CN111808924A - Method for creating new allelic variation through rice micro-effect gene cloning - Google Patents

Method for creating new allelic variation through rice micro-effect gene cloning Download PDF

Info

Publication number
CN111808924A
CN111808924A CN202010678470.9A CN202010678470A CN111808924A CN 111808924 A CN111808924 A CN 111808924A CN 202010678470 A CN202010678470 A CN 202010678470A CN 111808924 A CN111808924 A CN 111808924A
Authority
CN
China
Prior art keywords
gene
rice
qgl1
allele
interval
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010678470.9A
Other languages
Chinese (zh)
Inventor
朱玉君
庄杰云
张振华
樊叶杨
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China National Rice Research Institute
Original Assignee
China National Rice Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China National Rice Research Institute filed Critical China National Rice Research Institute
Priority to CN202010678470.9A priority Critical patent/CN111808924A/en
Publication of CN111808924A publication Critical patent/CN111808924A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Botany (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a method for creating new allelic variation through rice micro-effect gene cloning. Specifically, micro-effect particle length QTL qGL1-34.3 is cloned from a secondary population derived from rice variety Zhenshan 97 and Miyang 46, and the difference of the particle length between Zhenshan 97 and Miyang 46 alleles is about 0.021 mm. The method adopts CRISPR/Cas9 gene editing technology to carry out directional editing on qGL1-34.3, the grain length difference between the obtained new allele and the wild type is about 0.095mm, and the allele variation with larger effect is successfully created on the micro-effect gene locus. The invention provides a new method for creating new allelic variation, is beneficial to widening the genetic variation of the cultivated rice and further provides a technical basis for improving rice varieties.

Description

Method for creating new allelic variation through rice micro-effect gene cloning
Technical Field
The invention relates to the technical field of plant genetic engineering, in particular to a method for creating new allelic variation through micro-effect gene cloning, namely cloning of rice grain length micro-effect gene qGL1-34.3 and creating the new allelic variation of the micro-effect gene by applying a gene editing technology.
Background
Rice is one of the most important food crops, and nearly more than half of the population in the world takes rice as staple food. China is a big country for rice production and consumption, and the cultivation of excellent new rice varieties is an important basis for guaranteeing national grain safety.
The improvement of rice varieties is based on genetic variation, but in the processes of long-term domestication and variety improvement of rice, no matter from wild rice to cultivated rice or from local varieties to modern improved varieties, the genetic diversity is continuously reduced due to manual selection, and only a small part of genetic variation is reserved. This phenomenon may be one of the causes of the bottlenecks in rice yield improvement in recent years. Therefore, broadening genetic variation has important significance for rice variety improvement, and comprises two basic approaches: introduction of exogenous gene and creation of new allelic variation. For cultivated rice, the introduction of favorable alleles into wild rice can effectively broaden the genetic variation. Significant success has been achieved in improving quality traits such as disease and insect resistance, but progress has been slow in improving yield traits due to poor performance of wild rice itself and control of quantitative traits by multiple genes.
The traditional creation of new allelic variation mainly refers to mutation breeding, namely, organisms are induced to mutate through physical, chemical or biological means, and new variety resources are obtained through screening favorable variation, so that the method has obvious effect in the creation of new germplasm and the breeding of new varieties. However, the mutation caused by the traditional mutagenesis method has randomness, so that the favorable mutation needs to be screened in a large-scale population, and the efficiency is low.
The emerging gene editing technology can directionally edit target genes, improve target characters and provide an effective means for creating new allelic variation. By using gene editing techniques, a target gene for controlling a target trait is first specified. At present, 31 Quantitative Trait Loci (QTL) related to yield are cloned in rice by using a Quantitative Trait Locus (QTL) positioning method, wherein the maximum number of the QTL controlling grain weight and grain type is 17. These QTLs all exhibit major effects, but the proportion is too low in terms of genome distribution and initial localization interval, limiting the application of genome editing techniques in broadening the genetic variation of oryza sativa. Compared with the main effect QTL, the micro effect QTL also plays an important role in the regulation and control of important agronomic characters of rice, and the QTL is not ignored no matter mechanism analysis or breeding application. Moreover, previous studies have shown that the specific gravity of the micro-effect QTL in the genome far exceeds that of the main effect QTL. Therefore, it would be beneficial to broaden the genetic variation of cultivated rice if the effective QTL could be successfully cloned and the genetic editing technology could be applied to create new allelic variation.
Based on this background, the inventors have established a technical approach to create new allelic variations by means of minigene cloning.
Disclosure of Invention
The invention provides a method for creating new allelic variation through micro-effect gene cloning, which is specifically represented by cloning of rice grain length micro-effect QTL qGL1-34.3 and creating new allelic variation while performing functional verification.
A method for creating new allelic variations by means of minigene cloning, characterized in that: (1) constructing a near isogenic line group by applying a residual heterozygote strategy; (2) fine positioning the micro-effect gene to the interval containing only a few candidate genes; (3) and (3) directionally mutating the candidate gene by using a gene editing technology, and obtaining new allelic variation while performing functional verification.
The method comprises the following detailed steps:
(1) screening the remaining heterozygote individual plants in the heterozygote region covering the region where the target gene is located, and developing F after selfing2A population;
(2) from F2Screening new residual heterozygote single plants with continuously overlapped heterozygote intervals in the group, and respectively selfing to develop F2A population;
(3) from each F2Selecting the individuals in the heterozygous interval from the population, and selfing to obtain near isogenic line populations with continuously overlapped separation intervals;
(4) firstly, analyzing whether the segregation interval of each near-isogenic line group has gene segregation, then comparing the segregation intervals of each group, and reducing the interval of the gene;
(5) repeating steps (1) to (4) until the region where the gene is located is limited to the size containing only a few candidate genes;
(6) directionally editing candidate genes by using a gene editing technology to obtain mutants, and verifying the functions of the candidate genes by analyzing the phenotypic difference between the mutants and wild types;
(7) the allele carried by the mutant with mutation on the target gene locus and character mutation is the new allele mutation.
The cloned grain growth micro-effect gene is qGL1-34.3, and the fragment thereof is shown as SEQ ID NO: 1-3, or a sequence corresponding to SEQ ID NO: 4-6, the specific information is as follows:
SEQ ID NO: 1 shows the whole genome sequence of qGL1-34.3 allele from Zhenshan 97.
SEQ ID NO: 2 shows the cDNA sequence of qGL1-34.3 allele from Zhenshan 97.
SEQ ID NO: 3 shows the amino acid sequence coded by qGL1-34.3 allele from Zhenshan 97.
SEQ ID NO: shown in FIG. 4 is the whole genome sequence of qGL1-34.3 allele from Miyang 46.
SEQ ID NO: shown in FIG. 5 is the cDNA sequence of qGL1-34.3 allele derived from Miyang 46.
SEQ ID NO: shown in FIG. 6 is the amino acid sequence encoded by the qGL1-34.3 allele derived from Miyang 46.
Drawings
FIG. 1 shows the process of constructing a population of near isogenic lines.
FIG. 2 shows the positioning process of qGL 1-34.3: (A) qTGW1.2b is defined in the 371.5kb interval; (B) qTGW1.2b is defined in the 108.6kb interval; (C) qGL1-34.3 is defined in the 44.0kb interval; (D) the region where qGL1-34.3 is located contains 6 annotated genes.
FIG. 3 shows the difference in grain size between Zhenshan 97 type near isogenic line and Miyang 46 type near isogenic line.
FIG. 4 shows the difference in grain length between wild-type Nipponbare and the knockout mutant.
Detailed Description
The following examples are further illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods mentioned in the examples are all conventional methods in molecular biology without special indication; the related experimental reagents and consumables are all conventional biochemical reagents without special description.
Example 1 Fine positioning of qGL1-34.3
1. Near isogenic line population construction
BC derived from Zhenshan 97// Zhenshan 97/Miyang 46 by applicant2F9:10In the Near Isogenic Line (NIL) population, 3 QTLs for controlling rice thousand seed weight are decomposed in the region of the rice 1 st chromosome long arm RM11730-RM11885, wherein the QTLs are qTGW1.2a, qTGW1.2b and qTGW1.2c (Wang et al 2015). The invention aims at qTGW1.2b with about 418.8kb in the interval RM11781-RM11800 to clone map. For the interval, the inventors constructed 2 sets of populations including 4 and 3 NIL populations respectively, and the construction process is shown in fig. 1.
First, from BC2F9The population picked 1 remaining individual hybrids with a heterozygous interval RM212-RM11787 and comprising qtwg1.2b. The single plant is inbred for 2 generations, and is detected by 4 newly developed InDel marks to obtain 1 BC with a heterozygous interval of Wn33304-RM117872F11And (4) a group. In the group, the remaining hybrid individuals with 4 hybrid regions in continuous overlapping arrangement are selected and selfed to generate 4 BC2F12NIL-F2Group, selecting non-recombinant individual plant from each group by genotype detection, selfing to generate 4 BC2F12:13NIL populations, L1, L2, L3 and L4, respectively.
Then, according to the 4 BC2F12:13Location of NIL population at BC2F12Screening 1 remaining heterozygote single plants with the heterozygote interval of Wn34293-RM11787 from the group, and selfing to generate BC2F13In the population, 4 InDel markers are newly designed, and the marker is updated into Wn34286-RM11787 from the heterozygous interval through genotype detection, and the BC is obtained2F13Screening 3 residual heterozygote individuals in the population, selfing to generate 3 BC2F14NIL-F2Group, selecting non-recombinant individual plant from each group by genotype detection, selfing to generate 3 BC2F14:15NIL populations, W1, W2 and W3, respectively.
DNA extraction
The DNA extraction of the QTL positioning population comprises the following steps:
(1) cutting 1-2cm rice seedling leaves, and placing into a 2.0ml sterilized centrifuge tube.
(2) 300ul of DNA extract and 1 small steel ball with a diameter of 2.0mm were added, and the leaves were ground with a tissue grinder.
(3) 300ul of chloroform extract was added, and the mixture was inverted and mixed.
(4) After centrifugation at 12,000rpm for 2min, 250ul of the supernatant was pipetted into a 1.5ml sterile centrifuge tube.
(5) 500ul of precooled absolute ethyl alcohol is added, and the mixture is inverted and mixed evenly.
(6) After centrifugation at 12,000rpm for 3min, the supernatant was discarded, and the centrifuge tube walls and pellet were washed with 70% ethanol.
(7) The tube was inverted onto paper, and the DNA pellet was naturally dried, and then dissolved in 100ul of 1/10 XTE buffer.
(8) 1ul of DNA was used as a template for PCR amplification.
InDel marker development
According to the genome positions of the interval marks RM11781 and RM11800 in Nippon rice variety Nippon, the sequence of Nippon in the interval RM11781-RM11800 is downloaded from RGAP (http:// rice. plant. msu. edu/cgi-bin/gbrowse/rice/# search). By comparing the whole genome re-sequencing results of Zhenshan 97 and Miyang 46, the position of the insertion deletion of the sequence between parents is searched in a target interval, and the upstream and downstream primer sequences are designed by using the application software Oligo 7.0(Lasergene company) with reference to Nippon Qing genome. The primer firstly amplifies DNA of Zhenshan 97 and Miyang 46, and is used for separating population detection when the polymorphism of the parent allele is determined. The invention designs 8 pairs of InDel markers together, and the sequences of the upstream primer and the downstream primer are shown in Table 1.
Table 1. 8 pairs of InDel marker information developed by the present invention
Figure BDA0002584883790000041
PCR amplification and product detection
PCR reaction (10. mu.l): 80mM (NH)4)2SO4(ii) a 335mM Tris-HCL; 0.05% TWEEN-20; 0.9mM MgCl; 0.2mM dNTPs; 3.3 ng/. mu.l upstream primer; 3.3 ng/. mu.l downstream primer; 0.5 units TaqDNA polymerase; 1 μ LDNA. The PCR reaction was carried out in a PCR instrument (ETC811, Dongsheng dragon, China). And (3) PCR reaction conditions: 94 ℃ for 2 min; at 94 ℃ for 45s, at 55 ℃ for 30s, at 72 ℃ for 1min, for 30 cycles; 8min at 72 ℃; 10min at 10 ℃. And after the PCR reaction is finished, adding 5 mul of sample adding buffer solution, uniformly mixing, taking 2 mul of product, performing electrophoresis on polyacrylamide gel with the concentration of 6%, controlling the electrophoresis time according to the size of a product fragment, and performing silver staining for color development after the electrophoresis is finished.
5. Field trials and phenotypic characterization
All NIL groups are planted in a test base (Yang-rich area in Zhejiang province) of the Chinese rice institute, the test adopts a random block design, 1 line of each plant is 12, the plant spacing is 16.7cm, the line spacing is 26.7cm, 2 times of repetition are set, and the field management is carried out conventionally.
After maturation, the protective strains were removed, 5 normal individuals were harvested from each strain, sun-dried and threshed. Taking about 35g of seeds of each strain, soaking the seeds in 3.5mol/L NaCl solution, removing empty grains and shrivelled grains, collecting the rest seeds by using small mesh bags, putting the seeds into a 37 ℃ oven, taking out the seeds after 16 hours, and standing the seeds at room temperature for 4 hours. The saturated grains were divided into 2 parts on average, and thousand-grain weight, grain length, grain width and aspect ratio were measured with an SC-G type seed analyzer (ten thousand depth). And if the measurement error of 2 seeds exceeds 2.0%, the strain is re-selected to be full of grains and then measured.
6. Data analysis
In each segregating population, the phenotype difference between Zhenshan 97 type and Miyang 46 type strains is compared by variance analysis, and the analysis process adopts the GLM program of SAS software. When there are significant differences between different genotype lines (P)<0.05), additive effect (A) and contribution rate (R) were calculated2)。
Defining a QTL positioning interval: firstly, analyzing whether the phenotype difference among different parent homozygotic strains in each segregation population is significant or not, if the significant difference exists, indicating that the QTL is segregated in the segregation interval contained in the population, and vice versa; then, the segregation intervals contained in each segregation population are compared, and the QTL interval is finally defined.
7. Fine positioning result
First, apply 4 BC2F12:13NIL population, the inventors narrowed the interval of qTGW1.2b to 371.5 kb. The data analysis results are shown in table 2: in the L1 population, thousand kernel weight was not significantly different in the two parental lines, both grain length and grain width were significantly different, but the synergistic alleles were from different parents; in the remaining 3 populations, thousand grain weight and grain length all showed significant differences, and the synergistic alleles were from the male parent, Miyang 46, indicating that there may be 2 QTLs controlling grain weight and grain shape in this interval. As shown in fig. 2A, the separation intervals of L1 and L4 do not overlap, therefore, there are 1 QTL controlling the morphology of the L1 population, while qtwg 1.2b is located in the common interval of L2, L3 and L4, i.e., the RM11781-Wn34526 interval.
Next, the inventors added 3 InDel markers between the intervals RM11781-Wn34526, Wn34529, Wn34286 and Wn34367, respectively, and further narrowed the interval qTGW1.2b to about 108.6kb between the markers Wn34259-Wn34367 (FIG. 2B).
Then, the inventors applied 3 BC again2F14:15NIL fine-localizes qtgw1.2b to 44.0 kb. The data analysis results are shown in table 2: in 3 groups, thousand kernel weights were significantly different among different parental lines, the range of additive effect was 0.12-0.18g, the range of contribution rate was 5.96% -7.86%, and the synergistic allele came from sun 46. The grain length is the same as the thousand grain weight, the grain length shows very remarkable difference in 3 groups, the range of additive effect is 0.021-0.036mm, the range of contribution rate is 17.49% -32.70%, and the contribution rate is obviously greater than the thousand grain weight. As shown in fig. 2C, qtwg1.2b should be located in the 3 population consensus interval, i.e. about 44.0kb between Wn34323-Wn 34367. Since this QTL is dominated by controlling grain length and is located at 34.3Mb of chromosome 1, it is renamed qGL 1-34.3.
Table 2: QTL analysis results of 2 sets of near isogenic line populations
Figure BDA0002584883790000061
TGW: thousand kernel weight (g); GL: grain length (mm); GW: grain width (mm)
8. Analysis of candidate genes
Referring to Nippon genome annotation (http:// rice. plant biology. msu. edu /), a total of 6 annotated genes were included within the 44.0kb interval of qGL1-34.3 (FIG. 2D, Table 3). Wherein LOC _ Os01g59370, LOC _ Os01g59390, LOC _ Os01g59400 and LOC _ Os01g59420 are expressed proteins with unknown functions, and LOC _ Os01g59360 and LOC _ Os01g59410 are proteins with known functions. The inventors performed sequence analysis on these 2 annotated functional genes.
Table 3: 6 annotated genes within the target interval
Figure BDA0002584883790000071
Designing a primer according to a Nipponbare genome sequence, wherein the specific information is as follows:
(1) the genome sequence of LOC _ Os01g59360 is spliced after being amplified by 2 pairs of primers:
a first pair of primers:
an upstream primer: 5'-CCGTACACCACCCGACGAA-3' the flow of the air in the air conditioner,
a downstream primer: 5'-GGGGAAACAAAATCACAGACCCT-3', respectively;
a second pair of primers:
an upstream primer: 5'-TCATGAACAGGCTCAAGCAG-3' the flow of the air in the air conditioner,
a downstream primer: 5'-GCTGACATCAACACGATACCTT-3' are provided.
(2) The primer information for amplifying LOC _ Os01g59410 is as follows:
an upstream primer: 5'-CCCAAGTCCCACAGCGAAC-3' the flow of the air in the air conditioner,
a downstream primer: 5'-TCCGTCCACAGTACCATACACA-3' are provided.
The 2 annotation genes are amplified by taking DNA of Zhenshan 97 and Miyang 46 as templates. The amplified product is detected by agarose gel electrophoresis with the concentration of 1.5 percent, the size of the amplified fragment is estimated by referring to molecular weight markers, and the amplified product is sent to Hippocastine Biotech company of Hangzhou department for sequencing after the amplification product meets the forecast. The sequence alignment results show that: LOC _ Os01g59360 has no sequence difference in coding regions of Zhenshan 97 and Miyang 46; LOC _ Os01G59410 detects 3 SNPs and 1 insertion deletion in Zhenshan 97 and Miyang 46 coding regions, the 3 SNPs are respectively G259A, A306C and C528T by taking the Zhenshan 97 sequence as reference, wherein G259A causes amino acid change, the 86 th amino acid is mutated from glycine to alanine, and the rest 2 SNPs are synonymous mutations; additionally, Miyang 46 inserts GAC at base 468, resulting in the insertion of 1 aspartate into the coding region. Thus, LOC _ Os01g59410 is most likely a candidate gene for qGL 1-34.3.
Reference documents: wang L-L, Chen Y-Y, Guo L, Zhang H-W, Fan Y-Y, Zhuang J-Y.Disection of qTGW1.2 to three QTLs for grain weight and grain size in rice (Oryza sativa L.)
Example 2 validation of candidate Gene function and creation of New allelic variants Using CRISPR/Cas9 Gene editing technology
1. Knock-out vector construction and genetic transformation
Aiming at LOC _ Os01g59410, the inventor constructs 2 knockout vectors in total and takes japonica rice variety Nipponbare as a receptor for genetic transformation. The CRISPR/Cas9 gene editing vector framework BGK03 is purchased from Baige Gene science and technology Co., Ltd and is specifically implemented by the following steps:
(1) and (4) selecting a sgRNA target sequence. A CRISPRR direct database (crishpr. dbcls. jp) is opened, a whole genome sequence is input, and 2 targets are selected from LOC _ Os01g59410 genome according to indexes such as the position, the specificity and the GC content of the provided target sequence in the genome, wherein the indexes are respectively named as 410-1 and 410-2.
The sequence of 410-1 is: 5'-GGGCAATGCTACTGCAACGA-3', respectively;
410-2 has the sequence: 5'-AATGCTACTGCAACGAGGGG-3' are provided.
(2) And (3) designing an Oligo sequence. The Oligo primer sequence is designed according to the mode that the selected gene editing vector skeleton and dimer are connected into the vector, the vector skeleton BGK03 is purchased from Baige Gene science and technology Limited, and only the target point sequence is required to be input into an online tool (http:// www.open-genome. cn/index/excrispr) provided by Baige corporation, so that 2 pairs of Oligo primers are automatically generated.
The Oligo primer information corresponding to 410-1 is:
the upstream primer 5'-TGTGTGGGGCAATGCTACTGCAACGA-3' is the primer that is used,
a downstream primer 5'-AAACTCGTTGCAGTAGCATTGCCCCA-3';
the Oligo primer information of 410-2 is:
the upstream primer 5'-TGTGTGAATGCTACTGCAACGAGGGG-3' is the primer that is used,
the downstream primer 5'-AAACCCCCTCGTTGCAGTAGCATTCA-3'.
(3) And synthesizing Oligo dimer. Diluting Oligo primers to 10. mu.M, taking 1. mu.l of upstream and downstream Oligo primers, 18. mu.l of Buffer Aneal to 200. mu.l of sterile centrifuge tube, and blowing and mixing by a pipette gun. The synthesis was carried out in a PCR instrument and after 3min at 95 ℃ the temperature was reduced to 20 ℃ at a rate of 0.2 ℃ per second.
(4) Oligo dimers were ligated into the BGK03 vector. Mu.l Oligo dimer, 2. mu.l CRISPR/cas VectorBGK03, 1. mu.l Enzyme Mix were taken with ddH2And supplementing 10 mu l of O, uniformly blowing the mixture on ice by using a pipette gun, and standing the mixture for 1h at the temperature of 20 ℃. The 2 knockout vectors were named BGK03-410-1 and BGK03-410-2, respectively.
(5) Taking out Escherichia coli DH5 alpha competent cells from a-80 ℃ ultra-low temperature refrigerator, placing on ice for thawing, sucking 5 mu l of plasmid vector solution to be transformed into the competent cell solution, stirring and mixing the pipette tip uniformly, and carrying out ice bath for 30 min.
(6) The mixture was transferred to a 42 ℃ water bath, placed on ice after 30sec, and left for 2 min.
(7) Adding 500 μ l LB culture medium into the mixed solution, stirring and mixing the solution with a gun head, placing the solution on a shaker at 37 ℃, and keeping the solution for 1h at 200 r/min.
(8) The bacterial liquid is evenly coated on LB culture medium containing kanamycin, dried at 37 ℃, and then placed upside down in an incubator at 37 ℃ for culture in dark place.
(9) The monoclonal colony is picked up and used as a template to carry out PCR reaction, and positive clone is identified.
(10) Sucking 1mL of kanamycin-containing culture medium into a 1.5mL sterilized centrifuge tube, picking positive monoclonal colonies by using a pipette tip, placing the colonies in the centrifuge tube, and keeping the colonies at 37 ℃ for 5 hours at 180 r/min.
(11) Delivering the bacterial liquid to Hangzhou Pongke catalpi-xi biotechnology company for sequencing verification, after comparing, respectively sucking 500 mu l to a new 1.5ml sterilized centrifuge tube from bacterial liquids numbered BGK03-410-1 and BGK03-410-2, adding glycerol with the same volume concentration of 50%, mixing uniformly, storing in a refrigerator at-80 ℃, and entrusting the residual 2 bacterial liquids to Wuhanbo remote biotechnology limited company for genetic transformation experiment.
2. Identification of transgenic seedlings
(1) Receive T0After the generation of transgenic seedlings, about 2cm of leaves of transgenic seedlings derived from the same callus were taken, and DNA was extracted.
(2) And (3) carrying out hygromycin resistance gene detection by using the hygromycin resistance gene marker, and screening a transgenic positive plant.
(3) PCR amplifying a fragment containing a target sequence, and sequencing, wherein the primer sequence is as follows:
the upstream primer 5'-TGGTGGTGGTGGTGGTGT-3' is the primer that is used,
the downstream primer 5'-CCTTGATCGGCTTCTTCCC-3'.
(4) 4 transgenic positive seedlings are obtained together, wherein TB1 and TB2 have 1 base (A) insertion mutation at the target point 410-1, and TB3 and TB4 have 1 base (T) insertion mutation at the target point 410-2, which both result in frame shift mutation. The results of the alignment of the mutated sequences with nipponica are as follows:
target 410-1:
GGGCAATGCTACTGCAA CGAGGGGTGG Nipponbare
TB1:GGGCAATGCTACTGCAAaCGAGGGGTGG
TB2:GGGCAATGCTACTGCAAaCGAGGGGTGG
Target 410-2:
GGGCAATGCTACTGCAACGAG GGGTGG Nipponbare
TB3:GGGCAATGCTACTGCAACGAGtGGGTGG
TB4:GGGCAATGCTACTGCAACGAGtGGGTGG
3. Functional validation and creation of new allelic variants
Mixing wild type Nipponbare and T1The generations TB1, TB2, TB3 and TB4 are planted in the test base of Chinese Rice institute (Zhejiang province rich in yang). All the materials are planted with 60 plants, the seeding time is 5 months and 17 days, and the transplanting time is 6 months and 10 days, wherein the number of the plants is 2. After maturation, 10 plants were taken out each time and examined for thousand kernel weight, kernel length and kernel width. As shown in table 4: the grain length and the grain weight of TB1, TB2, TB3 and TB4 are all remarkably smaller than that of wild Nipponbare, and the LOC _ Os01g59410 is a gene for controlling the grain length of qGL 1-34.3.
In addition, we found that the difference in grain length between NIL (figure 3) was much smaller than the difference between wild type and knockout mutant (figure 4), which indicates that at the locus of the minor gene qGL1-34.3, we created allelic variation with greater effect.
Therefore, the method for creating new allelic variation by cloning the micro-effect gene is feasible, contributes to widening the genetic variation of the cultivated rice and provides a technical basis for improving rice varieties.
TABLE 4 comparison of differences between thousand Kernel weight, grain Length and grain Width in knockout mutant lines and Nipponbare
Figure BDA0002584883790000101
TGW: thousand kernel weight (g); GL: grain length (mm); GW: grain width (mm)
The significance levels for upper and lower case letters were P <0.01 and P <0.05, respectively, with the same letters representing no significant difference between groups.
Figure BDA0002584883790000111
Figure BDA0002584883790000121
Figure BDA0002584883790000131
Figure BDA0002584883790000141
Sequence listing
<110> institute of Rice research in China
<120> a method for creating a novel allelic variation by cloning of a rice minigene
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>811
<212>DNA
<213> Rice (Oryza sativa)
<400>1
tacgccacat ccatccgtgg cttccgtccc ccgagtttac tactgctcca cgacgccccg 60
ctcccatcca cacccgcaac cacctcgctc gctaaaaatc cccacgattt gtcctcacat 120
ggccacgccc agaacggccg gaactagccc tcgctctcgt cgtcctactc cagattgccg 180
ctgctcgacg gagccagatc gtcggtaggg aggaggagga ggaggaggtg gtggtggtgg 240
tggtggtgtg ggggtgatgg atcggcagag gcagcagagc tccaggggca atgctactgc 300
aacgaggggt ggtgggtcgt cggggaaggg tggtggtggt ggtgtcggga aggcggcggg 360
gaagaagccg atcaaggtgg tgtacatctc caaccccatg cgggtcaaga ccagcgccgc 420
cgggttccgc gccctcgtgc aggagctcac cggccgcaac gccgaccctt ccaagtacag 480
cccccgcgcc tccgccgacg acgacgacgg cggcggcggc ggcggcggcg gcgagctggc 540
cgccgccagt gacggcgcgg gagagcccgg gcccggcgcc gccgcggcct cgcccgacac 600
cggcgccgca gccgccagcg acgccgccga cgccctcgtg gcggcgggtc atccggcggc660
ggcgacgttc gacgacgaag gcggcggtgg cggcggggga tactacgacg acgacgacga 720
cgacatcttc aggtcgcagc tgctggacac cagctactcg gtgttctcgc cgccgacgct 780
gctctacgac cacccgcaca gcaaggtgta g 811
<210>2
<211>555
<212>DNA
<213> Rice (Oryza sativa)
<400>2
atggatcggc agaggcagca gagctccagg ggcaatgcta ctgcaacgag gggtggtggg 60
tcgtcgggga agggtggtgg tggtggtgtc gggaaggcgg cggggaagaa gccgatcaag 120
gtggtgtaca tctccaaccc catgcgggtc aagaccagcg ccgccgggtt ccgcgccctc 180
gtgcaggagc tcaccggccg caacgccgac ccttccaagt acagcccccg cgcctccgcc 240
gacgacgacg acggcggcgg cggcggcggc ggcggcgagc tggccgccgc cagtgacggc 300
gcgggagagc ccgggcccgg cgccgccgcg gcctcgcccg acaccggcgc cgcagccgcc 360
agcgacgccg ccgacgccct cgtggcggcg ggtcatccgg cggcggcgac gttcgacgac 420
gaaggcggcg gtggcggcgg gggatactac gacgacgacg acgacgacat cttcaggtcg 480
cagctgctgg acaccagcta ctcggtgttc tcgccgccga cgctgctcta cgaccacccg 540
cacagcaagg tgtag 555
<210>3
<211>184
<212>PRT
<213> Rice (Oryza sativa)
<400>3
Met Asp Arg Gln ArgGln Gln Ser Ser Arg Gly Asn Ala Thr Ala Thr
1 5 10 15
Arg Gly Gly Gly Ser Ser Gly Lys Gly Gly Gly Gly Gly Val Gly Lys
20 25 30
Ala Ala Gly Lys Lys Pro Ile Lys Val Val Tyr Ile Ser Asn Pro Met
35 40 45
Arg Val Lys Thr Ser Ala Ala Gly Phe Arg Ala Leu Val Gln Glu Leu
50 55 60
Thr Gly Arg Asn Ala Asp Pro Ser Lys Tyr Ser Pro Arg Ala Ser Ala
65 70 75 80
Asp Asp Asp Asp Gly Gly Gly Gly Gly Gly Gly Gly Glu Leu Ala Ala
85 90 95
Ala Ser Asp Gly Ala Gly Glu Pro Gly Pro Gly Ala Ala Ala Ala Ser
100 105 110
Pro Asp Thr Gly Ala Ala Ala Ala Ser Asp Ala Ala Asp Ala Leu Val
115 120 125
Ala Ala Gly His Pro Ala Ala Ala Thr Phe Asp Asp Glu Gly Gly Gly
130 135 140
Gly Gly Gly Gly Tyr Tyr Asp Asp Asp Asp Asp Asp Ile Phe Arg Ser
145 150 155 160
Gln Leu Leu Asp Thr Ser Tyr Ser Val Phe Ser Pro Pro Thr Leu Leu
165 170 175
Tyr Asp His Pro His Ser Lys Val
180
<210>4
<211>814
<212>DNA
<213> Rice (Oryza sativa)
<400>4
tacgccacat ccatccgtgg cttccgtccc ccgagtttac tactgctcca cgacgccccg 60
ctcccatcca cacccgcaac cacctcgctc gctaaaaatc cccacgattt gtccttacat 120
ggccacgccc agaacggccg gaactagccc tcgctctcgt cgtcctactc cagattgccg 180
ctgctcgacg gagccagatc gtcggtaggg aggaggagga ggaggtggtg gtggtggtgg 240
tggtggtgtg ggggtgatgg atcggcagag gcagcagagc tccaggggca atgctactgc 300
aacgaggggt ggtgggtcgt cggggaaggg tggtggtggt ggtgtcggga aggcggcggg 360
gaagaagccg atcaaggtgg tgtacatctc caaccccatg cgggtcaaga ccagcgccgc 420
cgggttccgc gccctcgtgc aggagctcac cggccgcaac gccgaccctt ccaagtacag 480
cccccgcgcc tccgccgacg acgacgacgg cggcagcggc ggcggcggcg gcgagctggc 540
cgccgccagt gacggcgcgg gcgagcccgg gcccggcgcc gccgcggcct cgcccgacac 600
cggcgccgca gccgccagcg acgccgccga cgccctcgtg gcggcgggtc atccggcggc 660
ggcgacgttc gacgacgaag gcggcggtgg cggcggggga tactacgacg acgacgacga 720
cgacgacatc ttcaggtcgc agctgctgga caccagctac tcggtgttct cgccgccgac 780
gctgctttac gaccacccgc acagcaaggt gtag 814
<210>5
<211>558
<212>DNA
<213> Rice (Oryza sativa)
<400>5
atggatcggc agaggcagca gagctccagg ggcaatgcta ctgcaacgag gggtggtggg 60
tcgtcgggga agggtggtgg tggtggtgtc gggaaggcgg cggggaagaa gccgatcaag 120
gtggtgtaca tctccaaccc catgcgggtc aagaccagcg ccgccgggtt ccgcgccctc 180
gtgcaggagc tcaccggccg caacgccgac ccttccaagt acagcccccg cgcctccgcc 240
gacgacgacg acggcggcag cggcggcggc ggcggcgagc tggccgccgc cagtgacggc 300
gcgggcgagc ccgggcccgg cgccgccgcg gcctcgcccg acaccggcgc cgcagccgcc 360
agcgacgccg ccgacgccct cgtggcggcg ggtcatccgg cggcggcgac gttcgacgac 420
gaaggcggcg gtggcggcgg gggatactac gacgacgacg acgacgacga catcttcagg 480
tcgcagctgc tggacaccag ctactcggtg ttctcgccgc cgacgctgct ttacgaccac 540
ccgcacagca aggtgtag 558
<210>7
<211>185
<212>PRT
<213> Rice (Oryza sativa)
<400>7
Met Asp Arg Gln Arg Gln Gln Ser Ser Arg Gly Asn Ala Thr Ala Thr
1 5 10 15
Arg Gly Gly Gly Ser Ser Gly Lys Gly Gly Gly Gly Gly Val Gly Lys
20 25 30
Ala Ala Gly Lys Lys Pro Ile Lys Val Val Tyr Ile Ser Asn Pro Met
35 40 45
Arg Val Lys Thr Ser Ala Ala Gly Phe Arg Ala Leu Val Gln Glu Leu
50 55 60
Thr Gly Arg Asn Ala Asp Pro Ser Lys Tyr Ser Pro Arg Ala Ser Ala
65 70 75 80
Asp Asp Asp Asp Gly Gly Ser Gly Gly Gly Gly Gly Glu Leu Ala Ala
85 90 95
Ala Ser Asp Gly Ala Gly Glu Pro Gly Pro Gly Ala Ala Ala Ala Ser
100 105 110
Pro Asp Thr Gly Ala Ala Ala Ala Ser Asp Ala Ala Asp Ala Leu Val
115 120 125
Ala Ala Gly His Pro Ala Ala Ala Thr Phe Asp Asp Glu Gly Gly Gly
130 135 140
Gly Gly Gly Gly Tyr Tyr Asp Asp Asp Asp Asp Asp Asp Ile Phe Arg
145 150 155 160
Ser Gln Leu Leu Asp Thr Ser Tyr Ser Val Phe Ser Pro Pro Thr Leu
165 170 175
Leu Tyr Asp His Pro His Ser Lys Val
180 185

Claims (9)

1. A method for creating new allelic variations by cloning of a minigene, comprising: (1) constructing a near isogenic line group by applying a residual heterozygote strategy; (2) fine positioning the micro-effect gene to the interval containing only a few candidate genes; (3) directionally mutating candidate genes by using a gene editing technology, and obtaining new allelic variation while performing functional verification;
the method comprises the following detailed steps:
(1) screening the remaining heterozygote individual plants in the heterozygote region covering the region where the target gene is located, and developing F after selfing2A population;
(2) from F2Screening new residual heterozygote single plants with continuously overlapped heterozygote intervals in the group, and respectively selfing to develop F2A population;
(3) from each F2Selecting the individuals in the heterozygous interval from the population, and selfing to obtain near isogenic line populations with continuously overlapped separation intervals;
(4) firstly, analyzing whether the segregation interval of each near-isogenic line group has gene segregation, then comparing the segregation intervals of each group, and reducing the interval of the gene;
(5) repeating steps (1) to (4) until the region where the gene is located is limited to the size containing only a few candidate genes;
(6) directionally editing candidate genes by using a gene editing technology to obtain mutants, and verifying the functions of the candidate genes by analyzing the phenotypic difference between the mutants and wild types;
(7) the allele carried by the mutant with mutation on the target gene locus and character mutation is the new allele mutation.
2. A micro-effect gene qGL1-34.3 for controlling rice grain length, the genome sequence of which is shown as SEQ ID NO: 1 is shown.
3. The cDNA of claim 2, having the sequence of qGL1-34.3 as set forth in SEQ ID NO: 2, respectively.
4. The amino acid sequence of claim 3, wherein the amino acid sequence encoded by qGL1-34.3 is as set forth in SEQ ID NO: 3, respectively.
5. The allele of qGL1-34.3 of claim 2, having a genomic sequence as set forth in SEQ ID NO: 4, respectively.
6. The allele according to claim 5 having the cDNA sequence set forth in SEQ ID NO: 5, respectively.
7. The allele according to claim 6, which encodes an amino acid sequence as set forth in SEQ ID NO: and 6.
8. A primer for amplifying a full-length or partial fragment of the gene of claim 2 or 5.
9. Use of the gene of claim 2 or 5 in rice genetic breeding.
CN202010678470.9A 2020-07-15 2020-07-15 Method for creating new allelic variation through rice micro-effect gene cloning Pending CN111808924A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010678470.9A CN111808924A (en) 2020-07-15 2020-07-15 Method for creating new allelic variation through rice micro-effect gene cloning

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010678470.9A CN111808924A (en) 2020-07-15 2020-07-15 Method for creating new allelic variation through rice micro-effect gene cloning

Publications (1)

Publication Number Publication Date
CN111808924A true CN111808924A (en) 2020-10-23

Family

ID=72864774

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010678470.9A Pending CN111808924A (en) 2020-07-15 2020-07-15 Method for creating new allelic variation through rice micro-effect gene cloning

Country Status (1)

Country Link
CN (1) CN111808924A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101880671A (en) * 2010-05-27 2010-11-10 华中农业大学 Cloning and application of major gene GS5 capable of controlling width and weight of rice grain
CN102586277A (en) * 2012-03-05 2012-07-18 南京农业大学 Set of DTH2 genes for controlling heading stage of paddy rice and haplotypes and application thereof
WO2013060136A1 (en) * 2011-10-24 2013-05-02 南京农业大学 Cloning and application of semi-dominant gene qgl3 capable of controlling grain length and grain weight of rice kernel
CN103589734A (en) * 2012-03-05 2014-02-19 南京农业大学 Haplotype of group of genes DTH2 for controlling rice heading period and application of genes DTH2

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101880671A (en) * 2010-05-27 2010-11-10 华中农业大学 Cloning and application of major gene GS5 capable of controlling width and weight of rice grain
WO2013060136A1 (en) * 2011-10-24 2013-05-02 南京农业大学 Cloning and application of semi-dominant gene qgl3 capable of controlling grain length and grain weight of rice kernel
CN102586277A (en) * 2012-03-05 2012-07-18 南京农业大学 Set of DTH2 genes for controlling heading stage of paddy rice and haplotypes and application thereof
CN103589734A (en) * 2012-03-05 2014-02-19 南京农业大学 Haplotype of group of genes DTH2 for controlling rice heading period and application of genes DTH2

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LIN-LIN WANG等: "Dissection of qTGW1.2 to three QTLs for grain weight and grain size in rice(Oryza sativa L.)" *
王琳琳: "水稻千粒重QTLqTGW1.2b的图位克隆" *

Similar Documents

Publication Publication Date Title
Hasan et al. Recent advancements in molecular marker-assisted selection and applications in plant breeding programmes
CN108893551B (en) Molecular marking method for detecting high oleic acid content of peanuts and application
CN110938706B (en) Molecular marker closely linked with watermelon plant non-tendril gene Clnt and application thereof
CN105283069A (en) Breeding methods for enhanced grain yield and related materials and methods
US20180371483A1 (en) Molecular markers for low palmitic acid content in sunflower (helianthus annus), and methods of using the same
CN116656867B (en) SNP locus for detecting watermelon holofilment and application thereof
CN111944921A (en) Application of brassica napus BnaA08.PDS3 gene in breeding of color traits of brassica napus petals
CN109735648B (en) Method for screening wheat with different thousand grain weights and special kit thereof
Yang et al. Development and evaluation of chromosome segment substitution lines carrying overlapping chromosome segments of the whole wild rice genome
Liu et al. Development and molecular cytogenetic identification of a new wheat–Psathyrostachys huashanica Keng translocation line resistant to powdery mildew
CN110468229B (en) Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t)
CN111334597B (en) SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof
CN110358861B (en) Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t)
CN108064302A (en) QTL associated with the resisting breakage of Canola and the method for identifying resisting breakage
CN107287210B (en) Rice appearance quality gene qAQ7 and molecular marking method and application thereof
CN111808924A (en) Method for creating new allelic variation through rice micro-effect gene cloning
CN110407922B (en) Rice cold-resistant gene qSCT11 and application thereof
CN110358862B (en) Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t)
Zhao et al. Validating a Major Quantitative Trait Locus and Predicting Candidate Genes Associated With Kernel Width Through QTL Mapping and RNA-Sequencing Technology Using Near-Isogenic Lines in Maize
CN114195872A (en) Application of FOT1 gene in rice flowering improvement breeding
Brar et al. RICE BREEDING IN THE GENOMICS ERA: PERSPECTIVES.
CN111733278A (en) Rice sodium and potassium ion absorption QTL (quantitative trait loci) linked SNP (Single nucleotide polymorphism) molecular marker and application thereof
Banerjee et al. High-Throughput Genomics: Application in Plant Breeding under Abiotic Stress Conditions
CN110951751A (en) Epidermal hair specific accumulation anthocyanin regulatory gene, cloning method and application
CN117305511B (en) KASP primer group related to wheat grain width and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20201023