, has quick effect, can selectively clear mononuclear cells activated by peripheral blood by taking the tripterygium glycosides tablet with low dosage orally, quickly restrain CRS generated after CAR-T treatment, has no influence on CAR-T cells in vivo, possibly provides a treatment method with quick, effective, safe and convenient effect for CRS, has good cost-benefit ratio, and can greatly reduce the clinical treatment cost of patients.
It is further noted that patients infected with the novel coronavirus (COVID-19) have similar clinical manifestations as CRS that occurs after CAR-T treatment, with high fever, hypoxia and hypotension, and with cytokine storm, our findings are suggestive of treatment of COVID-19 infection.
Drawings
FIG. 1 is a graph of the results of the effect of tripterygium glycosides tablets on monocytes and CAR-T cells in a patient's blood;
FIG. 2 is a graph showing the results of bone marrow MRD assays in patients receiving Tripterygium Wilfordii polyglycoside tablets after CAR-T cell reinfusion;
FIG. 3 is a graph showing the results of treating tripterygium glycosides with CRS.
Detailed Description
The present invention will be described in further detail with reference to specific examples. The examples will help to understand the present invention given the detailed embodiments and the specific operation procedures, but the scope of the present invention is not limited to the examples described below.
The tripterygium glycosides tablets used in the following embodiments are prepared by Zhejiang Deende pharmaceutical Co., Ltd, and the Chinese medicine standard Z33020422 is 10 mg/tablet.
Example 1 Tripterygium glycosides tablets selectively clear peripheral blood mononuclear cells from patients in vivo without affecting CAR-T cells.
1) 2 patients diagnosed with CRS after CAR-T cell infusion were treated with oral low dose tripterygium glycosides tablets three times daily at 10 mg/dose (total daily dose 0.5mg/kg), and discontinued after taking 5 tripterygium glycosides tablets (50 mg) within 36 hours.
2) Taking anticoagulated peripheral blood at different time points before and after taking medicine, taking 200 μ l of anticoagulated peripheral blood, adding 5ml flow cell tube, adding fluorescence labeled antibody HLA-DR-PE, CD14-FITC, incubating on ice for 30min, lysing erythrocytes, and detecting with flow cytometer.
3) qPCR determination of CAR-T cell copy number: EDTA (ethylene diamine tetraacetic acid) anticoagulated whole blood samples are collected at different time points before and after the administration of the medicine, and genomic DNA (deoxyribonucleic acid) is extracted from PBMC (peripheral blood mononuclear cell). To quantify the copy number per unit of DNA, 102To 106The copy of the CTL019 lentiviral plasmid was inserted into 100ng of untransformed control genomic DNA to form a 5-point calibration curve. The qPCR analysis used the SYBR-Green method and 100ng of genomic DNA was used at each time point to detect the integration sequence of the CD19-CAR gene. CDKN1A gene and WPRE upstream non-transcribed genomic region specific primers, as described below.
CDKN1A:Forward:gaaagctgactgcccctatttg，Reverse:gagaggaagtgctgggaacaat；
WPRE:Forward:ccttttacgctatgtggatacg，Reverse:ccaggatttatacaaggaggaga。
4) MRD analysis: multiparameter flow cytometry monitoring MRD, analysis by Kaluza software. The antibody group for detecting minimal residual disease was c-kappa, c-lambda, CD38, CD45, CD19, CD27, CD138, CD56 of patient 1, and HLA-DR, CD13, CD33, CD19, CD10, CD34, CD20, CD45 of patient 2.
5) As a result:
2 patients diagnosed with CRS after CAR-T cell infusion received oral low dose tripterygium glycosides tablets, and flow cytometry analysis showed that the tripterygium glycosides tablets selectively removed monocytes in the patients (FIG. 1A, FIG. 1B) without affecting the number of CAR-T cells (FIG. 1C, FIG. 1D). At the same time, the results of leukemia Minimal Residual Disease (MRD) detection in bone marrow of two patients after 3 weeks of CAR-T infusion were negative (FIG. 2), indicating that the treatment with Tripterygium glycosides did not affect the anti-tumor function of CAR-T cells.
Example 2 tripterygium glycosides tablets rapidly arrest CRS.
Patient 1 was diagnosed with multiple myeloma (IgD, lambda type) in 2017, age 53. His baseline karyotype was 46, XY, + add (1) (p11), -3, del (3) (q13), add (9) (q34), del (11) (p12), add (14) (q32), -17, 18, add (20) (q11), add (22) (q11), +2mar, inc [20 ], [20 ]]. Patients initially responded partially to lenalidomide, bortezomib and dexamethasone treatment, but the disease worsened after 6 months. Then received 3 cycles of VCLD regimen chemotherapy (bortezomib, cyclophosphamide, lenalidomide and dexamethasone). Subsequent treatment regimens include lenalidomide, bmidide, melphalan, vinblastine, epirubicin, and arsenite. The patient had bone destruction and anemia exacerbated and bone marrow biopsy revealed 52% multiple myeloma cells. In 11 months 2019, patients participated in a clinical trial of anti-CD 19/BCMA-CAR-T cell therapy. Patient autologous T cells were transfected with lentiviruses to express CD 19-specific and BCMA-specific chimeric antigen receptors, respectively, and expanded with anti-CD 3 and anti-CD 28 antibodies. 2 days before cell infusion, patients received chemotherapy pretreatment (fludarabine dose 30 mg/m)2Body surface area, cyclophosphamide dose 600mg/m2) Thereafter the patient was infused 7.75X 107CD3+ cells (0.52X 10 cells/kg)6CD19-CART cells), followed by infusion of 7.75 x 107CD3+ cells (0.52X 10 cells/kg)6BCMA-CART cells).
CRS symptoms appeared in patients on day 4 after CAR-T cell infusion, and include fever with chills, fatigue, myalgia, systemic debilitation, persistent tachycardia (pulse peak of 141 beats per minute), tachypnea, intermittent hypoxia but response to oxygen uptake (3L/min). High fever lasted from day 6 with a maximum temperature of 39.9 ℃, no fever abated by oral acetaminophen, and sustained hypotension (systolic blood pressure decreased to 78mmHg) and cytokine storm, i.e., IL-6 increased to 70 × ULN and impaired liver and kidney function, with patients diagnosed with quaternary CRS. The patient is orally administered with low-dose tripterygium glycosides tablet (Zhejiang Ender pharmaceutical Co., Ltd., Chinese medicine standard Z33020422, 10mg) three times a day after 48 hours of continuous high fever (>38.5 ℃), and is stopped after 10mg of tripterygium glycosides tablet is taken within 36 hours (total dose per day is 0.5 mg/kg).
As a result:
the body temperature of the patient is firstly reduced to a normal level only 8 hours after the tripterygium glycosides tablet is taken for the first time (figure 3A), the IL-6 and IFN-gamma levels are recovered to be normal 72 hours after the tripterygium glycosides tablet is taken for the last time, the IL-8 and IL-10 levels are also close to normal (figure 3B), but the liver and kidney function damage of the patient continues to progress, the patient receives methylprednisolone and continuous kidney replacement therapy, the body temperature and serum cytokine levels are recovered to be normal after 12 hours, inflammation indexes such as PCT, LDH, CRP and the like are rapidly reduced and recovered to be normal (figure 3C), and the liver and kidney function is gradually recovered to be normal (figure 3D).
Example 3 treatment with tripterygium glycosides rapidly suppresses CRS.
Patient 2 of this example was a 55 year old female with B-ALL diagnosed in 2017. Patients achieved complete remission after initial treatment, but relapsed 15 months after initial diagnosis of B-ALL. She did not respond to re-chemotherapy and further intensive chemotherapy including vindesine, epirubicin and cyclophosphamide. The patients participated in a clinical trial of anti-CD 19-CAR-T cell therapy. Patient autologous T cells were transfected with lentiviruses to express CD 19-specific chimeric antigen receptors, respectively. 2 days before cell infusion, patients received chemotherapy pretreatment (fludarabine dose 30 mg/m)2Body surface area, cyclophosphamide dose 600mg/m2) Thereafter the patient is infused with 1.31X 106CD3+ cells (0.52X 10 cells/kg)6CD19-CART cells).
Patients developed high fever at day 7 after CAR-T cell reinfusion, oral acetaminophen failed to abate fever, and patients were diagnosed with secondary CRS. On day 9 after CAR-T cell reinfusion, patients were given oral tripterygium glycosides tablets for treatment. Taken three times a day, 10mg each time (total daily dose 0.5mg/kg), 5 tripterygium glycosides tablets (50 mg) taken within 36 hours, and then stopped taking.
As a result:
after 36 hours of taking the tripterygium glycosides tablet for the first time, the patient has the tachycardia disappeared, the body temperature is reduced to be normal (figure 3A), the cell factor storm is rapidly relieved, IL-2 and IFN-alpha are recovered to be normal, IL-10 and IL-1 beta are recovered to be normal 60 hours after the tripterygium glycosides tablet is taken for the first time (figure 3B), inflammation indexes such as PCT, LDH, CRP and the like are rapidly reduced and recovered to be normal (figure 3C), and liver and kidney function damage does not appear in the treatment period (figure 3D).
In conclusion, tripterygium glycosides can selectively clear activated monocytes in vivo, thereby rapidly relieving CRS without affecting the number and activity of properly functioning CAR-T cells. It is further noted that patients infected with the novel coronavirus (COVID-19) have similar clinical manifestations as CRS that occurs after CAR-T treatment, with high fever, hypoxia and hypotension, and with cytokine storm, our findings are suggestive of treatment of COVID-19 infection.

Claims (2)

1. Use of Tripterygium glycosides in preparing a medicament for selectively clearing mononuclear cells from peripheral blood of a patient with CAR-T induced cytokine release syndrome.
2. The use of claim 1, wherein the tripterygium glycosides tablet improves high fever, hypoxia, hypotension and cytokine storm due to cytokine release syndrome occurring after CAR-T treatment and suppresses IL-6, IL-8, IL-2, IL-10, IL-1 β, IFN α, IFN γ.
CN202010778038.7A 2020-08-05 2020-08-05 Application of tripterygium glycosides tablets in preparation of medicine for treating CAR-T induced cytokine release syndrome Active CN111840355B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010778038.7A CN111840355B (en) 2020-08-05 2020-08-05 Application of tripterygium glycosides tablets in preparation of medicine for treating CAR-T induced cytokine release syndrome

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010778038.7A CN111840355B (en) 2020-08-05 2020-08-05 Application of tripterygium glycosides tablets in preparation of medicine for treating CAR-T induced cytokine release syndrome

Publications (2)

Publication Number Publication Date
CN111840355A CN111840355A (en) 2020-10-30
CN111840355B true CN111840355B (en) 2022-04-15

Family

ID=72971454

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010778038.7A Active CN111840355B (en) 2020-08-05 2020-08-05 Application of tripterygium glycosides tablets in preparation of medicine for treating CAR-T induced cytokine release syndrome

Country Status (1)

Country Link
CN (1) CN111840355B (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101574386B (en) * 2008-05-09 2012-11-28 中国科学院上海生命科学研究院 Application of active ingredients of thunder god vine for regulating heat shock protein and retinol X receptor Alpha
US10739353B2 (en) * 2014-12-31 2020-08-11 Signpath Pharma, Inc. Suppression of cytokine release and cytokine storm

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
gA肾病患者外周血单个核细胞活化与凋亡及雷公藤甲素干预研究;梁倩;《中国优秀博硕士学位论文全文数据库(博士)医药卫生科技辑》;20110415 *

Also Published As

Publication number Publication date
CN111840355A (en) 2020-10-30

Similar Documents

Publication Publication Date Title
Safadi et al. Immune stimulation of hepatic fibrogenesis by CD8 cells and attenuation by transgenic interleukin-10 from hepatocytes
Erol High-dose intravenous vitamin C treatment for COVID-19
Chen et al. Thalidomide combined with low-dose glucocorticoid in the treatment of COVID-19 pneumonia
Guo et al. Asiatic acid ameliorates dextran sulfate sodium-induced murine experimental colitis via suppressing mitochondria-mediated NLRP3 inflammasome activation
Chi et al. Production of interleukin-17 in Behcet’s disease is inhibited by cyclosporin A
US20050159483A1 (en) Method of using punicic acid to enhance immune response and prevent metabolic disorders
Li et al. Andrographolide sulfonate reduces mortality in Enterovirus 71 infected mice by modulating immunity
CN113559107B (en) Application of progestogen in preparing medicine for inhibiting cell factor storm
Lv et al. Effects of magnesium isoglycyrrhizinate on AST, ALT, and serum levels of Th1 cytokines in patients with allo-HSCT
Wu et al. α-Galactosylceramide protects mice from lethal Coxsackievirus B3 infection and subsequent myocarditis
Wolinsky et al. Role of prostaglandin in the depressed cell-mediated immune response in rheumatoid arthritis
CN111840355B (en) Application of tripterygium glycosides tablets in preparation of medicine for treating CAR-T induced cytokine release syndrome
Li et al. The immunological mechanisms and therapeutic potential in drug-induced liver injury: Lessons learned from acetaminophen hepatotoxicity
CN107157978B (en) Medicine and composition for treating EBV + DLBCL and DLBCL
US20180169108A1 (en) Drug Combinations For the Treatment of HIV
Sato et al. Fulminant, CMV-associated, haemophagocytic syndrome following unrelated bone marrow transplantation
US20210052541A1 (en) Application of (5R)-5-Hydroxytriptolide in Preparation of Drugs
US11957783B2 (en) Topical immunosensitizers to treat viral and fungal infections
AU2021200357B2 (en) Use of mesenchymal stem cells in the treatment of viral infections and/or complications caused by viral infections
Garming Legert et al. Oral mucositis after tacrolimus/sirolimus or cyclosporine/methotrexate as graft‐versus‐host disease prophylaxis
Zhang et al. Clinical applications of haploidentical hematopoietic stem cell transplantation in severe aplastic anemia.
CN111803508A (en) Application of triptolide in preparing medicine for treating CAR-T induced cytokine release syndrome
CN111956680B (en) Application of tripterygium glycosides tablets in preparation of medicine for relieving and/or treating symptoms related to hemophagocytic syndrome
CN107617101B (en) Zoledronic acid-containing and interleukin-containing medium pharmaceutical combination of element 2 and application thereof
EP3608414A1 (en) Viral vector for treating autoimmune disease and diabetes and construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant