CN111826377A

CN111826377A - Signal peptide for promoting pullulanase extracellular expression

Info

Publication number: CN111826377A
Application number: CN202010749154.6A
Authority: CN
Inventors: 佟毅; 刘松; 徐奎栋; 李江华; 陈坚
Original assignee: Jiangnan University; Jilin COFCO Bio Chemical Co Ltd
Current assignee: Jiangnan University; Jilin COFCO Bio Chemical Co Ltd
Priority date: 2020-07-30
Filing date: 2020-07-30
Publication date: 2020-10-27
Anticipated expiration: 2040-07-30
Also published as: CN111826377B

Abstract

The invention discloses a signal peptide for promoting the extracellular expression of pullulanase, belonging to the technical field of genetic engineering and enzyme engineering. According to the invention, a Bacillus subtilis expression host is used, and a synonymous mutation sequence capable of obviously improving the extracellular protein amount is obtained by performing synonymous mutation on Bacillus subtilis endogenous signal peptides AprE, SacB and Epr, so that the normal translation of the protein is ensured, and the expression amount of the protein can be improved. The synonymous mutation sequences of the Apre, Epr and SacB signal peptides can respectively improve the extracellular enzyme activity by 2.92, 1.08 and 1.37 times compared with the wild type, thereby providing a strategy for the extracellular high-efficiency expression of the pullulanase.

Description

Signal peptide for promoting pullulanase extracellular expression

Technical Field

The invention relates to a signal peptide for promoting the extracellular expression of pullulanase, belonging to the technical field of genetic engineering and enzyme engineering.

Background

Pullulanase (EC 3.2.1.41) belongs to the family of alpha-amylases, and is capable of specifically hydrolyzing the branched alpha-1, 6-glucosidic bonds of amylopectin, also known as starch debranching enzyme. However, when wild strains are used as production strains to produce pullulanase, various problems exist, including difficult culture, low yield and the like, so that the industrial large-scale production is difficult to realize. With the rapid development of genetic engineering, the pullulanase coding gene realizes heterologous expression in different genetic engineering strains.

Soluble expression of pullulanase in B.subtilis has been successfully achieved in our earlier studies, and expression of pullulanase has been driven by a strong promoter, PlyTR (Yang, S et al, mutagenesis and administration of endogenous end phase-dependent microorganisms in Bacillus subtilis, 2017). However, although the extracellular enzyme activity of pullulanase has been significantly improved by these means, it still meets the requirement of large-scale industrial production. Therefore, how to further increase the extracellular expression level of pullulanase is still a problem to be solved.

Disclosure of Invention

In order to solve the problems, the extracellular expression of the pullulanase is further improved, and the extracellular expression of the pullulanase can be improved by means of synonymous mutation. Synonymous mutations in a gene may leave the amino acid sequence unchanged, but may result in significant changes in the level of gene transcription. The N-terminal coding region of the gene is modified by a synonymous mutation means, so that the gene expression level can be remarkably improved, and the influence on the enzyme activity can be almost ignored. According to the invention, the extracellular enzyme activity of the pullulanase can be obviously improved by using the signal peptide screened by the synonymous mutation.

The invention provides a signal peptide, wherein the nucleotide sequence of the signal peptide is shown in any one of SEQ ID No. 1-3.

In one embodiment of the invention, the nucleotide sequence of the signal peptide is the signal peptide AprE, SacB, Epr synonymous mutant sequence, respectively.

In one embodiment of the invention, the synonymous mutant sequence of the signal peptide AprE is shown as SEQ ID No. 1; the synonymous mutation sequence of the signal peptide SacB is shown as SEQ ID NO. 2; the synonymous mutant sequence of the signal peptide Epr is shown as SEQ ID NO. 3.

The invention provides a recombinant plasmid containing a signal peptide with a nucleotide sequence shown as SEQ ID No. 1-3.

In one embodiment of the present invention, the heavy plasmid is any vector that can be expressed in Bacillus subtilis.

In one embodiment of the invention, the starting vector comprises P43 NMK.

In one embodiment of the present invention, the recombinant plasmid further comprises a constitutive promoter.

In one embodiment of the invention, the constitutive promoter comprises a LytR promoter, and the nucleotide sequence of the LytR promoter is shown in SEQ ID No. 4.

The invention provides a recombinant bacterium containing a signal peptide with a nucleotide sequence shown as SEQ ID No. 1-3.

In one embodiment of the present invention, the recombinant bacterium is a bacillus subtilis host.

In one embodiment of the present invention, the recombinant bacterium is a host bacillus subtilis WB600 or bacillus subtilis 168.

The invention provides a method for improving protein expression quantity, which takes a recombinant strain containing a signal peptide with a nucleotide sequence shown as SEQ ID No. 1-3 as a fermentation strain to produce protein.

In one embodiment of the present invention, the recombinant bacterium is cultured to OD₆₀₀And (3) inoculating the bacterial liquid not lower than 3.0 into the reaction system according to the proportion of 1-10 mL/100 mL.

In one embodiment of the present invention, the culture medium of the culture system is TB culture medium, and the TB culture medium is cultured at 30-40 ℃ and 200-250 rpm for 25-35 hours.

The invention provides a method for improving the extracellular protein expression quantity of bacillus subtilis, which adds a signal peptide with a nucleotide sequence shown as SEQ ID NO. 1-3 at the N end of a nucleotide sequence of a coded protein.

In one embodiment of the invention, a signal peptide with a nucleotide sequence shown in SEQ ID No. 1-3 is added to the N-terminal of a target protein, a recombinant plasmid is constructed, and the recombinant plasmid is introduced into Bacillus subtilis.

In one embodiment of the present invention, a signal peptide having a nucleotide sequence represented by SEQ ID NO.1 to 3 is inserted after the initiation codon ATG of a nucleotide sequence encoding a target protein.

In one embodiment of the invention, the protein of interest is any protein that can be expressed extracellularly in B.subtilis.

In one embodiment of the invention, the protein of interest comprises pullulanase and/or sfGFP.

In one embodiment of the invention, the amino acid sequence of pullulanase has NCBI accession number AMQ67157 and the amino acid sequence is shown in SEQ ID NO. 5.

In one embodiment of the invention, the nucleotide sequence encoding sfGFP is shown in SEQ ID No. 7.

The invention also protects the application of the signal peptide with the nucleotide sequence shown in SEQ ID NO. 1-3, or the recombinant plasmid containing the signal peptide with the nucleotide sequence shown in SEQ ID NO. 1-3, or the recombinant bacterium containing the signal peptide with the nucleotide sequence shown in SEQ ID NO. 1-3 in improving the expression quantity of extracellular proteins.

The invention also protects the application of the method for improving the protein expression quantity in improving the extracellular protein expression quantity.

The invention also protects the application of the method for improving the extracellular protein expression quantity of the bacillus subtilis in improving the extracellular protein expression quantity.

The invention also protects the application of the recombinant plasmid, the recombinant bacterium or the synonymous mutant sequence of the signal peptides AprE, SacB and Epr in improving the expression quantity of extracellular proteins.

The invention has the beneficial effects that:

the signal peptides AprE, SacB and Epr are subjected to synonymous mutation, so that a synonymous mutation sequence capable of improving the extracellular expression of the protein is screened out, the obtained mutation sequence is fused at the N end of the pullulanase, the extracellular enzyme activity yield of the pullulanase can be obviously improved and reduced, and the extracellular enzyme activity of the pullulanase is respectively improved by 2.92, 1.08 and 1.37 times in the conversion production of bacillus subtilis.

Drawings

FIG. 1 shows the expression plasmid maps of the fusion of signal peptide and sfGFP to the N-terminal and C-terminal of pullulanase, respectively (AprE is taken as an example).

FIG. 2 is a map of an expression plasmid in which a signal peptide is fused to the N-terminus of pullulanase (AprE is taken as an example).

FIG. 3 shows the extracellular enzyme activities of pullulanase secreted by wild-type and NCS-modified strains.

Detailed Description

Seed culture medium: 10g/L of peptone, 5g/L of yeast extract and 5g/L of sodium chloride.

The fermentation medium is TB medium: peptone 12g/L, yeast extract 24g/L, glycerin 4mL/L, KH₂PO₄0.017mol/L，K₂HPO₄0.072mol/L。

Seed culture: and (3) selecting a single colony of the engineering bacteria, inoculating the single colony of the engineering bacteria into a triangular flask (250mL) with the liquid loading capacity of 25mL, culturing at the temperature of 37 ℃, and culturing for 12 hours at the rotating speed of a shaking table of 200 r/min.

Fermentation culture: the mixture was inoculated into a 25mL Erlenmeyer flask (250mL) at an inoculum size of 4% (v/v), and the fermentation was carried out at 37 ℃ for 48 hours.

And (3) measuring the green fluorescent protein expression level and biomass: in a 96-well plate, if 200. mu.L of the diluted fermentation broth was used, a Cytation3 cell imaging microplate detector (Berton instruments, Inc. USA) was used, and the green fluorescence excitation wavelength: 480nm, green fluorescence emission wavelength: 520nm, cell growth OD absorption wavelength: 600 nm.

The pullulanase enzyme activity determination method comprises the following steps: 1mL of 1mg/100mL pullulan polysaccharide substrate and 0.9mL of 100mM acetic acid-sodium acetate buffer solution with pH4.5 are uniformly mixed, the mixture is placed in a water bath kettle at 60 ℃ for preheating for 10min, 0.1mL of pullulanase solution is added, after the reaction is carried out for 10min, 3mL of DNS color developing solution is added, then the mixture is boiled in a boiling water bath for 7min, the mixture is placed in ice water to stop the color developing reaction, 10mL of deionized water is added, the mixture is uniformly mixed, and the light absorption value is measured at 540 nm.

Definition of enzyme activity: the amount of enzyme that produces 1. mu. mol of reducing sugar per unit time is one unit of enzyme activity.

Example 1: construction of an Apre signal peptide NCS synonymous mutation library

Connecting a LytR promoter (shown in sequence information in SEQ ID NO. 4) to a P43NMK plasmid through a one-step cloning kit (purchased from Nanjing Nuojingzau Biotechnology Co., Ltd.), constructing to obtain a recombinant plasmid, transferring the recombinant plasmid into E.coli JM109, coating a bacterial liquid on an LB plate containing 100 mu g/L ampicillin resistance, culturing at 37 ℃ until a monoclonal antibody grows out, and selecting the monoclonal antibody for sequencing and verification to obtain a plasmid P43 NMK-LytR; fusing a pullulanase gene (the nucleotide sequence is shown as SEQ ID NO. 6) to the downstream of the LytR by a one-step cloning kit by using the same one-step cloning method to construct a recombinant plasmid P43 NMK-LytR-Pul; by using the same one-step cloning method, sfGFP fluorescent protein and Apre signal peptide (nucleotide sequences are shown as SEQ ID NO.7 and 8) are respectively connected to the C end and the N end of the pullulanase to construct a recombinant plasmid P43 NMK-Apre-Pul.

A synonymous mutation library (synonymous mutation recombinant plasmid) of the first 30 bases of the N end of Apre is obtained by PCR by using P43NMK-Apre-Pul as a template and an upstream degenerate primer, namely, the first 30 amino acid sequences are unchanged and the nucleotide sequences are changed.

An upstream degenerate primer:

ATGAGRAGYAARAARTTRTGGATHAGYTTRTTRtttgcgttaacgttaatctttacgatgg(SEQ IDNO.12)；

a downstream degenerate primer:

GTGTACATTTCACCTCCTTTAAATTACTTTCATTAT(SEQ ID NO.11)。

example 2: construction of SacB signal peptide NCS synonymous mutation library

The specific implementation manner is the same as that in example 1, except that after obtaining the P43NMK-LytR-Pul, a one-step cloning method is utilized to respectively connect sfGFP fluorescent protein and SacB signal peptide (nucleotide sequences are shown as SEQ ID NO. 9) to the C end (sfGFP fluorescent protein) and the N end (SacB signal peptide) of pullulanase, so as to construct a recombinant plasmid P43 NMK-SacB-Pul.

A synonymous mutation library (synonymous mutation recombinant plasmid) of the first 30 bases of N-terminal of SacB, namely the first 30 amino acid sequences are unchanged and the nucleotide sequences are changed, is obtained by PCR by using P43NMK-SacB-Pul as a template and using an upstream degenerate primer and a downstream degenerate primer.

An upstream degenerate primer:

ATGCTNAARAGRACNTCNTTYGTNTCNTCNTTRttcatcagttcagctgttttactatcaatct(SEQID NO.13)；

a downstream degenerate primer:

GTGTACATTTCACCTCCTTTAAATTACTTTCATTAT(SEQ ID NO.11)。

example 3: construction of an Epr signal peptide NCS synonymous mutation library

The specific implementation manner is the same as that in example 1, except that after obtaining the P43NMK-LytR-Pul, the sfGFP fluorescent protein and the Epr signal peptide (the nucleotide sequences are shown in SEQ ID NO. 10) are respectively connected to the C end (sfGFP fluorescent protein) and the N end (SacB signal peptide) of the pullulanase by a one-step cloning method, so as to construct a recombinant plasmid P43 NMK-SacB-Pul.

A synonymous mutation library (synonymous mutation recombinant plasmid) of the first 30 bases of the N end of Epr is obtained by PCR by using P43NMK-Epr-Pul as a template and an upstream and downstream degenerate primer, namely, the amino acid sequence of the first 30 is unchanged and the nucleotide sequence is changed.

An upstream degenerate primer:

ATGTTRAARAARGTNATHTTRGCNGCNTTYATHttagtaggaagtactttgggagctttta(SEQ IDNO.14)；

a downstream degenerate primer:

GTGTACATTTCACCTCCTTTAAATTACTTTCATTAT(SEQ ID NO.11)。

example 4: screening of nucleotide sequence of signal peptide from NCS synonymous mutant library

(1) Respectively transforming the synonymous mutation recombinant plasmids constructed in the embodiments 1-3 into an expression host bacillus subtilis WB600, coating a transformation solution on an LB (lysogeny broth) plate containing 50 mu g/mL kanamycin resistance to challenge growth, culturing at 37 ℃ until a monoclonal is grown out, picking the monoclonal to a 96 shallow-well plate containing 50 mu g/mL kanamycin resistance 200 mu L LB culture medium, and culturing for 8 hours to obtain a seed solution;

(2) inoculating the seed solution to a 96-deep-well plate containing a 50 mu g/mL kanamycin-resistant 800 mu LTB culture medium according to the inoculation amount of 4mL/100mL, and culturing for 24 hours to obtain a fermentation liquid;

(3) the fermentation broth was rapidly frozen on ice, centrifuged, and the supernatant was removed, diluted to an appropriate magnification with 100mM PBS buffer (pH7.2), and the fluorescence value (excitation light 480, absorption light 520) and OD were measured by a microplate reader₆₀₀。

The relative fluorescence intensity RFI was defined as fluorescence value/OD, and cells with the highest relative fluorescence intensity were selected according to the RFI value and sent to soyawa corporation for sequencing.

After sequencing identification, the AprE signal peptide successfully realizes synonymous mutation at the N end, and the nucleotide sequence of the mutation part is shown in SEQ ID NO. 15; the SacB signal peptide successfully realizes synonymous mutation at the N end, and the nucleotide sequence of the mutant part is shown as SEQID No. 16; the Epr signal peptide successfully realizes synonymous mutation at the N-terminal, and the nucleotide sequence of the mutant part of the Epr signal peptide is shown as SEQ ID No. 17.

Example 5: application of synonymous mutation signal peptide in improvement of extracellular expression of pullulanase

Plasmids were extracted from the sequenced cells having the highest fluorescence intensity obtained in example 4, and sfGFP fluorescent proteins were removed using primers as templates, respectively, by PCR to obtain recombinant plasmids from which fluorescent proteins were removed, recombinant plasmids containing the synonymous mutation sequences for the aprE signal peptide, SacB signal peptide, and Epr signal peptide, respectively, were transformed into Bacillus subtilis WB600 to obtain recombinant bacteria, which were inoculated into 250mL shake flasks containing 20mL LB medium resistant to 50. mu.g/mL kanamycin,after fermentation at 37 ℃ for 8 hours at 220rpm, the OD was allowed to stand₆₀₀The amount of pullulan was 4 or more, and the pullulan was inoculated into a 250mL shake flask containing 50. mu.g/mL kanamycin-resistant 25mL TB medium at a ratio of 4mL/100mL, and after 30 hours of fermentation at 37 ℃ and 250rpm, the extracellular enzyme activity of pullulanase was measured, and the results are shown in FIG. 3.

Removal of sfGFP forward primer:

CGGTAAAAAATAAtgagattatcaaaaaggatcttcacctagat(SEQ ID NO.18)；

removal of sfGFP downstream primer:

gataatctcaTTATTTTTTACCGTGATCTGGAGAAACttc(SEQ ID NO.19)。

by measuring the extracellular enzyme activity of the pullulanase, the synonymous mutation sequences of Apre, Epr and SacB signal peptides are found to respectively improve the extracellular enzyme activity by 2.92, 1.08 and 1.37 times compared with the wild type.

TABLE 1 pullulanase extracellular enzyme Activity (U/mL)

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> Jilin Mizhong Lianghua Co., Ltd

Jiangnan University

<120> Signal peptide for promoting extracellular expression of pullulanase

<160>19

<170>PatentIn version 3.3

<210>1

<211>84

<212>DNA

<213> Artificial sequence

<400>1

agaagtaaaa aattatggat aagtttatta tttgcgttaa cgttaatctt tacgatggcg 60

ttcagcaaca tgtctgcgca ggct 84

<210>2

<211>84

<212>DNA

<213> Artificial sequence

<400>2

aatataaaaa aatttgcaaa acaagctaca gtattaacct ttactaccgc actgctggca 60

ggaggcgcaa ctcaagcgtt tgcg 84

<210>3

<211>78

<212>DNA

<213> Artificial sequence

<400>3

aaaaatatgt cttgtaaact agttgtatct gtcactctgt ttttcagttt tctcaccata 60

ggccctctcg ctcatgcg 78

<210>4

<211>320

<212>DNA

<213> Artificial sequence

<400>4

ctaaccctac ataagtacct tcttttgttt caatgttact gtctggcgat acatcttcac 60

cttgactctt ttgactatta accccgcaac ccgaaagaag caatataaag aacagtaaag 120

caataaattt tttcattttt ttcacctcat tatattttat cgtcaaccta ttttatattt 180

taaagaaaaa ttaagaaaca atgaaacttt tttttataaa aaacgactat tttaggattt 240

cattcttgta ttaaatagag ttgtatttat tggaaattta actcataatg aaagtaattt 300

aaaggaggtg aaatgtacac 320

<210>5

<211>724

<212>PRT

<213> Artificial sequence

<400>5

Asp Ala Ala Lys Pro Ala Val Ser Asn Ala Tyr Leu Asp Ala Ser Asn

1 5 10 15

Gln Val Leu Val Lys Leu Ser Gln Pro Leu Thr Leu Gly Glu Gly Ala

20 2530

Ser Gly Phe Thr Val His Asp Asp Thr Ala Asn Lys Asp Ile Pro Val

35 40 45

Thr Ser Val Lys Asp Ala Ser Leu Gly Gln Val Glu Ser Gly Val Lys

50 55 60

Thr Asp Leu Val Thr Val Thr Leu Gly Glu Asp Pro Asp Val Ser His

65 70 75 80

Thr Leu Ser Ile Gln Thr Asp Gly Tyr Gln Ala Lys Gln Val Ile Pro

85 90 95

Arg Asn Val Leu Asn Ser Ser Gln Tyr Tyr Tyr Ser Gly Asp Asp Leu

100 105 110

Gly Asn Thr Tyr Thr Gln Lys Ala Thr Thr Phe Lys Val Trp Ala Pro

115 120 125

Thr Ser Thr Gln Val Asn Val Leu Leu Tyr Asp Ser Ala Thr Gly Ser

130 135 140

Val Thr Lys Ile Val Pro Met Thr Ala Ser Gly His Gly Val Trp Glu

145 150 155 160

Ala Thr Val Asn Gln Asn Leu Glu Asn Trp Tyr Tyr Met Tyr Glu Val

165 170 175

Thr Gly Gln Gly Ser Thr Arg Thr Ala Val Asp Pro Tyr Ala Thr Ala

180 185190

Ile Ala Pro Asn Gly Thr Arg Gly Met Ile Val Asp Leu Ala Lys Thr

195 200 205

Asp Pro Ala Gly Trp Asn Ser Asp Lys His Ile Thr Pro Lys Asn Ile

210 215 220

Glu Asp Glu Val Ile Tyr Glu Met His Val Arg Asp Phe Ser Ile Asp

225 230 235 240

Pro Asn Ser Gly Met Lys Asn Lys Gly Lys Tyr Leu Ala Leu Thr Glu

245 250 255

Lys Gly Thr Lys Gly Pro Asp Asn Val Lys Thr Gly Ile Asp Ser Leu

260 265 270

Lys Gln Leu Gly Ile Thr His Val Gln Leu Met Pro Val Phe Ala Ser

275 280 285

Asn Ser Val Asp Glu Thr Asp Pro Thr Gln Tyr Asn Trp Gly Tyr Asp

290 295 300

Pro Arg Asn Tyr Asp Val Pro Glu Gly Gln Tyr Ala Thr Asn Ala Asn

305 310 315 320

Gly Asn Ala Arg Ile Lys Glu Phe Lys Glu Met Val Leu Ser Leu His

325 330 335

Arg Glu His Ile Gly Val Asn Met Asp Val Val Tyr Asn His Thr Phe

340 345 350

Ala Thr Gln Ile Ser Asp Phe Asp Lys Ile Val Pro Glu Tyr Tyr Tyr

355 360 365

Arg Thr Asp Asp Ala Gly Asn Tyr Thr Asn Gly Ser Gly Thr Gly Asn

370 375 380

Glu Ile Ala Ala Glu Arg Pro Met Val Gln Lys Phe Ile Ile Asp Ser

385 390 395 400

Leu Lys Tyr Trp Val Asn Glu Tyr His Ile Asp Gly Phe Arg Phe Asp

405 410 415

Leu Met Ala Leu Leu Gly Lys Asp Thr Met Ser Lys Ala Ala Ser Glu

420 425 430

Leu His Ala Ile Asn Pro Gly Ile Ala Leu Tyr Gly Glu Pro Trp Thr

435 440 445

Gly Gly Thr Ser Ala Leu Pro Asp Asp Gln Leu Leu Thr Lys Gly Ala

450 455 460

Gln Lys Gly Met Gly Val Ala Val Phe Asn Asp Asn Leu Arg Asn Ala

465 470 475 480

Leu Asp Gly Asn Val Phe Asp Ser Ser Ala Gln Gly Phe Ala Thr Gly

485 490 495

Ala Thr Gly Leu Thr Asp Ala Ile Lys Asn Gly Val Glu Gly Ser Ile

500 505 510

Asn Asp Phe Thr Ser Ser Pro Gly Glu Thr Ile Asn Tyr Val Thr Ser

515 520 525

His Asp Asn Tyr Thr Leu Trp Asp Lys Ile Ala Leu Ser Asn Pro Asn

530 535 540

Asp Ser Glu Ala Asp Arg Ile Lys Met Asp Glu Leu Ala Gln Ala Val

545 550 555 560

Val Met Thr Ser Gln Gly Val Pro Phe Met Gln Gly Gly Glu Glu Met

565 570 575

Leu Arg Thr Lys Gly Gly Asn Asp Asn Ser Tyr Asn Ala Gly Asp Ala

580 585 590

Val Asn Glu Phe Asp Trp Ser Arg Lys Ala Gln Tyr Pro Asp Val Phe

595 600 605

Asn Tyr Tyr Ser Gly Leu Ile His Leu Arg Leu Asp His Pro Ala Phe

610 615 620

Arg Met Thr Thr Ala Asn Glu Ile Asn Ser His Leu Gln Phe Leu Asn

625 630 635 640

Ser Pro Glu Asn Thr Val Ala Tyr Glu Leu Thr Asp His Val Asn Lys

645 650 655

Asp Lys Trp Gly Asn Ile Ile Val Val Tyr Asn Pro Asn Lys Thr Val

660 665 670

Ala Thr Ile Asn Leu Pro Ser Gly Lys Trp Ala Ile Asn Ala Thr Ser

675 680 685

Gly Lys Val Gly Glu Ser Thr Leu Gly Gln Ala Glu Gly Ser Val Gln

690 695 700

Val Pro Gly Ile Ser Met Met Ile Leu His Gln Glu Val Ser Pro Asp

705 710 715 720

His Gly Lys Lys

<210>6

<211>2172

<212>DNA

<213> Artificial sequence

<400>6

gatgctgcta aaccagcagt ttctaacgct taccttgacg cttctaacca agttttagtt 60

aaattatctc aaccattaac attaggtgaa ggtgcttctg gtttcactgt acatgatgac 120

actgctaaca aagacatccc agtaacatct gtaaaagacg cttctttagg tcaagttgaa 180

tcaggtgtaa aaactgacct tgttactgtt actttaggcg aagatccaga tgtatctcac 240

actttatcta tccaaacaga cggttaccaa gctaaacaag taatcccacg taacgtactt 300

aactcttctc aatattacta ttctggtgat gatttaggaa acacatacac acaaaaagct 360

actactttca aagtttgggc tcctacatct actcaagtta acgtattgtt atacgattct 420

gctacaggta gcgttacaaa aatcgttcca atgacggctt caggtcacgg tgtttgggag 480

gctactgtta accaaaactt agaaaactgg tactacatgt acgaagtaac tggtcaaggt 540

tctacacgca ctgctgttga tccttacgct actgctatcg ctccaaacgg tacacgcggc 600

atgatcgtag atttagctaa aactgaccca gcaggttgga actctgataa acacattact 660

ccaaaaaaca ttgaagatga agttatctac gaaatgcacg tacgtgattt ctctatcgat 720

ccaaactcag gtatgaaaaa caaaggtaaa tacttagctc taactgaaaa aggcactaaa 780

ggtcctgata acgttaaaac aggtatcgac tctcttaagc aattaggtat tacacatgtt 840

caattaatgc cagttttcgc atctaactca gttgacgaaa ctgatccaac acaatacaac 900

tggggttacg acccacgtaa ctacgatgta ccagaaggtc aatatgcaac taacgctaac 960

ggtaacgcac gtattaaaga attcaaagaa atggttttat cactacaccg tgagcacatc 1020

ggtgttaaca tggacgttgt ttacaaccac acgttcgcta ctcaaatctc tgacttcgat 1080

aaaattgttc cagagtacta ttaccgcact gacgacgcag gtaactacac taacggttct 1140

ggtactggta acgaaattgc tgcagaacgt cctatggtgc aaaaattcat catcgatagc 1200

cttaaatact gggttaacga ataccacatt gacggcttcc gtttcgactt aatggcttta 1260

cttggtaaag acacaatgtc taaggctgct tctgagttac atgctatcaa cccaggtatt 1320

gctttatatg gcgaaccttg gactggtggt acaagcgctc ttcctgacga ccaactttta 1380

actaaaggtg cacaaaaagg catgggagta gctgtattca acgataacct tcgtaacgca 1440

ttagacggaa acgttttcga ttcttctgct caaggattcg caacaggagc tacaggtctg 1500

actgatgcta ttaaaaacgg agttgaagga tcaatcaacg atttcacttc ttctcctggc 1560

gaaacaatta actacgttac atcacacgat aactacactc tttgggacaa aatcgctttg 1620

tctaacccta acgactctga agcagatcgc atcaaaatgg atgagcttgc tcaagctgtt 1680

gttatgactt ctcaaggtgt acctttcatg caaggtggtg aagaaatgtt acgcactaaa 1740

ggtggtaacg ataacagcta taacgcgggt gatgctgtaa acgaattcga ctggtctcgt 1800

aaagctcaat accctgacgt tttcaactac tactcaggtt taatccacct tcgtcttgac 1860

catccagctt tccgtatgac aacagctaac gaaatcaact ctcaccttca attccttaac 1920

tcacctgaaa acacagtagc ttacgaactt actgaccacg taaacaaaga taaatggggt 1980

aacattatcg ttgtttacaa ccctaacaag actgtagcaa ctatcaactt accatctggt 2040

aaatgggcta tcaacgcaac tagcggtaaa gtaggtgaat ctacattagg tcaagctgaa 2100

ggatctgtac aagttcctgg tatttctatg atgatccttc accaagaagt ttctccagat 2160

cacggtaaaa aa 2172

<210>7

<211>717

<212>DNA

<213> Artificial sequence

<400>7

gtgagcaagg gcgaggagct gttcaccggg gtggtgccca tcctggtcga gctggacggc 60

gacgtaaacg gccacaagtt cagcgtgaga ggcgagggcg agggcgatgc caccaatggc 120

aagctgaccc tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc 180

gtgaccaccc tgacctacgg cgtgcagtgc ttcagccgct accccgacca catgaagcgc 240

cacgacttct tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac catcagtttc 300

aaggacgacg gcacatacaa gacccgcgcc gaggtgaagt tcgagggcga caccctggtg 360

aaccgcatcg agctgaaggg catcgacttc aaggaggacg gcaacatcct ggggcacaag 420

ctggagtaca acttcaacag ccacaacgtc tatatcacgg ccgacaagca gaagaacggc 480

atcaaggcca acttcaagat ccgccacaac gtggaggacg gcagcgtgca gctcgccgac 540

cactaccagc agaacacccc catcggcgac ggccccgtgc tgctgcccga caaccactac 600

ctgagcaccc agtccgtgct gagcaaagac cccaacgaga agcgcgatca catggtcctg 660

ctggagttcg tgaccgccgc cgggatcact cacggcatgg acgagctgta caagtaa 717

<210>8

<211>84

<212>DNA

<213> Artificial sequence

<400>8

agaagcaaaa aattgtggat cagcttgttg tttgcgttaa cgttaatctt tacgatggcg 60

ttcagcaaca tgtctgcgca ggct 84

<210>9

<211>84

<212>DNA

<213> Artificial sequence

<400>9

aacatcaaaa agtttgcaaa acaagcaaca gtattaacct ttactaccgc actgctggca 60

ggaggcgcaa ctcaagcgtt tgcg 84

<210>10

<211>78

<212>DNA

<213> Artificial sequence

<400>10

aaaaacatgt cttgcaaact tgttgtatca gtcactctgt ttttcagttt tctcaccata 60

ggccctctcg ctcatgcg 78

<210>11

<211>36

<212>DNA

<213> Artificial sequence

<400>11

gtgtacattt cacctccttt aaattacttt cattat 36

<210>12

<211>61

<212>DNA

<213> Artificial sequence

<400>12

atgagragya araarttrtg gathagyttr ttrtttgcgt taacgttaat ctttacgatg 60

g 61

<210>13

<211>64

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<222>(6)..(6)

<223>n is a, c, g, or t

<220>

<221>misc_feature

<222>(15)..(15)

<223>n is a, c, g, or t

<220>

<221>misc_feature

<222>(18)..(18)

<223>n is a, c, g, or t

<220>

<221>misc_feature

<222>(24)..(24)

<223>n is a, c, g, or t

<220>

<221>misc_feature

<222>(27)..(27)

<223>n is a, c, g, or t

<220>

<221>misc_feature

<222>(30)..(30)

<223>n is a, c, g, or t

<400>13

atgctnaara gracntcntt ygtntcntcn ttrttcatca gttcagctgt tttactatca 60

atct 64

<210>14

<211>61

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<222>(15)..(15)

<223>n is a, c, g, or t

<220>

<221>misc_feature

<222>(24)..(24)

<223>n is a, c, g, or t

<220>

<221>misc_feature

<222>(27)..(27)

<223>n is a, c, g, or t

<400>14

atgttraara argtnathtt rgcngcntty athttagtag gaagtacttt gggagctttt 60

a 61

<210>15

<211>30

<212>DNA

<213> Artificial sequence

<400>15

agaagtaaaa aattatggat aagtttatta 30

<210>16

<211>30

<212>DNA

<213> Artificial sequence

<400>16

aatataaaaa aatttgcaaa acaagctaca 30

<210>17

<211>30

<212>DNA

<213> Artificial sequence

<400>17

aaaaatatgt cttgtaaact agttgtatct 30

<210>18

<211>44

<212>DNA

<213> Artificial sequence

<400>18

cggtaaaaaa taatgagatt atcaaaaagg atcttcacct agat 44

<210>19

<211>40

<212>DNA

<213> Artificial sequence

<400>19

gataatctca ttatttttta ccgtgatctg gagaaacttc 40

Claims

1. The signal peptide is characterized in that the nucleotide sequences of the signal peptide are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.

2. A recombinant plasmid comprising the signal peptide of claim 1.

3. A recombinant bacterium comprising the signal peptide according to claim 1 or the recombinant plasmid according to claim 2.

4. A method for increasing the expression level of a protein, comprising producing the protein using the recombinant strain of claim 3 as a fermentation strain.

5. The method according to claim 4, wherein the recombinant bacterium is cultured and OD is obtained₆₀₀At least 3 bacterial liquid, and inoculating the bacterial liquid into the reaction system in an amount of 1-10 mL/100 mL.

6. A method for increasing the expression level of extracellular proteins of Bacillus subtilis, which comprises adding the signal peptide of claim 1 to the N-terminus of the nucleotide sequence encoding the protein.

7. The method according to claim 6, characterized in that the method is: adding the signal peptide of claim 1 to the N-terminal of a target protein to construct a recombinant plasmid; and introducing the recombinant plasmid into bacillus subtilis to construct a recombinant bacterium.

8. The method of claim 6, wherein the protein of interest comprises pullulanase and/or sfGFP.

9. The method according to claim 7, wherein the pullulanase has NCBI accession No. AMQ 67157; the nucleotide sequence for coding the sfGFP is shown as SEQ ID NO. 7.

10. Use of the signal peptide according to claim 1, or the recombinant plasmid according to claim 2, or the recombinant bacterium according to claim 3, or the method according to any one of claims 4 to 9 for increasing the expression level of extracellular proteins.