CN111826436B

CN111826436B - Group high-throughput determination method for gene and corresponding protein expression change in hippocampal tissues in nicotine addiction, withdrawal and addiction reconstruction stages

Info

Publication number: CN111826436B
Application number: CN202010707484.9A
Authority: CN
Inventors: 王红娟; 陈欢; 付亚宁; 韩书磊; 刘彤; 侯宏卫; 胡清源
Original assignee: National Tobacco Quality Supervision and Inspection Center
Current assignee: National Tobacco Quality Supervision and Inspection Center
Priority date: 2020-07-21
Filing date: 2020-07-21
Publication date: 2022-10-04
Anticipated expiration: 2040-07-21
Also published as: CN111826436A

Abstract

The invention discloses a group high-throughput determination method for expression changes of 8 CHRNs genes and corresponding nAChRs proteins in hippocampal tissues in nicotine addiction, withdrawal and addiction reconstruction stages of a rat, which comprises the following steps: establishing a rat nicotine addiction, withdrawal and addiction reconstruction stage model based on a Conditional Positional Preference (CPP) device, obtaining rats with nicotine addiction, withdrawal and addiction reconstruction and corresponding control rats in the period and at last, killing the rats, stripping hippocampal tissues and preparing cDNA and total protein, and detecting the expression changes of 8 CHRNs genes and 8 nAChRs proteins. The method can simulate three stages of smoking addiction, withdrawal and relapse, is beneficial to researching signal mechanisms of different addiction states by detecting the changes of 8 CHRNs genes and corresponding nAChRs protein expressions in different stages, and has important effects on researching related molecular mechanisms of nicotine addiction, developing nicotine withdrawal treatment measures and the like.

Description

Group high-throughput determination method for gene and corresponding protein expression change in hippocampal tissues in nicotine addiction, withdrawal and addiction reconstruction stages

Technical Field

The invention belongs to the field of life science research, and particularly relates to a group high-throughput determination method for detecting 8 CHRNs genes in hippocampal tissues and expression changes of corresponding 8 nAChRs proteins based on a rat model simulating different stages of smoking addiction, stage and relapse.

Background

Smoking and health are the subject of intense interest in the international public health sector. Nicotine is a major addictive substance in cigarette smoke, and the study of the mechanism of nicotine addiction and the discovery of biomarkers of nicotine addiction are important for smoking and health problems.

In the process of addiction causing research, a reliable animal addiction model needs to be constructed firstly, and then the expression change of nicotine addiction and withdrawal related genes is detected based on the constructed animal model, so that the mechanism and potential biomarkers of nicotine addiction can be researched. The Conditioned Place Preference (CPP) experiment is a classical experimental model for evaluating the reward effect and dependence of a drug, utilizes the natural Preference of rodents on dark environments and the natural aversion to bright places, establishes the association between the reward effect of the drug and a certain specific environment by training animals, and evaluates the craving degree of the drug of the animals by determining whether the animals have a Preference for the environment experiencing the reward effect of the drug. The process of smoking addiction, withdrawal and relapse can be simulated by constructing a rat nicotine addiction, withdrawal and CPP model. Therefore, the rat CPP model based on nicotine addiction, withdrawal and reconstruction is used for carrying out the related research on the nicotine addiction mechanism and the addiction marker, and has important effects on the elucidation of the nicotine addiction mechanism and the further proposal of a more scientific nicotine withdrawal treatment scheme and the like.

The hippocampus tissue is an important region of the midbrain limbic system, plays an important role in addictive learning and memory, and is closely related to the regulation of addictive-related synaptic plasticity. Following nicotine intake, a neuroreward effect is triggered by binding to nicotinic acetylcholine receptors (nAChRs), which makes nAChRs the most interesting factor in nicotine addiction studies. nAChRs are pentamers consisting of five homologous or heterologous subunits, sharing 8 α (2-9) and 3 β (2-4) subunits in vertebrate brain, for a total of 11 subunits. Wherein 8 subunits of alpha 3-nAChR, alpha 4-nAChR, alpha 5-nAChR, alpha 7-nAChR, alpha 9-nAChR, beta 2-nAChR, beta 3-nAChR and beta 4-nAChR are related to nicotine addiction, are respectively coded by 8 genes of CHRNA3, CHRNA4, CHRNA5, CHRNA7, CHRNA9, CHRNB2, CHRNB3 and CHRNB4, and are all expressed in hippocampal tissues. The detection of the expression changes of the 8 CHRNs genes and the corresponding 8 nAChRs proteins in the hippocampal tissues in the stages of addiction, withdrawal and reconstruction is of great significance for researching nicotine addiction mechanism and smoking cessation treatment.

However, the modeling period of the rat nicotine addiction, withdrawal and reconstruction stage model is long, the amount of the hippocampal tissue sample of each rat is very limited, and the hippocampal tissue is soft and sticky and is not easy to be divided, so that the hippocampal tissue sample is very precious. In addition, many molecular biology experiments such as western blotting and gene copy number analysis are required to be performed while detecting gene expression, so it is very difficult to obtain 8 genes and expression change results of corresponding 8 proteins in the process by using as few hippocampal tissues as possible. In addition, animal models typically treat at least 8 per group, and at least 16 samples per experimental group plus the corresponding control group need to be tested simultaneously. For fluorescence quantification experiments, 2 96-well plates are required for single target gene detection. Therefore, 2 x 8 x 3, namely 48 96-well plates are needed to complete the experiment in the stage of detecting 8 target gene expression changes in addiction, withdrawal and reconstruction, the workload is extremely high, and the sample size of the required hippocampal tissues is large. For western blotting experiments, 2 10-well protein gels are required for single target protein detection, and 8 samples of the experimental group and the control group cannot be detected on the same protein gel. Therefore, 2 x 8, namely 16 pieces of 10-pore protein gel are needed to complete the protein electrophoresis experiment in the detection of 8 target protein expression changes in the stages of addiction, withdrawal and reconstruction, and the subsequent protein transfer experiment is added, so that the overall workload is extremely high, and the required sample size is very large. If a dose gradient is set during nicotine administration, the workload is more arduous, and the obtained detection results do not have good space-time consistency. However, no suitable sample combination method exists at present, and the experiment can be completed under the requirements of high throughput and small sample consumption.

Therefore, it is necessary to establish a group high-throughput detection method for detecting the expression of 8 CHRNs genes and corresponding nAChRs in rat hippocampal tissues in nicotine addiction, withdrawal and reconstruction stages.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to establish a group high-throughput measuring method for measuring 8 CHRNs genes and expression changes of 8 nAChRs proteins of hippocampal tissues in the stages of nicotine addiction, withdrawal and addiction reconstruction of rats.

In the invention, the 8 CHRNs genes and the corresponding 8 nAChRs proteins refer to CHRNA3, CHRNA4, CHRNA5, CHRNA7, CHRNA9, CHRNB2, CHRNB3, CHRNB4 genes and corresponding alpha 3-nAChR, alpha 4-nAChR, alpha 5-nAChR, alpha 7-nAChR, alpha 9-nAChR, beta 2-nAChR, beta 3-nAChR and beta 4-nAChR proteins.

The purpose of the invention is realized by the following technical scheme:

the invention provides a group high-throughput determination method for 8 CHRNs genes and protein expression changes corresponding to nAChRs in hippocampal tissues in nicotine addiction, withdrawal and addiction reconstruction stages of a rat, which comprises the following steps: based on a Conditional Positional Preference (CPP) device, a rat nicotine addiction, withdrawal and addiction reconstruction stage model is established, rats with nicotine addiction, withdrawal and addiction reconstruction and corresponding control rats are obtained in the process and finally, the rats are sacrificed, hippocampal tissues are stripped and cDNA and total protein are prepared, and the expression changes of 8 CHRNs genes and 8 nAChRs proteins are detected.

The method provided by the invention comprises the following steps:

(1) Establishing a CPP addiction-withdrawal-reconstruction model:

establishing a rat nicotine addiction-withdrawal-reconstruction model based on a Conditional Positional Preference (CPP) device, 3 groups of rats and corresponding 3 groups of control rats during and at the end of obtaining nicotine addiction, withdrawal and reconstruction;

(2) Taking hippocampal tissue:

extracting hippocampal tissue from each obtained rat, dividing the tissue into two parts, subpackaging the tissue in tubes, recording the mass, and freezing and storing;

(3) Preparation of hippocampal tissue cDNA:

taking out the frozen hippocampus tissues, adding lysis solution RNAioso Plus, fully grinding, transferring to a new tube, carrying out room temperature lysis, centrifuging to obtain supernatant, extracting RNA, washing, adding DEPC (diethyl phthalate) water with corresponding volume into each tube according to the same mass-volume ratio according to the average value of the tube hippocampus tissues weighed in the step (2) corresponding to 100 mu L to dissolve the RNA, and then carrying out first strand cDNA synthesis;

(4) Group mix of hippocampal tissue cDNA:

using each cDNA sample with the same volume obtained in the step (3) as a template, carrying out PCR amplification on GAPDH fragments, carrying out agarose gel electrophoresis on amplification products, carrying out target strip quantification by combining the quantity (ng/mu L) of DNA marker, calculating the volume of each hippocampal tissue cDNA template corresponding to unit ng number based on the quantification result, and mixing the cDNA templates of rats in the same group in equal proportion according to the calculated template volume result to obtain a mixed sample;

(5) Group mixes of hippocampal tissue total proteins:

taking out the frozen hippocampal tissues, adding Western Blotting lysate for full grinding, transferring to a new tube, performing ice lysis, centrifuging to obtain a supernatant, calculating the volume of the supernatant after lysis corresponding to the situation that the hippocampal tissues with the same mass are added according to the mass/volume ratio of the hippocampal tissues in each tube, and correspondingly taking the supernatant to perform equal mass mixing on the hippocampal tissues of the rats in the same group to obtain a mixed sample;

(6) Group expression of 8 CHRNs genes in hippocampal tissues:

respectively taking the respective mixed samples of 3 groups of rats obtained in the step (4) for nicotine addiction, withdrawal and addiction reconstruction as experimental group samples, taking the corresponding mixed samples of 3 groups of control rats as control group samples, taking GAPDH as a reference gene, taking 8 CHRNs genes as target genes, performing qRT-PCR, and determining the gene expression change of the nicotine addiction, withdrawal and addiction reconstruction group relative to the control group;

(7) Group expression of 8 nAChRs proteins in hippocampal tissues:

respectively taking the respective mixed samples of 3 groups of rats with nicotine addiction, withdrawal and addiction reconstruction obtained in the step (5) as experimental group samples, taking the corresponding mixed samples of 3 groups of control rats as control group samples, GAPDH as reference protein, 8 nAChRs proteins as target proteins, carrying out a Western blotting experiment, and then determining the protein expression changes of the nicotine addiction, withdrawal and addiction reconstruction groups relative to the control group by relative protein quantification.

Preferably, the step (1) comprises:

selecting SD male rats with age of 6-7 weeks and weight of 200 +/-20 g, randomly dividing the rats into 3 experimental groups and 3 control groups, wherein the number of the rats in each group is more than or equal to 8; the model was established as follows:

a. addiction:

injecting nicotine solution prepared by normal saline into rats of an experimental group subcutaneously in odd days for 1 administration period every 2 days, wherein the administration dose is 0.6mg/kg, injecting normal saline with the same volume into rats of a control group, immediately putting the rats into a white box of a CPP device after injection to allow the rats to freely move for 40min, and then putting the rats back into a cage for conventional feeding; injecting normal saline with the same volume into rats of the experimental group and the control group subcutaneously on even days, immediately placing the rats into a black box of a CPP device after injection to allow the rats to freely move for 40min, and then placing the rats back into a cage for conventional breeding;

the first CPP test was performed after the 4 th dosing cycle (i.e., on day 9 after the start of dosing), prior to the day of dosing, and included: respectively placing the rats in each group into a CPP box, removing the partition plates at two sides, allowing the rats to freely move in the black and white boxes at two sides for 10min, and recording the residence time of the rats in the white boxes; when the time of the rats of the experimental group and the control group staying in a white box is found to form a significant difference (one-factor analysis of variance), indicating that the rats of the experimental group generate nicotine dependence, and killing 1 rat of the experimental group and 1 rat of the control group, thereby obtaining rats with nicotine addiction and corresponding control rats;

b. and (3) withdrawal:

on the day of obtaining nicotine addicted rats, the nicotine solution was replaced with physiological saline, subcutaneous injection of the remaining rats was performed according to step a, and then CPP test was started after the 1st administration period (i.e., on the 3 rd day after starting administration); when no significant difference is found in the residence time of the rats in the white box between the experimental group and the control group, the rats in the experimental group have no nicotine dependence, and 1 rat in the experimental group and 1 rat in the control group are sacrificed, so that rats with nicotine withdrawal and corresponding control rats are obtained;

c. reconstruction:

on the day of obtaining nicotine withdrawal, subcutaneous injections of the remaining rats were performed according to step a, wherein the nicotine solution was injected at a dose of 0.2mg/kg, followed by CPP testing after the 1st administration cycle (i.e., on day 3 after the start of administration); when the time of the rats of the experimental group and the rats of the control group staying in the white box are found to be remarkably different, the rats of the experimental group are shown to regenerate nicotine dependence, and the rats of the rest experimental group and the rats of the control group are sacrificed, so that the rats reconstructed by nicotine addiction and the corresponding control rats are obtained.

Preferably, in step a, the rats in the experimental group develop nicotine dependence after the 7 th administration cycle;

preferably, in step b, the rats in the experimental group have no nicotine dependence after the 2 nd dosing cycle;

preferably, in step c, the rats in the experimental group re-develop nicotine dependence after the 3 rd dosing cycle.

In step (1) of the method of the present invention, preferably, before the establishment of the model is started, the rats are sub-packaged in independent aeration cages for adaptive feeding for 2 days, during which sufficient food and water are provided, and appropriate temperature, humidity and light environment are maintained; then testing the CPP reference value in a behavior period of 5 days, and removing abnormal individuals; further preferably, the CPP benchmark test includes: the rats to be tested are sequentially and independently loaded into the CPP device, partition plates of black boxes and white boxes on two sides are removed, the rats are allowed to freely move, the distance and time of free shuttling movement in the black boxes and the white boxes within 10min are recorded, the percentage of the time of the rats staying in the white boxes is used as a test index, and the rats staying in the white boxes for more than 50% and less than 10% of the total test time are removed according to a test result.

Preferably, step (2) of the method of the present invention comprises:

after the rat dies at the cervical vertebra, taking off free cerebral cortex and exposing bilateral hippocampal tissues; separating hippocampal tissue from surrounding brain tissue, taking out the hippocampal tissue by peeling, cutting into two parts on ice rapidly, respectively placing into 2mL of EP tubes weighed in advance, packaging, recording the mass of the EP tubes before and after placing into the hippocampal tissue, and freezing at-80 deg.C in time.

Preferably, step (3) of the method of the present invention comprises:

taking out Hippocampus tissue from-80 deg.C, adding 500 μ l lysate RNAiSo Plus and grinding beads into each tube, and grinding in precooled tissue grinder under 50Hz,30s; after the grinding is finished, putting the uniformly ground sample into a new 2mL centrifuge tube, cracking at room temperature for 10min, then centrifugally transferring supernatant into a new 1.5mL centrifuge tube, respectively extracting RNA by using chloroform and isopropanol, washing RNA precipitate by using 75% ethanol, then adding corresponding volume of DEPC water to each tube according to the same mass-volume ratio according to the average value of the weights of the hippocampal tissues of the tubes in the step (2) corresponding to 100 mu L, and dissolving the RNA precipitate by using the corresponding volume of DEPC water, and carrying out first strand cDNA synthesis, for example according to PrimeScript ^TM II 1st Strand cDNA Synthesis Kit Specification requirements.

Preferably, step (4) of the method of the present invention comprises:

and (3) performing common PCR (polymerase chain reaction) for 30 cycles under the same space-time condition by using each cDNA sample with the same volume obtained in the step (3) as a template to amplify the GAPDH fragment (the primer example is shown below), performing agarose gel electrophoresis on the amplification product, and performing target band quantification by using a multifunctional gel imager according to the electrophoresis result.

Preferably, step (5) of the method of the present invention comprises:

taking out hippocampal tissues from-80 ℃, putting the tissues on ice, then adding 150 mu L of Western Blotting lysate and grinding beads into each tube, grinding the tissues in a precooled tissue grinder, transferring the lysate which is uniformly ground into a new 2mL centrifuge tube after finishing grinding, continuously cracking the lysate on ice for 30 minutes, and centrifuging the lysate for 5min at 10000-14000g at 4 ℃ to obtain a supernatant; and calculating the volume of the added cracked supernatant when the hippocampal tissue with the same mass is added according to the mass/volume ratio of the hippocampal tissue in each tube, and taking the supernatant correspondingly to mix the hippocampal tissue of the rats in the same group with equal mass to obtain a mixed sample.

Preferably, step (6) of the method of the present invention comprises:

the qRT-PCR is performed by designing and synthesizing fluorescent quantitative PCR primers corresponding to the reference gene and the target gene, e.g. based on Roche LC96 type fluorescent quantitative PCR instrument using FastStart Essential DNA Green Master kit (see primers examples below).

Preferably, step (7) of the method of the invention comprises:

respectively taking the mixed samples of 3 groups of rats subjected to nicotine addiction, withdrawal and addiction reconstruction and obtained in the step (5) as experimental group samples, taking the mixed samples of corresponding control rats as control group samples, measuring the protein concentration by using a BCA protein concentration detection kit, adding sterilized water to adjust the protein concentration of each sample to 4mg/mL, and adding 4 x loading buffer with the volume of 1/3 of the sample; after boiling water bath for 5min, centrifuging at 12000g for 10min, and taking supernatant;

carrying out polyacrylamide gel electrophoresis after sample loading, cutting off corresponding colloid according to respective theoretical molecular weights of 8 nAChRs proteins and internal reference proteins after electrophoresis, and carrying out Protein transfer printing under the condition of constant pressure by using a nitrocellulose filter membrane (NC membrane) by referring to a Protein PAGE Ruler strip;

after the protein transfer, protein blocking, membrane washing by PBST (neutral phosphate buffer solution containing 0.05 percent of Tweeen 20) 3 times, overnight incubation by primary antibody, membrane washing by PBST 3 times, shaking incubation by secondary antibody at room temperature for about 1.5h, and membrane washing by PBST 3 times are sequentially carried out, ECL chemiluminescence development is carried out on the finished NC membrane, protein relative quantification is carried out based on gel imaging system software, and the change of the expression level of 8 nAChRs proteins in each group relative to a control group is calculated.

According to a particular embodiment of the invention, the process of the invention is described in detail as follows:

different groups of SD rats were given nicotine and saline, respectively, and the addiction, withdrawal and reconstitution status were evaluated by the residence time of the rats in the white box of the conditioned place preference box. After successful modeling, the rat is killed, hippocampal tissues are stripped, cDNA samples and total protein samples are prepared, a fluorescence quantitative PCR experiment and a protein immunization experiment are carried out, and the expression changes of 8 CHRNs genes such as CHRNA3, CHRNA4, CHRNA5, CHRNA7, CHRNA9, CHRNB2, CHRNB3, CHRNB4 and the like and 8 nAChRs proteins such as alpha 3-nAChR, alpha 4-nAChR, alpha 5-nAChR, alpha 7-nAChR, alpha 9-nAChR, beta 2-nAChR, beta 3-nAChR, beta 4-nAChR and the like are tested.

The method comprises the following specific steps:

1. selection criteria for laboratory animals

SD male rats 6 to 7 weeks old and having a body weight of about 200g were selected as model-constructed rats. The rats are separately loaded in independent ventilation cages for feeding, sufficient food and water are provided, and proper temperature, humidity and illumination environment are maintained. And (3) testing the CPP reference value of 5 days after adapting to the environment for 2 days, and rejecting rats with the residence time of more than 50% and less than 10% in a white box according to the test result.

2. Establishment of rat nicotine addiction CPP model

During the conditioning training period, nicotine solution is prepared by using normal saline, the rats are administrated in a subcutaneous injection mode, one administration period is formed every two days, the rats in an experimental group are injected with the nicotine solution subcutaneously according to the dose of 0.6mg/kg on odd days (day 1) after the experiment begins, the rats in a control group are injected with the normal saline with the same volume, and then the rats are immediately placed into a white box of a CPP device to freely move for 40min; on even number of days, the rats in the experimental group and the rats in the control group are injected with normal saline, placed in a black box of a CPP device and allowed to freely move for 40min, and then taken out and placed back in a cage in an animal house for conventional breeding. The first CPP test was performed after the 4 th dosing cycle (i.e., on the 9 th day after the start of dosing, before the same day of dosing), and there was a significant difference in white-box residence time between the experimental group and the control group after the 7 th dosing cycle (i.e., on the 15 th day after the start of dosing, before the same day of dosing), indicating that the rats in the experimental group developed nicotine dependence, i.e., acquired a conditional positional preference for nicotine (CPP).

3. Rat CPP model withdrawal and reconstruction

Withdrawal and reconstruction of rat CPP model: after the CPP is obtained, the experimental group and the control group are injected with physiological saline only from the day of the test, and are still trained in an alternating manner of white boxes and black boxes, namely, the CPP regression period enters the second stage, the CPP test is started after the administration of the CPP for two days (namely, after the 1st administration period, namely, after the 3 rd administration after the administration is started, before the administration of the day), the retention time of the experimental group and the control group has no significant difference, namely, the rats have no nicotine dependence, and the CPP regression is found by the test after the 4 th injection of the physiological saline (namely, after the 2 nd administration period, namely, after the 5 th administration after the administration is started, before the administration of the day). After the CPP subsided, the rats in the experimental group were injected with nicotine at a dose of 0.2mg/kg from the day of the test, with saline the following day, still two days as a dosing period, and the rats in the control group were injected with saline only. Successful CPP reconstitution was found after the 3 rd dosing cycle (i.e. on day 7 after the start of dosing, before dosing on the same day).

4. Selection of Hippocampus tissue

After the rat dies at the cervical vertebra, the scalp of the rat is cut along the coronal suture and the sagittal suture to expose the head, the skull of the rat is pulled open by using a straight forceps, and then the parietal bone and the occipital bone are taken down from two sides; the hippocampal tissue is positioned at the bottom of the cerebral cortex, the cerebral cortex covered on the tissue is carefully cut by using a straight forceps, and the free cerebral cortex is taken down to expose bilateral hippocampal tissue; separating hippocampal tissue from surrounding brain tissue; finally, hippocampal tissue was carefully dissected out, split into two parts, and frozen in-80 ℃ using 2mL EP tubes.

5. Preparation of Hippocampus tissue cDNA

Frozen hippocampal tissue samples were removed from-80 ℃, tissue disrupted using a tissue grinder, 500 μ L lysate RNAiso Plus was added, the grinding beads were placed in a tube, and the batch was placed in a pre-chilled tissue grinder for sufficiently rapid grinding at 50hz for 30 seconds. Then, the RNA was aspirated using chloroform and isopropanol, and the RNA precipitate was washed with 75% ethanol, dried and dissolved in 100. Mu.L of DEPC water. Finally using the kit PrimeScript ^TM II 1st Strand cDNA Synthesis Kit, 1st Strand cDNA Synthesis was performed as described in the specification.

The optimized cracking steps of the hippocampal tissue sample comprise:

and (3) grinding the supernatant in a lysis solution by using a tissue grinder to extract RNA, washing RNA precipitates by using 75% ethanol, and adding DEPC (diethyl phthalate) water in a corresponding volume into each tube to dissolve the precipitates according to the same mass-volume ratio standard according to the average value of the weighed hippocampal tissues of each tube corresponding to 100 mu L. Namely, preparing a hippocampal tissue cDNA sample solution according to a certain mass-to-volume ratio. See, for example, table 1.

TABLE 1 concentration and purity of RNA extracted by tissue grinder lysis

Remarking: H1-H8 are addictive stage normal saline control hippocampal samples No. 1-8. The A260/A280 and the A260/A230 represent the purity of RNA, the A260/A280 value of the RNA with better purity is about 1.9, and the A260/A230 value is more than 2.0.

6. Fluorescent quantitative PCR experiment

The fluorescent quantitative PCR primers of the corresponding target genes were designed and synthesized, and the sequence information is shown in Table 2. A Real-time fluorescent quantitative PCR (Q mu-qualitative Real-time PCR, qRT-PCR) test is carried out by using a FastStart Essential DNA Green Master kit based on a Roche LC96 type fluorescent quantitative PCR instrument by taking the prepared model hippocampal tissue cDNA samples at each stage as a template.

TABLE 2.8 RT-PCR primer information for CHRNs genes

Several cDNA sample mixing patterns were compared:

(1) Directly mixing in equal volume;

(2) Mixing RNA ng number;

(3) Agarose gel electrophoresis quantification based on internal reference amplification with ng number mixing:

using cDNA of each sample with the same volume as a template, carrying out PCR amplification on GAPDH fragments (amplification primers are Forward: GTTCAACGGCAGATA, reverse: GCATCAAAGGGTGGAAGAAT), carrying out agarose gel electrophoresis on amplification products, carrying out target strip quantification by combining the quantity (ng/mu L) of DNA marker, calculating the volume of each hippocampal cDNA sample corresponding to unit ng based on the quantification result, and mixing the cDNA templates of 8 samples in each group in equal proportion according to the calculated template volume result.

Taking the independent samples and the mixed samples of the 8 independent samples of the nicotine addiction group/withdrawal group/reconstruction group as experimental group samples, the independent samples and the mixed samples of the 8 independent samples of the corresponding normal saline group as control group samples, GAPDH as an internal reference gene, and CHRNs as target genes respectively, carrying out qRT-PCR test, calculating relative fluorescence values, and further calculating the expression change of the 8 CHRNs genes of the nicotine addiction group/withdrawal group/reconstruction group relative to the normal saline control group.

Specifically, taking the expression of 8 CHRNs in 8 cDNA samples in an addiction stage saline control group as an example, cDNA templates are mixed according to the three mixing modes respectively, and compared with the results of independent fluorescence quantitative detection of each sample, the results show that the accuracy of ng number mixing such as the agarose gel electrophoresis quantitative result based on internal reference amplification in the (3) th sample is the best, the average value of the independent quantitative results is closest, and the mixing modes of the other two samples deviate greatly. The results of the independent quantification of 8 cDNA samples and the quantification of 3 different sample combinations are shown in Table 3 and FIG. 1.

TABLE 3 CHRNs fluorescence quantification results in independent and mixed state for 8 rat hippocampal tissue cDNA samples of the control group at the addiction stage

Remarking: H1-H8 are independent quantitative results of 8 cDNA samples of 8 rats of an addiction stage normal saline control group, CO is an average value of H1-H8 independent quantitative results, M1 is a quantitative result of 8 cDNA samples mixed in a mixing mode (1), M2 is a quantitative result of 8 cDNA samples mixed in a mixing mode (2), and M3 is a quantitative result of 8 cDNA samples mixed in a mixing mode (3).

Thus, the optimized sample mixing steps are:

using cDNA of each sample with the same volume as a template, carrying out PCR amplification on GAPDH fragments, carrying out agarose gel electrophoresis on amplification products, carrying out target band quantification by combining the magnitude of a DNA marker, and calculating the template volume corresponding to the unit ng number based on the quantification result; and mixing the cDNA templates of each group of 8 samples in equal proportion according to the calculated template volume result, wherein each experimental group and the corresponding control group are respectively used as a sample to carry out experiments when subsequent fluorescence quantification is carried out, and each experimental group is normalized by taking the corresponding control group as a reference.

7. Preparation of Mixed Total protein samples from various groups of Hippocampus tissues

Frozen hippocampal tissue samples were removed from-80 ℃ and compared to the following sample mix:

(1) Clamping a proper amount of hippocampal tissues of 8 rats in each group respectively, directly mixing and then cracking;

(2) Hippocampus tissues of 8 rats in each group were lysed separately and subjected to equal μ g number mixing based on the BCA protein quantification results;

(3) Indirect equal mass mixing was performed after independent lysis based on pre-cryopreservation weighing results.

The WB quantification results of the above 3 mixed methods were compared with the WB quantification results of the hippocampal tissue of 8 rats in each group, which were independently quantified and then analyzed in combination. In order to obtain the most accurate comparative advantage of the quantitative results under the 3 different sample mixing modes, the total protein samples of the independent cracking of the hippocampal tissues of 8 rats in the normal saline control group at the addiction stage and the mixed total protein samples under the 3 different mixing modes are used for carrying out WB tests of 8 nAChR, and the results show that the WB quantitative results of the 3 rd mixing mode, namely the indirect equal mass mixing, are the closest to the results of the combined analysis after the independent WB quantitative results of the hippocampal tissues of the 8 rats in the group are shown in a specific figure 2 and a table 4.

TABLE 4 results of independent and mixed WB quantitative analysis of hippocampal tissue samples of 8 test rats in the control group at the addiction stage

Remarking: the 8 quantitative results of the nAChRs and the GAPDH gray scale are quantitative values of gray scale analysis software of WB development results. H1-H8 are the independent cracking results of 8 hippocampal tissue samples of 8 rats in an addiction stage normal saline control group, CO is the mean value of H1-H8 independent cracking, M1 is the cracking result of 8 hippocampal tissue samples after mixing in a mixing mode (1), M2 is the mixed result of 8 hippocampal tissue samples in a mixing mode (2), and M3 is the mixed result of 8 hippocampal tissue samples in a mixing mode (3). The mean of the independent H1-H8 cracking was taken as the reference value, i.e. CO as indicated in the table; the statistical results of M1/CO, M2/CO and M3/CO are the ratios of nAChRs/GAPDH to H1-H8 mean values under the corresponding sample mixing modes.

Therefore, the optimized mixing steps for each group of hippocampal tissue samples were:

firstly, weighing a plurality of 2mL EP tubes by using a ten-thousandth balance, and recording the mass of each empty EP tube; then respectively clamping half of hippocampal tissues of a single tested rat, putting the hippocampal tissues into one of the EP tubes, weighing and recording the hippocampal tissues again, and quickly placing the hippocampal tissues on ice; then adding 150 mu L of Western Blot lysate and the same amount of grinding beads into each EP tube, grinding by using a precooled tissue grinder, taking out the uniformly ground lysate after grinding, putting the lysate into a new 2ml centrifuge tube, cracking for 30 minutes on ice, centrifuging for 5 minutes at 10000-14000g and 4 ℃, and taking the supernatant; and finally, calculating the volume of the cracked supernatant which is required to be added when the hippocampal tissue with the same mass is added according to the mass/volume ratio of the hippocampal tissue in each EP tube, and indirectly mixing the hippocampal tissues of 8 rats in the same group by equal mass. All 8 rats in the experimental and control groups were manipulated in this manner.

8. Determination of expression change of 8 nAChRs proteins in rat hippocampal tissue

After the protein concentration of the mixed total protein samples of the hippocampal tissues of each group of rats was measured by using a BCA protein concentration assay kit, the protein concentration of each sample was adjusted to 4mg/mL by adding sterilized water, and 4 × loading buffer of 1/3 volume of the protein sample was added. After boiling water bath for 5min, 12000g is centrifuged for 10min to take the supernatant. After the mixed total Protein samples of 8 rat hippocampal tissues of each experimental group and control group are loaded, polyacrylamide gel electrophoresis (SDS-PAGE) is carried out, and corresponding colloids are cut off according to respective theoretical molecular weights of 8 nAChRs proteins and internal reference proteins by referring to Protein PAGE Ruler strips. Protein transfer was performed using a nitrocellulose filter (NC membrane) under a constant pressure, and after completion of the protein transfer, protein blocking, washing of the membrane with PBST (neutral phosphate buffer containing 0.05% Tween 20) 3 times, incubation with primary antibody overnight, washing of the membrane with PBST 3 times, incubation with secondary antibody at room temperature with shaking for about 1.5h, and washing of the membrane with PBST 3 times were performed in this order. And (3) carrying out ECL chemiluminescence development on the incubated NC membrane, finally, taking a nicotine addiction/withdrawal/reconstruction group as an experimental group, taking a corresponding normal saline group as a control group, taking 8 nAChRs as target proteins and GAPDH as reference proteins, carrying out protein relative quantification on the basis of the gel imaging system software, and calculating the change of the protein level of the nAChRs of each experimental group relative to the control group.

The method is a determination method for detecting the gene and the corresponding protein expression change in the hippocampal tissues at different stages based on rat models simulating smoking addiction, withdrawal and relapse at different stages. In the invention, the experimental procedures of obtaining, fading and reconstructing CPP, extracting tissue cDNA and protein and processing, electrophoresis, membrane transfer and antibody incubation are optimized:

(1) The optimal dose (0.6 mg/kg) of the CPP obtaining stage and the optimal dose (0.2 mg/kg) of the CPP regressing stage are determined, and the constructed rat CPP model can well simulate the three stages of smoking addiction, withdrawal and relapse, so that the change of the expression level of the target protein in different stages can be detected compared with the protein expression level only focusing on the nicotine addiction stage, thereby being conductive to researching the signal mechanism of different addiction states and having higher application value in the research on addiction related;

(2) The mixed mode of the hippocampal tissue cDNA and the protein sample is scientific, reasonable, rapid and efficient: in the sample pretreatment process of a fluorescence quantitative experiment, a plurality of samples in the same treatment group are mixed in equal proportion (volume corresponding to ng number of the reference gene in unit) based on the quantitative analysis result of agarose gel electrophoresis detection of the amplified reference gene of each cDNA sample; in the sample pretreatment process of the western blotting experiment, total protein samples of the same treatment group are indirectly mixed by equal mass according to the mass of the hippocampal tissue sample and the volume ratio of the lysate which are added in advance. The mixing modes are suitable for a plurality of different treatment groups, each group contains a plurality of samples, on one hand, the defect that equal-quality mixing cannot be directly carried out by weighing tissues with the same quality due to less and sticky hippocampal tissues can be solved, the using amount of the samples is greatly reduced by the mixing mode of the samples in the same group, on the other hand, the time for analyzing the fluorescence quantitative PCR and WB experiments is greatly shortened, related reagents and labor cost are saved, the comparison research of the experimental group and the control group is ensured to be carried out under the condition of time-space consistency, and the method is particularly suitable for the requirement of rapid analysis of small-sample, multi-gene and multi-protein index expression changes in batch animal model experiments.

Therefore, the method has the advantages of high flux, high sensitivity, good accuracy and the like.

Drawings

FIGS. 1-1 to 1-8 in FIG. 1 are graphs showing independent quantification and mixed quantification results of 8 CHRNs in 8 hippocampal tissue cDNA samples in an addiction stage saline control group, wherein H1-H8 is the independent quantification result of 8 cDNA samples in the addiction stage saline control group, CO is the mean value of H1-H8 independent quantification, M1 is the quantification result of direct equal volume mixing of 8 cDNA samples (mode (1)), M2 is the quantification result of RNA ng number mixing (mode (2)) such as 8 samples, and M3 is the quantification result of ng number mixing (mode (3)) such as agarose gel electrophoresis quantification result based on internal reference amplification.

FIGS. 2-1 to 2-8 in FIG. 2 are graphs showing the WB results of 8 independent lysates of 8 hippocampal tissue samples and 3 mixes of the addiction stage saline control group, wherein H1-H8 are the results of independent lysates of 8 hippocampal tissue samples of 8 rats in the addiction stage saline control group, CO is the mean value of H1-H8 independent lysates, M1 is the result of direct mix lysis (mode (1)) of 8 hippocampal tissue samples, M2 is the result of equal μ g number mix (mode (2)) based on the BCA result after independent lysis of 8 samples, and M3 is the result of indirect equal mass mix (mode (3)) after independent lysis based on the weighing result before freezing.

FIG. 3 is a schematic diagram of experimental flow chart of expression change of 8 CHRNs genes in nicotine different-stage model, wherein RG: reference gene, reference gene; TG: target gene, target gene; the gray background is saline control group, and the white background is treatment group (nicotine addiction group, withdrawal group, or reconstitution group).

FIG. 4 shows the results of the detection of the expression changes of 8 target genes in the nicotine addiction/withdrawal/reconstitution groups relative to their control groups, respectively.

FIG. 5 shows the results of the detection of the expression changes of 8 target proteins in the nicotine addiction/withdrawal/reconstitution groups relative to their control groups, respectively.

Detailed Description

The invention is illustrated below with reference to specific examples. It will be understood by those skilled in the art that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

The experimental procedures in the following examples are conventional unless otherwise specified. The raw materials and reagents used in the following examples are all commercially available products unless otherwise specified.

Example 1:

1. instrument and reagent

Nanodrop2000 ultramicro spectrophotometer (Thermo Scientific, USA), roche LC96 fluorescence quantitative PCR instrument (Roche, switzerland), multifunctional plate reader (Molecular Devices, USA), berlin electrophoresis transfer system (Bio-Rad, USA), and Fusion Fx7 multifunctional gel imaging system (VILBERLO Mm, france).

Nicotine (TRC, purity 99.5%), physiological saline (homemade), fluorescent quantitation reagent FastStart Essential DNA Green Master (Roche, 6402712001), rnaasso Plus, DNA polymerase, PCR primers, etc. (japan TAKARA inc.), agar powder (spain Amresco split). Nicotine (TRC, 99.5% purity), physiological saline (domestic), anti-Nicotinic acetyl choline Receptor alpha 3 antibody (Abcam, ab103956, UK); anti-niti-Nicotinic acrylic Receptor alpha 4 antibody (abcam, ab124832, UK); anti-Nicotinic Acetylcholine Receptor alpha 5 antibody (Abcam, UK, ab 157470); anti-niti-Nicotinic acrylic Receptor alpha 7 antibody (abcam, ab208641, UK); anti-CHRNA9 antibody-N-terminal (Abcam, ab192193, UK); anti-niti-Nicotinic Acetylcholine Receptor beta 2 antibody (abcam, ab55980, UK); anti-CHRNB3 antibody (SIGMA, HPA045555, USA); anti-Nicotinic acetyl choline Receptor beta 4 antibody-C-terminal (abcam, ab 156213), secondary antibody (China, boshide), skimmed milk powder, PBST, protein pre-made gel, tris-Glycine buffer solution, etc.

2. Establishment of nicotine addiction-abstinence-reconstruction model

(1) Selection criteria for laboratory animals

SD male rats with the age of about 7 weeks and the body weight of about 200g were selected as model-constructed rats. The rats are separately loaded in independent ventilation cages for feeding, sufficient food and water are provided, the light and shade alternation is kept for 12 hours, the feeding environment temperature is about 22 ℃, and the relative humidity is 40% -60%. And (3) starting a CPP reference value test of 5 days after the environment is adapted to 2d, sequentially and independently loading the rats to be tested into a CPP device, removing the partition plates of the black and white boxes at two sides, allowing the rats to freely move, and recording the distance and time of free shuttling movement in the black and white boxes within 10min by using video analysis software. And (3) taking the percentage of the time of the rats staying in the white box as a test index, and rejecting the rats staying in the white box for more than 50% and less than 10% according to the test result.

(2) Establishment of rat nicotine addiction CPP model

During the conditioning training period, nicotine solution is prepared by using normal saline, the rats are administrated in a subcutaneous injection mode, one administration period is formed every two days, the rats in an experimental group are injected with the nicotine solution subcutaneously according to the dose of 0.6mg/kg on odd days (day 1) after the experiment begins, the rats in a control group are injected with the normal saline with the same volume, and then the rats are immediately placed into a white box of a CPP device to freely move for 40min; on even days, the rats in the experimental group and the rats in the control group are injected with normal saline, placed in a black box of a CPP device and allowed to freely move for 40min, and then taken out and placed in an animal house cage for conventional breeding. The first CPP test was performed after the 4 th dosing cycle (i.e. on day 9 after the start of dosing), before the day of dosing, rats were placed in the CPP box and the two side baffles removed, allowed to move freely in the black and white box for 10min on both sides, and their residence time in the white box was recorded. The white-box residence time of the experimental group after the 7 th dosing cycle (i.e., on day 15 after the start of dosing, before the day of dosing) was significantly different from that of the control group, indicating that rats in the experimental group developed nicotine dependence, i.e., acquired a conditional locus preference for nicotine (CPP).

(3) Rat CPP model withdrawal and reconstruction

Withdrawal and reconstruction of rat CPP model: after the CPP is obtained, the experimental group and the control group are injected with only physiological saline from the day of the test, and are still trained in an alternating mode of white boxes and black boxes, namely, the CPP regression period enters the second stage, the CPP test is started after the administration for two days (namely, after the 1st administration period, namely, after the 3 rd administration after the administration is started, before the administration for the day), the withdrawal condition of the nicotine dependence of the rats is judged according to the difference analysis of the residence time of the experimental group and the control group, and no significant difference indicates that the rats have no nicotine dependence, namely, the CPP has regression. After the CPP had subsided, rats in the experimental group were injected with nicotine the day after the test, with saline the next day, and with two days as a dosing cycle, and the control group was injected with saline only. CPP reconstitution results were observed with the CPP test after each dosing cycle.

It was found that after the 2 nd dosing cycle (i.e. on day 5 after the start of dosing, before the same day of dosing) rats in the experimental group had no nicotine dependence; the rats in the experimental group then re-developed nicotine dependence after the 3 rd dosing cycle (i.e. on day 7 after the start of dosing, before the day of dosing).

3. Selection of Hippocampus tissue

After the rat dies at the cervical vertebra, the scalp of the rat is cut along the coronal suture and the sagittal suture to expose the head, the skull of the rat is pulled open by using a straight forceps, and then the parietal bone and the occipital bone are taken down from two sides; the hippocampal tissue is positioned at the bottom of the cerebral cortex, the cerebral cortex covered on the tissue is carefully cut open by using a straight forceps, the first cut is positioned at the tail end of a hemisphere and is about 0.7mm deep, the second cut is positioned about 1.5-2mm in front of the first cut, the cut needs to be cut into a lateral ventricle, the two cuts are connected at the ventral side of the brain, and at the moment, the free cerebral cortex is taken down to expose the hippocampal tissue at two sides; separating hippocampal tissue from surrounding brain tissue; finally, carefully peeling off and taking out the hippocampal tissue, quickly cutting the tissue into two parts on ice, respectively putting the tissue into pre-weighed 2mL EP tubes for subpackaging, recording the mass difference of the EP tubes before and after the hippocampal tissue is put into the tubes, and timely freezing and storing the tissue at-80 ℃.

4. Fluorescent quantitative PCR experiment method

(1) Preparation of cDNA from rat Hippocampus tissues at various stages

Taking out the frozen sea horse tissue sample from-80 ℃, adding 500 mu L of lysate RNAioso Plus, putting grinding beads into a tube, putting the tube into a precooled tissue grinder for sufficiently and quickly grinding in batches, wherein the grinding conditions are 50Hz and 30 seconds; after grinding, taking out the uniformly ground sample tube, putting the sample tube into a new 2mL centrifuge tube, cracking at room temperature for 10 minutes, centrifuging at 13000g for 5 minutes at 4 ℃, transferring the supernatant into a new 1.5mL centrifuge tube, adding chloroform with the volume of 1/5 RNAsoso Plus, shaking and uniformly mixing, standing at room temperature for 5 minutes, centrifuging at 13000g for 15 minutes at 4 ℃, transferring the supernatant into a new centrifuge tube, adding isopropanol with the volume of 1/2 RNAsoso Plus, standing at room temperature for 10min, and centrifuging at 13000g 4 ℃ for 10 minutes. Adding 75% ethanol with the volume of RNAiso Plus and the like to clean the precipitate, centrifuging at 7500g 4 ℃ for 5min, discarding the supernatant and retaining the precipitate, and adding DEPC water with the corresponding volume to each tube according to the same mass-volume ratio and according to the average value of the weight of the hippocampal tissues of each tube corresponding to 100 mu L. Testing purity and concentration of extracted RNA sample, and using kit PrimeScript for qualified RNA sample ^TM II 1st Strand cDNA Synthesis Kit, 1st Strand cDNA Synthesis was performed as described in the specification.

(2) Determination of expression change of 8 CHRNs genes in rat hippocampal tissue

Using cDNA of each sample with the same volume as a template, amplifying GAPDH fragments by PCR, carrying out agarose gel electrophoresis on an amplification product, carrying out target strip quantification by combining the quantity value (ng/mu L) of a DNA marker, calculating the volume of each hippocampal cDNA sample corresponding to a unit ng number based on the quantification result, mixing the cDNA templates of 8 samples in each group in equal proportion according to the calculated template volume result, and carrying out experiments by taking each experimental group and a corresponding control group as a sample respectively when carrying out subsequent fluorescence quantification, wherein the specific experimental flow is shown in figure 3.

Taking CHRNA3 gene as an example, NCBI website searches rat CHRNA3 gene sequence number NM _052805 to derive corresponding CDS sequence; design of fluorescent quantitative PCR primers was performed using primer design software PrimerPremier5.0, and Real-time fluorescent quantitative PCR (Q. Mu. Quantitative Real-time PCR, qRT-PCR) test was performed using FastStart Essential DNA Green Master kit based on Roche LC96 type fluorescent quantitative PCR instrument after primer synthesis. Wherein, the upstream primer Rat-CHRNA3-Forward TCCAGTTTGAGGTGCATG and the downstream primer Rat-CHRNA3-Reverse CTTGGTAGTCAGAGGTTTCC generate single peak images of the dissolution curve, the signals are good, and the experimental requirements are met.

Respectively taking the mixed sample of 8 independent samples of the nicotine addiction group/the withdrawal group/the reconstruction group as an experimental group sample, taking the mixed sample of 8 independent samples of the corresponding normal saline group as a control group sample, taking GAPDH as an internal reference gene and 8 CHRNs as target genes, carrying out qRT-PCR test, and calculating the expression change of the nicotine addiction group relative to the CHRNs of the normal saline control group. The results are shown in fig. 4, where the total of 6 groups were originally present, and since 3 control groups were treated as 1 for normalization, the combination is shown as 4 groups.

5. Western blot experiment method

(1) Preparation of Mixed Total protein from Hippocampus tissues of various groups of rats

Taking out the frozen hippocampal tissue sample from-80 ℃, firstly weighing a plurality of 2mL EP tubes by using a ten-thousandth balance, and recording the mass of an empty tube of each EP tube; then respectively clamping a proper amount of hippocampal tissues of a single tested rat, putting the hippocampal tissues into one of the EP tubes, weighing and recording the hippocampal tissues again, marking the hippocampal tissues and quickly putting the hippocampal tissues on ice; then adding 150 mu L of Western Blot lysate into each EP tube, putting grinding beads into the tubes, then putting a plurality of centrifuge tubes into a pre-cooled grinding module of a tissue grinder, grinding the centrifuge tubes under the condition of 50Hz for 40 seconds, starting the tissue grinder to grind, taking out the uniformly ground lysate after grinding, putting the lysate into a new 2ml centrifuge tube, cracking the lysate on ice for 30 minutes, centrifuging the lysate at 10000-14000g for 5 minutes at 4 ℃, and taking the supernatant; and finally, calculating the volume of the cracked supernatant which is required to be added when the hippocampal tissue with the same mass is added according to the mass/volume ratio of the hippocampal tissue in each EP tube, and indirectly mixing the hippocampal tissues of 8 rats in the same group by equal mass. All 8 rats in the experimental and control groups were manipulated in this manner.

(2) Determination of expression change of 8 nAChRs proteins in rat hippocampal tissue

After the protein concentration of the prepared mixed total protein sample of each group of rat hippocampal tissues is determined by using a BCA protein concentration detection kit, the protein concentration of each sample is adjusted to 4mg/mL by adding sterilized water, and 4 × loading buffer of 1/3 volume of the protein sample is added. After 5min in a boiling water bath, centrifugation was carried out at 12000g for 10min. After polyacrylamide gel electrophoresis (SDS-PAGE), the corresponding colloids were cut according to the theoretical molecular weight of the target Protein (e.g., 53KD for. Alpha.3-nAChR Protein) and the theoretical molecular weight of the reference Protein (e.g., 40KD for GAPDH Protein) with reference to the molecular weight of Protein PAGE Ruler. Performing membrane transfer electrophoresis (ice bath, wherein the specific membrane transfer time is set according to the molecular weight of a target protein, for example, the transfer time of alpha 3-nAChR protein is set to be 50 min) by using a nitrocellulose filter membrane (NC membrane) under the constant pressure of 100V, marking each NC membrane after the protein transfer is finished, and placing the NC membrane in BSA protein blocking buffer solution for protein blocking. After blocking at room temperature with 80rpm shaking for 2h, the membrane was washed 3 times with 0.05% Tween20 in neutral PBS (i.e., PBST) buffer, each time with low speed shaking for 5min. The membrane is then incubated overnight at 4 ℃ with low shaking using the corresponding antibody to the target protein (e.g., the α 3-nAChR antibody Anti-nicotic acetylcholinergic Receptor alpha 3 antibody, abcam, ab103956, etc.), and the membrane is washed 3 times with PBST buffer, 5min each with low shaking. Finally, a suitable Secondary Antibody (e.g., goat Anti-Rabbit IgG (H + L) Secondary Antibody, HRP Conjugate (BOSTER, BA 1054), etc.) is added and incubated at room temperature for about 1.5H with shaking, and the membrane is washed 3 times with PBST buffer, 5min each time with shaking at low speed.

The washed NC membrane is placed on a sample platform of a VIBER high-end chemiluminescence gel imaging system, and a proper amount of hypersensitive ECL chemiluminescence developing solution of Thermo Scientific (liquid A and liquid B are uniformly mixed in equal volume) is slowly dripped to uniformly cover the whole membrane. And selecting an automatic exposure mode under the ECL chemiluminescence developing mode, and taking a picture to acquire signals when an optimized ECL chemiluminescence signal is achieved. The method is characterized in that a nicotine addiction/withdrawal/reconstruction group is used as an experimental group, a corresponding physiological saline group is used as a control group, 8 nAChRs such as alpha 3-nAChR, alpha 4-nAChR, alpha 5-nAChR, alpha 7-nAChR, alpha 9-nAChR, beta 2-nAChR, beta 3-nAChR and beta 4-nAChR are used as target proteins, GAPDH is used as an internal reference protein, protein relative quantification is carried out based on gel imaging system software, and the expression change of the protein levels of the 8 nAChRs such as alpha 3-nAChR in the nicotine addiction/withdrawal/reconstruction group relative to the physiological saline control group is calculated. The results are shown in fig. 5, where the total of 6 groups were previously treated for normalization as 3 control groups were treated as 1, and thus the combinations are shown as 4 groups.

The above description of the embodiments of the present invention is not intended to limit the present invention, and those skilled in the art may make various changes and modifications without departing from the spirit of the present invention, which should fall within the scope of the appended claims.

Claims

1. A method for group high throughput assay of 8 CHRNs genes and corresponding nAChRs protein expression changes in hippocampal tissues during rat nicotine addiction, withdrawal and craving reconstitution stages, said method comprising the steps of:

(1) Establishing a CPP addiction-abstinence-reconstruction model:

selecting SD male rats with the age of 6-7 weeks and the weight of 200 +/-20 g, randomly dividing the rats into 3 experimental groups and 3 control groups, wherein the number of the rats in each group is more than or equal to 8; the model was established as follows:

a. addiction:

the first CPP test was performed after the 4 th dosing cycle, prior to the day of dosing, and included: respectively placing the rats in each group into a CPP box, removing the partition plates at two sides, allowing the rats to freely move in the black and white boxes at two sides for 10min, and recording the residence time of the rats in the white boxes; when the time of the rats of the experimental group and the time of the rats of the control group staying in a white box are found to be remarkably different, the rats of the experimental group are shown to generate nicotine dependence, and 1 rat of the experimental group and 1 rat of the control group are sacrificed, so that the rats of nicotine addiction and the corresponding control rats are obtained;

b. and (3) withdrawal:

on the day of obtaining nicotine addicted rats, the nicotine solution was replaced with physiological saline, subcutaneous injection of the remaining rats was performed according to step a, and then CPP test was started after the 1st administration period; when no significant difference is found in the residence time of the rats in the white box, the rats in the experimental group and the rats in the control group show no nicotine dependence, and the rats in the experimental group and the rats in the control group are sacrificed to obtain the rats with nicotine withdrawal and the corresponding control rats;

c. reconstruction:

on the day of obtaining nicotine withdrawal rats, subcutaneous injections of the remaining rats were performed according to step a, wherein the injection dose of nicotine solution was 0.2mg/kg, followed by CPP test after the 1st administration cycle; when the time of the rats of the experimental group and the time of the rats of the control group staying in the white box are found to be remarkably different, the rats of the experimental group are shown to regenerate nicotine dependence, and the rats of the rest experimental group and the rats of the control group are sacrificed, so that the rats reconstructed by nicotine addiction and the corresponding control rats are obtained;

(2) Taking hippocampal tissues:

(3) Preparation of hippocampal tissue cDNA:

(4) Group mix of hippocampal tissue cDNA:

(5) Group mixes of total hippocampal tissue protein:

(6) Group expression of 8 CHRNs genes in hippocampal tissues:

respectively taking the respective mixed samples of 3 groups of rats obtained in the step (4) for nicotine addiction, withdrawal and addiction reconstruction as experimental group samples, taking the corresponding mixed samples of 3 groups of control rats as control group samples, GAPDH as an internal reference gene, 8 CHRNs genes as target genes, carrying out qRT-PCR, and determining the gene expression change of the nicotine addiction, withdrawal and addiction reconstruction groups relative to the control groups;

(7) Group expression of 8 nAChRs proteins in hippocampal tissues:

and (4) respectively taking the respective mixed samples of 3 groups of rats subjected to nicotine addiction, withdrawal and addiction reconstruction and obtained in the step (5) as experimental group samples, taking the corresponding mixed samples of 3 groups of control rats as control group samples, taking GAPDH as reference protein, and taking 8 nAChRs proteins as target proteins, performing a Western blotting experiment, and then determining the protein expression change of the nicotine addiction, withdrawal and addiction reconstruction groups relative to the control group through protein relative quantification.

2. The method of claim 1, wherein in step (1) a, the rats in the experimental group developed nicotine dependency after the 7 th administration cycle.

3. The method of claim 1, wherein in step (1) b, the experimental group of rats has no nicotine dependency after the 2 nd dosing cycle.

4. The method according to claim 1, wherein in step (1) c, the rats in the experimental group re-develop nicotine dependence after the 3 rd dosing cycle.

5. The method according to any one of claims 1 to 4, wherein in step (1), before the model building is started, the rats are sub-packaged in independent aeration cages for adaptive feeding for 2 days, during which sufficient food and water are provided and proper temperature, humidity and light environment are maintained; and then testing the CPP reference value in a behavioral period of 5 days to eliminate abnormal individuals.

6. The method of claim 5, wherein the CPP benchmark test comprises: the rats to be tested are sequentially and independently loaded into the CPP device, partition plates of black boxes and white boxes on two sides are removed, the rats are allowed to move freely, the distance and time of free shuttling movement in the black boxes and the white boxes within 10min are recorded, the percentage of the time of the rats staying in the white boxes is used as a test index, and the rats staying in the white boxes for more than 50% and less than 10% of the total test time are removed according to a test result.

7. The method of any one of claims 1 to 4, wherein step (2) comprises:

after the rat dies at the cervical vertebra, taking off free cerebral cortex and exposing bilateral hippocampal tissues; separating hippocampal tissue from surrounding brain tissue, taking out the hippocampal tissue by peeling, cutting into two parts on ice, respectively placing into 2mL of EP tubes weighed in advance, packaging, recording the mass of the EP tubes before and after placing into the hippocampal tissue, and freezing at-80 deg.C in time.

8. The method of any one of claims 1 to 4, wherein step (3) comprises:

taking out frozen hippocampal tissue from-80 deg.C, adding 500 μ l lysate RNAiSo Plus and grinding beads into each tube, and grinding in precooled tissue grinder under 50Hz,30s; after grinding, putting the uniformly ground sample into a new 2mL centrifuge tube, cracking at room temperature for 10min, then centrifugally transferring supernatant into a new 1.5mL centrifuge tube, respectively extracting RNA by using chloroform and isopropanol, washing RNA precipitate by using 75% ethanol, then adding DEPC water with the corresponding volume into each tube according to the same mass-volume ratio according to the average value of the weights of the hippocampal tissues of the tubes in the step (2) corresponding to 100 mu L, dissolving the RNA precipitate by using water, and carrying out first strand cDNA synthesis according to the requirements of the specification of a cDNA synthesis kit.

9. The method according to any one of claims 1 to 4, wherein step (4) comprises:

and (3) using each cDNA sample with the same volume obtained in the step (3) as a template, performing ordinary PCR (polymerase chain reaction) for 30 cycles under the same space-time condition to amplify the GAPDH fragment, performing agarose gel electrophoresis on the amplification product, and quantifying a target band by using a multifunctional gel imager according to the electrophoresis result.

10. The method according to any one of claims 1 to 4, wherein step (5) comprises:

taking out frozen hippocampal tissues from-80 ℃, putting the tissues on ice, adding 150 mu L of Western Blotting lysate and grinding beads into each tube, grinding the tissues in a precooled tissue grinder, transferring the lysate which is uniformly ground into a new 2mL centrifuge tube after finishing grinding, continuously cracking the lysate on ice for 30 minutes, and centrifuging the lysate for 5min at 10000-14000g at 4 ℃ to obtain a supernatant; and calculating the volume of the added cracked supernatant when the hippocampal tissue with the same mass is added according to the mass/volume ratio of the hippocampal tissue in each tube, and taking the supernatant correspondingly to mix the hippocampal tissue of the rats in the same group with equal mass to obtain a mixed sample.

11. The method according to any one of claims 1 to 4, wherein step (6) comprises:

designing and synthesizing fluorescent quantitative PCR primers corresponding to the reference gene and the target gene, and carrying out qRT-PCR.

12. The method according to any one of claims 1 to 4, wherein step (7) comprises:

after the electrophoresis is finished, according to respective theoretical molecular weights of 8 nAChRs proteins and internal reference proteins, corresponding colloids are cut off by referring to Protein PAGE Ruler strips, and a nitrocellulose filter membrane (NC membrane) is used for Protein transfer printing under the condition of constant pressure;

after the protein transfer printing is finished, protein sealing, PBST membrane washing for 3 times, primary antibody incubation overnight, PBST membrane washing for 3 times, secondary antibody room temperature oscillation incubation for 1.5h and PBST membrane washing for 3 times are sequentially carried out, ECL chemiluminescence development is carried out on the finished NC membrane, protein relative quantification is carried out on the basis of gel imaging system software, and the expression level change of 8 nAChRs proteins of each group relative to a control group is calculated.