CN111808179A - Phytophthora sojae 4 NCR protein and its coding gene and application - Google Patents

Abstract

The invention discloses 4 NCR (Niemann Pick type C-related) proteins from phytophthora sojae, and a coding gene and application thereof. The NCR protein provided by the invention is a protein shown as SEQ ID NO. 5-8; the coding gene is shown in SEQ ID NO. 1-4. Experiments prove that the protein provided by the invention plays an important role in the growth and development process of Phytophthora sojae (Phytophthora sojae), and the specific expression is that after the protein is deleted, the growth of Phytophthora sojae hyphae is slowed down, the number of zoospores is reduced, the form is changed, the pathogenicity is reduced, the oospore form is deformed, and the like. The conclusion provides a technical basis for researching the development and pathogenic molecular mechanism of the phytophthora sojae, and provides a molecular target for the research and development of novel bactericides in the future.

Description

Phytophthora sojae 4 NCR protein and its coding gene and application

Technical Field

The invention belongs to the technical field of biology, and particularly relates to 4 NCR (Niemann Pick type C-related) proteins PsNCR1-4 from Phytophthora sojae (Phytophthora sojae) and a coding gene and application thereof.

Background

Phytophthora sojae is a very important plant pathogenic oomycete, mainly causing Phytophthora sojae root rot. The disease was first discovered and reported in north america in the last 50 th century; currently, soybean prolific regions occur in more than twenty countries, asia, africa, europe, north and south america and continents. In the 80 s of the 20 th century, the disease was discovered for the first time in northeast China, and the main production area of soybean in China, namely Heilongjiang province, Anhui province, inner Mongolia autonomous region, Shandong province and the like, all occur. Phytophthora sojae can be infested throughout the entire growth period of soybeans, causing a devastating disaster to soybeans and causing economic losses of over 10 billion dollars per year. At present, the pathogenic bacteria are classified into one of ten important pathogenic oomycetes, and are widely concerned and researched by scholars at home and abroad.

The life history of phytophthora sojae is divided into asexual and sexual stages. In the vegetative propagation stage, phytophthora sojae grows nutritionally with non-septate multinucleate hyphae. Phytophthora sojae can also produce sporangia and zoospores that travel long distances with wind, rain, or irrigation water. Most sporangia are pear-shaped and are usually formed on the surface of a diseased part of a plant; it can directly germinate to form hypha, and can also differentiate to form mononuclear zoospore without cell wall and double flagellum, so as to indirectly carry out infection circulation of diseases. Zoospores are easily stimulated by external environment to be converted into resting spores which germinate to form hyphae and directly invade or invade plant roots through wounds or natural orifices. The swimming of the zoospores has autonomy and tropism, so that the probability of successful infection of the zoospores on hosts can be improved; it is used as a main re-infection source in disease circulation and plays an important role in large-scale disease epidemic. In the sexual reproduction stage, phytophthora sojae can form oospores through the cooperation with zong. The oospore has thick wall and rich content, can resist extreme environment, can survive in soil for years, and can directly germinate to produce hypha to infect host plants under proper conditions.

In conclusion, the growth speed of phytophthora sojae hyphae and the formation of zoospores and oospores are important factors influencing the occurrence and development of diseases. If the growth rate of phytophthora sojae hyphae can be slowed down, the formation of phytophthora sojae zoospores and oospores can be blocked, and the capability of infecting host plants by pathogenic bacteria can be reduced, the harm of phytophthora sojae root rot can be controlled.

Disclosure of Invention

Through research of the inventor, the NCR protein in the phytophthora sojae is closely related to the growth rate of phytophthora sojae hyphae, the yield and the morphology of zoospores and the normal morphological structure of oospores, and the infection cycle of normal plant diseases is positively related to the growth rate of the hyphae, the yield of the zoospores and the oospores and the survival time. Therefore, the growth of hyphae can be slowed down, the normal zoospore production can be blocked, the oospore structure can be damaged by regulating and controlling the NCR protein, the host infection capability of phytophthora sojae can be weakened, and the occurrence and development of phytophthora sojae root rot can be controlled.

It is therefore an object of the present invention to provide a class of phytophthora sojae NCR proteins comprising 4 homologous proteins, designated as PsNCR1, PsNCR2, PsNCR3, PsNCR4, derived from phytophthora sojae strain P6497, being a1) or a2) or A3) or a4) as follows:

A1) the amino acid sequence is a protein shown as any one of SEQ ID NO. 5-8;

A2) a fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in any one of SEQ ID NO. 5-8;

A3) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in any one of SEQ ID NO.5-8, has the same function and is derived from the protein shown in any one of SEQ ID NO. 5-8;

A4) an amino acid sequence which has more than 75 percent of similarity with the amino acid sequence shown in any one of SEQ ID NO.5-8, preferably more than 85 percent, more preferably more than 95 percent and has the same function with the amino acid sequence shown in SEQ ID NO. 5-8.

In order to facilitate the purification of the protein A1), a label such as Poly-Arg (RRRRRRR), Poly-His (HHHHHHHHHHHHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL) or the like may be attached to the amino terminus or the carboxy terminus of the protein consisting of the amino acid sequence shown in any one of SEQ ID Nos. 5 to 8 of the sequence Listing.

The protein in A1) -A4) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression. The coding gene of the protein in A2) -A4) can be obtained by deleting one or more codons of amino acid residues in a DNA sequence shown by any one of SEQ ID NO.1-4 in a sequence table, and/or carrying out missense mutation of one or more nucleotide pairs, and/or connecting the coding sequence of the label at the 5 'end and/or the 3' end.

Wherein, in A1), SEQ ID NO.5(PsNCR1) in the sequence table consists of 1597 amino acid residues; SEQ ID No.6(PsNCR2) in the sequence Listing consists of 1478 amino acid residues, SEQ ID No.7(PsNCR3) in the sequence Listing consists of 1045 amino acids, and SEQ ID No.8(PsNCR4) in the sequence Listing consists of 1486 amino acid residues.

It is another object of the invention to provide nucleic acid molecules encoding said NCR protein. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be an RNA, such as an mRNA, hnRNA, or tRNA, and the like.

Wherein the encoding gene of the NCR protein is B1) or B2) or B3):

B1) a DNA molecule shown by a nucleotide sequence in any one of SEQ ID NO.1-4 in a sequence table;

B2) a cDNA molecule or DNA molecule having 75% or more, 85% or more, or 95% or more identity to the nucleotide sequence represented by B1) and encoding the NCR protein;

B3) a cDNA molecule or a DNA molecule which hybridizes with the nucleotide sequence defined by B1) or B2) under strict conditions and codes the NCR protein.

The coding gene, SEQ ID NO.1 in the sequence table, consists of 4917 nucleotides; the nucleotides from 1-186 th, 265 th-432 th and 478 th-4917 th of the 5' end of SEQ ID NO.1 are coding sequences which encode the protein (PsNCR1) shown by SEQ ID NO.5 in the sequence table; SEQ ID NO.2 of the sequence list consists of 4477 nucleotides; the 1 st to 4437 th nucleotides from the 5' end of SEQ ID NO.2 are coding sequences and encode the protein (PsNCR2) shown as SEQ ID NO.6 in the sequence table; SEQ ID NO.3 of the sequence Listing consists of 3138 nucleotides; the 1 st to 3138 th nucleotides from the 5' end of SEQ ID NO.3 are coding sequences and encode the protein shown by SEQ ID NO.7 in the sequence table (PsNCR 3); SEQ ID NO.4 of the sequence list consists of 4461 nucleotides; nucleotide 1-4461 from the 5' end of SEQ ID NO.4 is a coding sequence, and encodes a protein (PsNCR4) shown as SEQ ID NO.8 in the sequence table.

The RNA molecule is obtained by transcription of the coding gene;

preferably, the sequence of the RNA molecule is C1) or C2) as follows:

C1) an RNA sequence which has similarity of more than 75%, more preferably more than 85%, and even more preferably more than 95% of the RNA sequence transcribed from the DNA sequence shown in SEQ ID NO.1-4 and has the same function as the RNA sequence transcribed from the DNA sequence shown in SEQ ID NO. 1-4;

C2) RNA sequences transcribed from the DNA sequences shown in SEQ ID NO. 1-4.

The DNA sequence of the invention can be molecularly hybridized with the DNA sequence shown in SEQ ID NO.1-4 under strict conditions and encodes the DNA sequence of any NCR protein. The stringent conditions may be hybridization with a solution of 6 XSSC, 0.5% SDS at 65 ℃ followed by washing the membrane once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

It is a further object of the present invention to provide biological materials related to the above-mentioned nucleic acid molecules, including recombinant vectors, expression cassettes, recombinant microorganisms or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector and can also be a recombinant cloning vector. In the above biological material, the vector may be a plasmid, a cosmid, a phage, or a viral vector; the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium; the transgenic plant cell line does not include propagation material. Specifically, any one of the following D1) to D10) may be mentioned as follows:

D1) an expression cassette comprising the encoding gene of claim 2;

D2) a recombinant vector comprising the gene encoding the gene of claim 2, or a recombinant vector comprising the expression cassette of D1);

D3) a recombinant microorganism containing the gene encoding the gene of claim 2, or a recombinant microorganism containing D1) the expression cassette, or a recombinant microorganism containing D2) the recombinant vector;

D4) a transgenic plant cell line comprising the gene encoding the gene of claim 2, or a transgenic plant cell line comprising the expression cassette of D1);

D5) transgenic plant tissue comprising the gene encoding the gene of claim 2, or transgenic plant tissue comprising the expression cassette of D2);

D6) a transgenic plant organ containing the gene encoding the gene of claim 2, or a transgenic plant organ containing the expression cassette of D2);

D7) a nucleic acid molecule that inhibits the expression of the encoding gene of claim 2;

D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line comprising the nucleic acid molecule of D7);

D9) a nucleic acid molecule that inhibits translation of the RNA molecule;

D10) producing an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line of D9) said nucleic acid molecule.

The fourth purpose of the invention is to provide a group of complete-use phytophthora sojae NCR protein combinations or DNA combinations, which are E1) or E2):

E1) consists of any two or the combination of more than two of the protein shown by SEQ ID NO.5 in the sequence table, the protein shown by SEQ ID NO.6 in the sequence table, the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table;

E2) is composed of any two or the combination of more than two of DNA molecules shown by SEQ ID NO.1 in a sequence table, DNA molecules shown by SEQ ID NO.2 in the sequence table, DNA molecules shown by SEQ ID NO.3 in the sequence table and DNA molecules shown by SEQ ID NO.4 in the sequence table.

The fifth purpose of the invention is to provide the phytophthora sojae NCR protein, the nucleic acid molecule for coding the NCR protein, or the biological material containing the nucleic acid molecule for coding the NCR protein, or the application of the NCR protein combination or the DNA combination.

The application is any one or more of the following 1) to 6):

1) the application in regulating and controlling the yield of phytophthora sojae zoospores and/or maintaining the form of the phytophthora sojae zoospores;

2) the application in regulating and controlling the growth rate of phytophthora sojae hyphae;

3) the application of the compound in regulating and controlling the host infection capacity of phytophthora sojae;

4) the method is applied to maintaining the normal morphological structure of the phytophthora sojae oospore;

5) the application of the phytophthora sojae in regulating and controlling the pathogenicity of the phytophthora sojae on hosts;

6) the application in inhibiting and/or killing phytophthora sojae;

preferably, the applications include 1) -6) by inhibiting or inactivating the transcription of one or two or more of the coding genes of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 in any combination, or inhibiting the translation of one or two or more of the RNA molecules in any combination, or inhibiting and/or inactivating the activity of one or two or more of the NCR proteins of SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 in the sequence list in any combination.

In the application, the yield and the form of phytophthora sojae zoospores, the hypha growth rate, the host infection capacity and the normal morphological structure of the oospores are regulated and controlled by inhibiting the transcription of the coding genes, or inhibiting the translation of the RNA sequences, or inhibiting and/or inactivating the activity of the NCR protein, so that the growth of phytophthora sojae can be inhibited and/or killed.

The sixth purpose of the invention is to provide the application of the NCR protein shown in SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8 of the sequence table, the coding gene shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4 of the sequence table, the RNA molecule or the biomaterial, or the protein combination or DNA combination of claim 5 as the target of the bacteriostasis or bactericide in screening the phytophthora sojae bacteriostasis and/or bactericide.

The seventh purpose of the invention is to provide a method for screening or auxiliary screening of phytophthora sojae bacteriostasis and/or bactericide, which comprises applying an object to be detected to the phytophthora sojae, wherein when the object to be detected can inhibit the transcription of any one DNA sequence or any combination of two or more DNA sequences, or inhibit the translation of any one RNA sequence or any combination of two or more RNA sequences, or inhibit and/or inactivate the activity of any one NCR protein or any combination of two or more proteins, the object to be detected is a candidate phytophthora sojae bacteriostat and/or bactericide.

The eighth purpose of the invention is to provide a method for reducing the activity of phytophthora sojae, which comprises the following steps: inhibiting transcription of one or more than two of the coding genes in any combination, or inhibiting translation of one or more than two of the RNA molecules in any combination, or inhibiting and/or inactivating activity of one or more than two of the NCR proteins in any combination;

wherein the activity of the phytophthora sojae is reduced by reducing the infection capacity and/or pathogenicity of the phytophthora sojae on a host, and/or reducing the thallus growth speed of the phytophthora sojae, and/or reducing the number and/or changing the form of zoospores of the phytophthora sojae, and/or deforming the oospore structure of the phytophthora sojae;

preferably, the method is any one of F1) -F7) as follows:

F1) inhibiting the activity of or inactivating the protein shown by SEQ ID NO.5 in the sequence table and the protein shown by SEQ ID NO.6 in the sequence table of Phytophthora sojae;

F2) inhibiting the expression of or inactivating the protein shown by SEQ ID NO.6 in the sequence table and/or the protein shown by SEQ ID NO.8 in the sequence table of Phytophthora sojae;

F3) inhibiting or inactivating the activity of a protein shown by SEQ ID NO.6 in a sequence table, a protein shown by SEQ ID NO.7 in the sequence table and a protein shown by SEQ ID NO.8 in the sequence table of Phytophthora sojae;

F4) inhibiting or inactivating the activity of a protein represented by SEQ ID NO.5 of the sequence Listing, a protein represented by SEQ ID NO.6 of the sequence Listing, a protein represented by SEQ ID NO.7 of the sequence Listing, and a protein represented by SEQ ID NO.8 of the sequence Listing of Phytophthora sojae;

F5) inhibiting or inactivating the activity of one or two or more of the protein shown by SEQ ID NO.5 in the sequence table of Phytophthora sojae, the protein shown by SEQ ID NO.6 in the sequence table, the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table;

F6) inhibiting the activity of or inactivating the protein shown by SEQ ID NO.6 in the sequence table and the protein shown by SEQ ID NO.7 in the sequence table of Phytophthora sojae;

F7) inhibit the activity of the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table of phytophthora sojae or inactivate the proteins.

Above, F1) -F7), the inactivation of the protein is achieved by the inhibition or reduction of the activity to be inhibited or the expression of a gene encoding the protein to be inactivated, and specifically, may be achieved by gene knockout or by gene silencing.

The gene knockout refers to a phenomenon in which a specific target gene is inactivated by homologous recombination. Gene knockout is the inactivation of a specific target gene by a change in the DNA sequence.

The gene silencing refers to the phenomenon that a gene is not expressed or is under expression on the premise of not damaging the original DNA. Gene silencing can occur at two levels, one at the transcriptional level due to DNA methylation, differential staining, and positional effects, and the other post-transcriptional gene silencing, i.e., inactivation of a gene at the post-transcriptional level by specific inhibition of a target RNA, including antisense RNA, co-suppression (co-suppression), gene suppression (quelling), RNA interference (RNAi), and micro-RNA (mirna) -mediated translational suppression, among others.

Preferably, in the step F1), the gene shown by SEQ ID NO.1 in the sequence table and the gene shown by SEQ ID NO.2 in the sequence table in phytophthora sojae are subjected to gene knockout, so that the protein shown by SEQ ID NO.5 in the sequence table and the protein shown by SEQ ID NO.6 in the sequence table are inactivated;

in the step F2), the gene shown by SEQ ID NO.2 in the sequence table and/or the gene shown by SEQ ID NO.4 in the sequence table in the phytophthora sojae are subjected to gene knockout, so that the protein shown by SEQ ID NO.6 in the sequence table and/or the protein shown by SEQ ID NO.8 in the sequence table are inactivated;

in step F3), performing gene knockout on a gene shown by SEQ ID NO.2 in the sequence table, a gene shown by SEQ ID NO.3 in the sequence table and a gene shown by SEQ ID NO.4 in the sequence table in Phytophthora sojae to inactivate a protein shown by SEQ ID NO.6 in the sequence table, a protein shown by SEQ ID NO.7 in the sequence table and a protein shown by SEQ ID NO.8 in the sequence table;

in step F4), the gene shown by SEQ ID NO.1 in the sequence table, the gene shown by SEQ ID NO.2 in the sequence table, the gene shown by SEQ ID NO.3 in the sequence table and the gene shown by SEQ ID NO.4 in the sequence table in Phytophthora sojae are subjected to gene knockout to inactivate the protein shown by SEQ ID NO.5 in the sequence table, the protein shown by SEQ ID NO.6 in the sequence table, the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table;

in the step F5), one or two or more of the gene shown by SEQ ID NO.1 in the sequence table, the gene shown by SEQ ID NO.2 in the sequence table, the gene shown by SEQ ID NO.3 in the sequence table and the gene shown by SEQ ID NO.4 in the sequence table in the phytophthora sojae are knocked out to inactivate one or more of the protein shown by SEQ ID NO.5 in the sequence table, the protein shown by SEQ ID NO.6 in the sequence table, the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table;

in the step F6), the gene shown by SEQ ID NO.2 in the sequence table and the gene shown by SEQ ID NO.3 in the sequence table in the phytophthora sojae are subjected to gene knockout, so that the protein shown by SEQ ID NO.6 in the sequence table and the protein shown by SEQ ID NO.7 in the sequence table are inactivated;

in the step F7), the gene shown by SEQ ID NO.3 in the sequence table and the gene shown by SEQ ID NO.4 in the sequence table in the phytophthora sojae are subjected to gene knockout, so that the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table are inactivated.

In one embodiment of the invention, the method for knocking out the gene is based on the gene knocking out method of CRISPR/Cas9.

Specifically, the gene knock-out method based on CRISPR/Cas9 is to obtain the recombinant bacteria inactivated by the target knock-out protein through screening the soybean phytophthora transfected by the Donor vector of the target gene, sgRNA and Cas9 co-expression plasmid.

The Donor vector is a recombinant vector containing a sequence of 800-1500bp upstream of the target gene to be knocked out, a DodorDNA sequence (which can be a gene sequence such as NPTII or GFP or RFP) and a sequence of 800-1500bp downstream of the target gene to be knocked out, which are connected in sequence.

The sgRNA and Cas9 co-expression plasmid is a vector for co-expressing a coding DNA fragment of sgRNA targeting a target gene to be knocked out and a coding DNA sequence of Cas9, wherein the sgRNA sequence targeting PsNCR1 gene is GAAGCAAGAAGAGTTGAAGA, the sgRNA sequence targeting PsNCR2 gene is GTACGTCCCGCAGATATCCT, the sgRNA sequence targeting PsNCR3 gene is TCACGAACATGGACTGGTTG, and the sgRNA sequence targeting PsNCR4 gene is ACGTACACAGAGTCCTGCTA.

Preferably, the sgRNA and Cas9 co-expression plasmid is a double-stranded sgRNA coding sequence obtained by annealing sgRNA of PsNCR1 gene or PsNCR2 gene or PsNCR3 gene or PsNCR4 gene with a PYF515 vector as a starting vector, and is inserted between Nhe I and Bsa I enzyme recognition sites of the PYF515 vector to obtain a sgRNA and Cas9 co-expression plasmid of PsNCR1 gene or PsNCR2 gene or PsNCR3 gene or PsNCR4 gene.

The application of the substance inhibiting the expression and/or activity of the NCR protein in the preparation of the phytophthora sojae bactericide also belongs to the protection scope of the invention.

In the above-mentioned application, the substance inhibiting the expression and/or activity of the NCR protein is a substance inhibiting the expression of the NCR protein and/or inhibiting the transcription of a gene encoding the NCR protein and/or inhibiting the translation of an RNA molecule obtained by the transcription of a gene encoding the NCR protein.

Experiments prove that the NCR protein provided by the invention plays a role in the growth and development process of phytophthora sojae. Different types of knockout mutants are obtained by using CRISPR/Cas9 gene editing technology, the growth and development of the knockout mutants are obviously changed compared with that of wild parent strains, and the method mainly comprises the following steps: the single knockout PsNCR1 mutant has a slower hyphal growth rate, reduced zoospore yield, and a reduced ability to infect host plants; a single knockout mutant of PsNCR2 and a single knockout mutant of PsNCR4 have reduced ability to infect a host plant; the biological properties of the PsNCR3 single knockout mutant are not obviously changed; the hypha growth rate of the PsNCR2/PsNCR4 double knockout mutant, the PsNCR2/PsNCR4/PsNCR3 triple knockout mutant, and the PsNCR2/PsNCR4/PsNCR3/PsNCR1 quadruple knockout mutant is slowed, zoospores are hardly formed, and the ability to infect host plants is weakened; in addition, the oospore morphological structure of the PsNCR2/PsNCR4/PsNCR3/PsNCR1 four-knockout mutant was changed, and the mutant was unable to fill with the content, increased vacuolation, and malformed. Therefore, the NCR protein in the phytophthora sojae plays an important role in all processes of vegetative growth, asexual reproduction, sexual reproduction and host infection of the phytophthora sojae. The invention provides technical support for the research on the pathogenic mechanism of phytophthora sojae and provides a potential molecular target for the development of novel bactericides in the future.

Drawings

FIG. 1 is a histogram of colony expansion diameters of P6497(WT) strain of P.sojae, CK (Δ N1-CK, Δ N2-CK, Δ N3-CK, Δ N4-CK) as empty vector control transformants, Δ N1 series as PsNCR1 single knock-out transformants (A in FIG. 1), Δ N2 series as PsNCR2 single knock-out transformants (B in FIG. 1), Δ N3 series as PsNCR3 single knock-out transformants (C in FIG. 1), Δ N4 series as PsNCR4 single knock-out transformants (D in FIG. 1) (5D cultured on V8 solid medium);

FIG. 2 is a virulence histogram of P6497(WT) strain of Phytophthora sojae, CK (Δ N1-CK, Δ N2-CK, Δ N3-CK, Δ N4-CK) as an empty vector control transformant, Δ N1 (A) as a PsNCR1 single knockout transformant, Δ N2 (B) as a PsNCR2 single knockout transformant, Δ N3 (C) as a PsNCR3 single knockout transformant, and Δ N4 (D) as a PsNCR4 single knockout transformant;

FIG. 3 is a histogram of colony expansion diameters and a photograph of colony morphology (D in FIG. 3) of P6497(WT) strain of P.sojae, CK (Δ N2-CK) an empty vector control transformant, Δ N2 series strain (Δ N2-44) a PsNCR2 single knockout transformant, Δ N2/4 series double knockout transformant (A in FIG. 3), Δ N2/4/3 series triple knockout transformant (B in FIG. 3) and Δ N2/4/3/1 series quadruple knockout transformant (C in FIG. 3) (D in FIG. 3) (cultured on V8 solid medium for 5D);

FIG. 4 is a photograph of a Phytophthora sojae strain P6497 (A, B and C in FIG. 4), PsNCR2/PsNCR4 double knockout mutant (. DELTA.N 2/4 series double knockout transformants, D, E and F in FIG. 4) in the form of zoospores released from sporangia under a normal light microscope (40-fold or 20-fold objective lens);

FIG. 5 is a graphic bar chart (C) showing the oospore morphology of the P6497(WT) and PsNCR2/PsNCR4/PsNCR3/PsNCR1 four knockout mutants under a common optical microscope (40-fold objective lens) (A) and a transmission electron microscope (B) as well as the oospore morphologies of the P6497(WT), the PsNCR1 single knockout mutant, the PsNCR2/PsNCR4 double knockout mutant, the PsNCR2/PsNCR4/PsNCR3 triple knockout mutant and the PsNCR2/PsNCR4/PsNCR3/PsNCR1 four knockout mutants;

FIG. 6 is a photograph (A) of the hypocotyl invasion of soybean etiolating seedlings by a strain of Phytophthora sojae strain P6497(WT), an empty vector control transformant CK, a single knockout mutant of PsNCR2, a double knockout mutant of PsNCR2/PsNCR4, a triple knockout mutant of PsNCR2/PsNCR4/PsNCR3, and a quadruple knockout mutant of PsNCR2/PsNCR4/PsNCR3/PsNCR1 (A), and the length (B) of the lesion.

Detailed Description

The following examples facilitate a better understanding of the invention, but do not limit it. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Soybean epidemic disease mould strain P6497: standard strains presented to professor Brett m.tyler, oregon state university, usa, were deposited at the seed pathology and fungicide pharmacology laboratory, the institute of plant protection, chinese agriculture university, and publicly available from chinese agriculture university.

Culture medium or reagent formula:

10% V8 solid medium: 100ml of V8 vegetable juice, 1.4g of CaCO₃Stirring and mixing evenly, diluting 10 times with deionized water, namely adding 900ml of deionized water, adding 15g of agar, and carrying out high-pressure moist heat sterilization at 121 ℃ for 20 min.

10% V8 liquid medium: 100ml of V8 vegetable juice, 1.4g of CaCO₃Stirring and mixing evenly, centrifuging at 12000rpm for 5min, taking supernatant, diluting with deionized water by 10 times, and sterilizing at 121 ℃ for 20min by high-pressure moist heat.

Nutrient pea medium (NPB): adding 1l deionized water into 125g of peas, performing high-pressure damp-heat sterilization at 121 ℃ for 20min, and filtering with gauze to obtain pea nutrient solution; 2.0g of yeast extract, 5.0g of glucose, 5.0g of mannitol, 5.0g of sorbitol, 2.0g of CaCO₃、0.1g CaCl₂、0.5g MgSO₄、3.0g KNO₃、1.0g K₂HPO₄、1.0gKH₂PO₄Stirring, mixing, centrifuging at 3000rpm for 10min or standing for 30min, collecting supernatant, diluting to 1l with semen Pisi Sativi nutrient solution, adding 15g agar powder into solid culture medium (NPBA), and wet-heat sterilizing for 20 min. Before use, 2ml of vitamin stock solution (Biotin 6.7X 10) was added in a sterile operating table^-7g/ml；Folic acid 6.7×10^-7g/ml；L-inositol 4.0×10^-5g/ml；Nicotinic acid 4.0×10^-5g/ml；Pyrido xine-HCl 6.0×10^-4g/ml；Riboflavin 5.0×10^{- 5}g/ml；Thiamine-HCl 1.3×10^-3g/ml) and 2ml of stock solution of trace elements (FeC)₆H₅O₇·3H₂O 5.4×10^-4g/ml；ZnSO₄·7H₂O 3.8×10^-4g/ml；CuSO₄·5H₂O 7.5×10^-4g/ml；MgSO₄·H₂O 3.8×10^-5g/ml；H₃BO₃2.5×10^-5g/ml；Na₂MoO₄·H₂O 3.0×10^-5g/ml)。

Pea Mannitol medium (Pea Mannitol, PM): accurately weigh 91.1g mannitol, 1g CaCl₂，2gCaCO₃Adding about 900ml of pea nutrient solution, stirring and mixing uniformly for about 30min, centrifuging at 3000rpm for 10min or standing for 30min, taking supernatant, metering to 1l with the pea nutrient solution, adding 15g of agar powder into solid culture medium (PMA), and performing moist heat sterilization for 20 min.

Hypha enzymatic hydrolysate (20 ml): 10ml of 0.8M mannitol, 0.8ml of 0.5M KCl, 0.8ml of 0.5M 4-morpholinoethanesulfonic acid, 0.4ml of 0.5M CaCl₂0.12g cellulase (Calbiochem, cat.No.219466), 0.12g lyase (Sigma, cat.No. L1412), sterile ultrapure water to 20ml, gently mixing and dissolving, filtering and sterilizing with a 0.22 μm filter membrane, and preparing the preparation on site.

MMG solution (250 ml): 18.22g of mannitol, 0.76g of MgCl₂·6H₂O, 2.0ml of 0.5M 4-morpholinoethanesulfonic acid (pH 5.7), ultrapure water was added to 250ml, and the mixture was filtered through a 0.22 μ M filter and sterilized.

W5 solution: 0.1g KCl, 4.6g CaCl₂·2H₂O, 2.25g NaCl, 7.8g glucose and ultrapure water are dissolved to a constant volume of 250ml, and the solution is filtered and sterilized by a 0.22 mu m filter membrane.

PEG-CaCl₂Solution (40% w/v): 12g PEG 4000, 3.75ml 0.5M CaCl₂3ml of sterile ultrapure water, and 0.22 μm filter membrane filtration sterilization.

Example 1, Phytophthora sojae 4 NCR proteins PsNCR1, PsNCR2, PsNCR3, PsNCR4 and acquisition of the genes encoding them

In this example, the 4 NCR proteins PsNCR1, PsNCR2, PsNCR3, PsNCR4 and their coding genes (or cdnas) of phytophthora sojae can be obtained by amplifying the DNA (or cDNA) of the P6497 standard strain of phytophthora sojae with the primers listed in table 1. Wherein, the material for extracting DNA or RNA can be mycelium of the phytophthora sojae standard strain P6497. Wherein, the coding gene PsNCR1 of PsNCR1 is shown as SEQ ID NO.1 in the sequence table, and the SEQ ID NO.1 in the sequence table consists of 4917 nucleotides; the nucleotides from 1-186 th position, 265 th position and 432 th position and 478 th position and 4917 th position of the 5' end of SEQ ID NO.1 are coding sequences and code a protein PsNCR1 shown by SEQ ID NO.5 in a sequence table; the coding gene PsNCR2 of PsNCR2 is shown as SEQ ID NO.2 in the sequence table, and SEQ ID NO.2 in the sequence table consists of 4477 nucleotides; the 1 st to 4437 th nucleotides from the 5' end of SEQ ID NO.2 are coding sequences and code the protein PsNCR2 shown in SEQ ID NO.6 of the sequence table; the coding gene PsNCR3 of PsNCR3 is shown as SEQ ID NO.3 in a sequence table, and the SEQ ID NO.3 in the sequence table consists of 3138 nucleotides; the 1 st-3138 th nucleotide from the 5' end of SEQ ID NO.3 is a coding sequence and encodes the protein PsNCR3 shown in SEQ ID NO.7 in the sequence table; the coding gene PsNCR4 of PsNCR4 is shown as SEQ ID NO.4 in the sequence table, and SEQ ID NO.4 in the sequence table consists of 4461 nucleotides; the 1 st to 4461 th nucleotides from the 5' end of SEQ ID NO.4 are coding sequences and encode the protein PsNCR4 shown in SEQ ID NO.8 of the sequence list. The above proteins or genes may also be artificially synthesized.

Table 1 PsNCR1, PsNCR2, PsNCR3, PsNCR4 full-length coding gene amplification primers

Example 2 construction of Phytophthora sojae PsNCR1, PsNCR2, PsNCR3, PsNCR4 knock-out vectors

In this example, a method for constructing a gene knockout vector based on CRISPR/Cas9, a sequence of a related vector, and an NPT II gene sequence are disclosed in "Fang, y., and Tyler, B.M. (2016.). effective differentiation and deletion of an effector gene in the yeast Phytophthora sojae using CRISPR/case 9.molecular plant pathway, 17(1)," 127- "and" Fang, y., Cui, l., Gu, b., arenedo, f., and Tyler, B.M. (2017). effective gene editing in the yeast Phytophthora sojae using CRISPR/9. current.protocol.Microbiol.44, 21a.1.1-21a.1.26 ". The pBluescript II SK + homology arm vector plasmid (Donor vector), sgRNA and Cas9 co-expression plasmid PYF515 used in this example was given by professor Brett m.tyler, oregon state university, usa.

The Gene sequence of the insert PcMuORP1 used in this example is disclosed in the references "Wang, W., Xue, Z., Miao, J., Cai, M., Zhang, C., Li, T., Zhang, B., Tyler, B.M. and Liu, X. (2019) PcMuORP1, and oxathiapiprolin-Resistance Gene, function as a Novel Selection Marker for photophthora transformation and CRISPR/Cas9 medical genome edition.

The Donor vectors used in the present embodiment are pBS-NPTII-NCR1, pBS-NPTII-NCR2, pBS-NPTII-NCR3, pBS-NPTII-NCR4, pBS-GFP-NCR1, and pBS-RFP-NCR 3; sgRNA and Cas9 co-expression plasmids PYF515-NCR1, PYF515-NCR2, PYF515-NCR3 and PYF515-NCR 4; and the specific construction methods of the co-expression plasmids PYF515-PcMuORP1-NCR1, PYF515-PcMuORP1-NCR3 and PYF515-PcMuORP1-NCR4 with the fluorothiazole pyrithylone screening marker are as follows:

1) construction of pBS-NPTII-NCR 1: the DNA of soybean phytophthora strain P6497 is used as a template, TaKaRa-In-Fusion _ Tools online website (http:// www.clontech.com/US/Products/Cloning _ and _ component _ Cells/Cloning _ Resources/On line _ In-Fusion _ Tools) is utilized to design a primer to amplify 1000bp upstream sequence of a target gene PsNCR1 (shown In SEQ ID NO.11 In a sequence table, amplified by primers shown In Pbs-NPTII-NCR1-F1 and Pbs-NPTII-NCR1-R1 shown In a table 2), NPTII gene sequence (the NPTII gene is a plasmid amplified fragment obtained by primers shown In the PYF515 skeleton and the primer sequences shown In the Table 2), Pbs-NPTII-NCR1-F2 and Pbs-NPTII-539R 1-PsR 2) and the NPTII gene sequence is amplified by primers shown In the PYF515 skeleton (shown In the sequence table 2) and the primer sequence of Pbs-NPTII-NCR2 and the primer sequences shown In the sequence table 2 (shown In the sequence table 2, amplified by primers shown In the NPTII-NCR 4642), by using

The HD Cloning kit sequentially fuses and connects the three amplified fragments into a cloning vector pBluescript II SK + (EcoR V restriction enzyme), the connection product is transferred into Escherichia coli DH5 alpha competent cells, after overnight culture at 37 ℃, the universal primer M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3')/M13R (sequence: 5'-CAGGAAACAGCTATGACC-3') is used for amplification and sequencing to verify cloning, and the recombinant expression vector which is verified to be correct and contains the sequentially connected sequence of 1000bp at the upstream of PsNCR1, the sequence of NPTII gene and the sequence of 1000bp at the downstream of PsNCR1 is named as pBS-NPTII-NCR 1.

2) Construction of pBS-NPTII-NCR 2: the procedure described in 1) was followed by sequentially ligating the upstream 1000bp sequence of PsNCR2 of the target gene (shown in SEQ ID No.13 of the sequence Listing, amplified by the primers Pbs-NPTII-NCR2-F1 and Pbs-NPTII-NCR2-R1 having the sequences shown in Table 2), the NPTII gene sequence (the NPTII gene is a fragment obtained by amplifying a PYF515 backbone plasmid as a template with the primer sequences shown in Table 2, Pbs-NPTII-NCR2-F2 and Pbs-NPTII-NCR 2-R2), the downstream 1000bp sequence of PsNCR2 (containing a 40bp untranslated region sequence following the termination codon TAA, shown in SEQ ID No.14 of the sequence Listing, amplified by the primers Pbs-NPTII-NCR2-F3 and Pbs-NPTII-NCR 2-R3) into Ecolscript II of the sequence Listing vector (pBoSK + V), and cloning and verifying the positive restriction enzyme digestion of pBoV), the recombinant expression vector which is verified to be correct and contains the upstream 1000bp sequence of PsNCR2, the NPTII gene sequence and the downstream 1000bp sequence of PsNCR2 which are connected in sequence is named as pBS-NPTII-NCR 2.

3) Construction of pBS-NPTII-NCR 3: the steps described in 1) are that the upstream 1000bp sequence of the target gene PsNCR3 (shown in SEQ ID NO.15 in the sequence table, obtained by amplification of primers Pbs-NPTII-NCR3-F1 and Pbs-NPTII-NCR3-R1 with sequences shown in Table 2), NPTII gene sequence (obtained by amplification of fragment of NPTII gene with PYF515 skeleton plasmid as template and primer sequences shown in Table 2 Pbs-NPTII-NCR3-F2 and Pbs-NPTII-NCR 3-R2), the downstream 1000bp sequence of PsNCR3 (shown in SEQ ID NO.16 in the sequence table, obtained by amplification of primers Pbs-NPTII-NCR3-F3 and Pbs-NPTII-NCR3-R3 with sequences shown in Table 2) are sequentially fused and connected into the scaffold vector pBluescript II (shown in SEQ ID NO.16 in the sequence table 2), the upstream 1000bp sequence of the PCR-NPTII-NCR 685R 3 and the PCR sequence is verified, and the upstream 1000bp sequence containing the sequence of the PCR 3 is sequentially fused and verified, The recombinant expression vector of the NPTII gene sequence and the sequence of 1000bp downstream of PsNCR3 is named pBS-NPTII-NCR 3.

4) Construction of pBS-NPTII-NCR 4: according to the procedure described in 1), the upstream 1000bp sequence of the target gene PsNCR4 (shown in SEQ ID NO.17 in the sequence table, obtained by amplification of primers Pbs-NPTII-NCR4-F1 and Pbs-NPTII-NCR4-R1 with sequences shown in Table 2), NPTII gene sequence (obtained by amplification of fragment of NPTII gene using PYF515 skeleton plasmid as template with primer sequences shown in Table 2 such as Pbs-NPTII-NCR4-F2 and Pbs-NPTII-NCR 4-R2), the downstream 1000bp sequence of PsNCR4 (shown in SEQ ID NO.18 in the sequence table, obtained by amplification of primers Pbs-NPTII-NCR4-F3 and Pbs-NPTII-NCR3-R3 shown in Table 2) were sequentially fusion-ligated into the scaffold vector pBluescript II (shown in SEQ ID NO.18 in the sequence table 2), and the upstream 1000bp sequence of the pBluescript vector was cloned and verified by sequencing of the PCR 73784, The recombinant expression vector of the NPTII gene sequence and the sequence of 1000bp downstream of PsNCR4 is named pBS-NPTII-NCR 4.

5) Construction of pBS-GFP-NCR 1: according to the procedure described in 1), the upstream 1000bp sequence of the target gene PsNCR1 (shown in SEQ ID NO.11 of the sequence Listing, obtained by amplification of the primers Pbs-GFP-NCR1-F1 and Pbs-GFP-NCR1-R1 shown in Table 2), the GFP gene sequence (shown in SEQ ID NO.9 of the sequence Listing, obtained by amplification of the primers Pbs-GFP-NCR1-F2 and Pbs-GFP-NCR1-R2 shown in Table 2), the downstream 1000bp sequence of PsNCR1 (shown in SEQ ID NO.12 of the sequence Listing, obtained by amplification of the primers Pbs-NCR 1-GFP F3 and Pbs-GFP-NCR1-R3 shown in Table 2) were sequentially fusion-ligated into the scaffold vector pBluescript II SK + (EcoR V) and the PsoR 1 sequence was verified to verify the positive clone, and the correct upstream 1000bp sequence of NCR 83 containing the sequence was sequentially ligated and the sequence was then verified by sequencing, The recombinant expression vector of the GFP gene sequence and the 1000bp sequence downstream of PsNCR1 was designated pBS-GFP-NCR 1.

6) Construction of pBS-RFP-NCR 3: according to the steps described in 1), the upstream 1000bp sequence of the target gene PsNCR3 (shown in SEQ ID NO.15 in the sequence table, obtained by amplification of the primers Pbs-RFP-NCR3-F1 and Pbs-RFP-NCR3-R1 shown in Table 2), the RFP gene sequence (shown in SEQ ID NO.10 in the sequence table, obtained by amplification of the primers Pbs-RFP-NCR3-F2 and Pbs-RFP-NCR3-R2 shown in Table 2), the downstream 1000bp sequence of PsNCR3 (shown in SEQ ID NO.16 in the sequence table, obtained by amplification of the primers Pbs-RFP-NCR3-F3 and Pbs-RFP-NCR3-R3 shown in Table 2) are sequentially fusion-ligated into the scaffold vector pBluescript II SK + (EcoR V positive enzyme digestion), and the upstream 1000bp sequence of the NCR 3-NCR 3 and the sequence of the correctly ligated gene are sequenced, thus expressed as the upstream recombinant vector PsNCR 3638-PSNCP-PCR vector.

7) Construction of PYF515-NCR 1: the website EuPaGDT (http:// grna. cteg. uga. edu /) and the on-line RNA structure analysis tool (http:// RNA. urmc. rochester. edu/RNAstructure Web/Servers/Predict1/predict1.html) were designed by using sgRNA, and the sgRNA sequence which specifically targets PsNCR1 gene and has weak secondary structure (sgNCR 1: GAAGCAAGAAGAGTTGAAGA, which targets the 2895-th 2914 of SEQ ID No.1 of PsNCR1 gene) was selected and sent to the company to synthesize forward and reverse sgRNA sequence primers with NhegRI and BsaI cleavage sites and HHribozyme. Dissolved in sterile water to 100. mu.M solution. Annealing reaction to synthesize double-chain sgRNA sequence, wherein the reaction system comprises: mu.l of forward strand solution, 3. mu.l of reverse strand solution, 3. mu.l of 10 XT 4 DNA Ligase Buffer (NEB), 4. mu.l of 0.5M NaCl, 21. mu.l of ultrapure sterile water, pipetting, mixing, reacting at 100 ℃ for 2min, cooling naturally at room temperature for 4h, and then diluting the reaction solution by 500 times. Then 2. mu.l of 10 XT 4 DNA Ligase Buffer (NEB), 50ng PYF515 vector (Nhe I/Bsa I double digestion), 4. mu.l of diluted double-stranded sgRNA solution, 1. mu. l T4 DNA Ligase, sterile ultrapure water were replenished to 20. mu.l, reacted at room temperature for 30min, transformed into E.coli DH5 alpha competent cells using 5. mu.l of ligation product, cultured overnight at 37 ℃, and then subjected to colony PCR verification using primers for RPL41_ Pseq _ F (SEQ ID: 5'-CAAGCCTCACTTTCTGCTGAC TG-3')/M13F (SEQ ID: 5'-TGTAAAACGACGGCCAGT-3'), and positive clones were verified by sequencing, and the recombinant vector PYF515-NCR1 which was verified to express the sgRNA correctly was named.

8) Construction of PYF515-NCR 2: following the procedure described in 4), the designed sgRNA sequence (sgNCR 2: GTACGTCCCGCAGATATCCT, targeting the sequence on the reverse complementary antisense strand at 3278-3297 th site of SEQ ID No.2 of PsNCR2 gene) into a PYF515 vector (Nhe I/Bsa I double digestion), sequencing to verify the positive clone, and naming the recombinant vector verified to be correct as PYF515-NCR 2.

9) Construction of PYF515-NCR 3: following the procedure described in 4), the designed sgRNA sequence (sgNCR 3: TCACGAACATGGACTGGTTG, targeting the sequence on the reverse complementary antisense strand of 2406-2425 of SEQ ID No.3 of PsNCR3 gene) into a PYF515 vector (Nhe I/Bsa I double digestion), sequencing to verify the positive clone, and naming the recombinant vector verified to be right as PYF515-NCR 3.

10) Construction of PYF515-NCR 4: following the procedure described in 4), the designed sgRNA sequence (sgNCR 4: ACGTACACAGAGTCCTGCTA, targeting the 1024-1043 th site of SEQ ID No.4 of the PsNCR4 gene) into a PYF515 vector (Nhe I/Bsa I double digestion), sequencing to verify positive clones, and naming the recombinant vector verified to be right as PYF515-NCR 4.

11) pYF515 construction of PcMuORP1-NCR 1: the gene sequence of PcMuORP1 is amplified by utilizing TaKaRa-In-Fusion _ Tools online website (website address 1) (PcMuORP 1-F1 and PcMuORP1-R1 shown In Table 2) to design primers and utilizing the PcMuORP1

The HD Cloning Kit ligated PcMuORP1 into the vector pYF515-NCR1(PacI/NotI double digestion) constructed as described in 7), the ligation product was transferred into E.coli DH 5. alpha. competent cells, and after overnight culture at 37 ℃ the DNA fragment was ligated using the primer Resg-F (sequence: 5'-ACTCGCCCACGATCGGAAGG-3') and Resg-R (sequence: 5'-CACAAAATCTGCAACTTCGC-3') and sequencing the positive clones, the recombinant vector which is verified to be correct is named pYF515-PcMuORP1-NCR 1.

12) pYF515 construction of PcMuORP1-NCR 3: the PcMuORP1 gene sequence was ligated into the vector pYF515-NCR3(PacI/NotI double digestion) constructed as in 9) following the procedure described in 11), and the positive clones were verified by sequencing, and the correctly verified recombinant vector was named pYF515-PcMuORP1-NCR 3.

13) pYF515 construction of PcMuORP1-NCR 4: the PcMuORP1 gene sequence was ligated into the vector pYF515-NCR4(PacI/NotI double digestion) constructed as in 10) according to the procedure described in 11), and the positive clones were verified by sequencing, and the correctly verified recombinant vector was named pYF515-PcMuORP1-NCR 4.

TABLE 2 primer sequences for vector construction

Example 3 obtaining of Phytophthora sojae PsNCR1-4 knockout transformant

Using CaCl₂PEG-mediated protoplast transformation method for the preparation of PsNCR1-4 knockout transformants, methods for genetic transformation of oomycetes are disclosed in the literature "Fang, Y., and Tyler, B.M. (2016. effective deletion and deletion of an effector gene in the yeast Phytophthora sojae using CRISPR/case 9.molecular plant Pathology,17(1), 127-.

The single knockout transformant is obtained by respectively co-transferring the Donor vectors of the genes to be knocked out, PsNCR1, PsNCR2, PsNCR3 and PsNCR4, sgRNA and Cas9 co-expression plasmids (pBS-NPTII-NCR1, PYF515-NCR1, pBS-NPTII-NCR2, PYF515-NCR2, pBS-NPTII-NCR3 and PYF515-NCR3, or pBS-NPTII-NCR4 and PYF515-NCR4) obtained in example 1 into protoplasts of Phytophthora sojae P6497, culturing and screening the grown transformants at 25 ℃ by a G418 resistant V8 solid medium plate, collecting mycelium of suspected transformants, extracting DNA for PCR verification, and extracting RNA of positive transformants for Q-PCR verification. Obtaining a strain of a PsNCR1 single knockout transformant delta N1 series, a strain of a PsNCR2 single knockout transformant delta N2 series, a strain of a PsNCR3 single knockout transformant delta N3 series and a strain of a PsNCR4 single knockout transformant delta N4 series. Meanwhile, transformants which were transformed with the same vector plasmid and subjected to the same transformation procedure without homologous substitution were used as CK control transformants, i.e., Δ N1-CK, Δ N2-CK, Δ N3-CK, and Δ N4-CK.

Because PsNCR2 and PsNCR4 have high protein homology (protein sequence identity > 85%), it is presumed that redundant complementation may exist in functions, and therefore the two genes are subjected to double knockout experiments. The double knockout transformant is obtained by transferring vector plasmids (Donor vector pBS-NPTII-NCR4, sgRNA and Cas9 co-expression plasmid pYF515-PcMuORP1-NCR4) of the PsNCR4 gene obtained in example 1 into protoplasts of phytophthora sojae PsNCR2 single knockout transformant delta NCR2-44, culturing and screening grown transformants at 25 ℃ by a fluorothiazole pyrithylone resistant V8 solid culture medium plate, collecting suspected mycelium of the transformant, and extracting DNA for PCR sequencing verification; RNA was extracted for Q-PCR validation. After verification, the delta N2/4 series double knockout transformants with inactivated phytophthora sojae PsNCR2 protein and PsNCR4 protein are obtained.

The three knockout transformants are obtained by transferring vector plasmids (Donor vector pBS-RFP-NCR3, sgRNA and Cas9 co-expression plasmid pYF515-PcMuORP1-NCR3) of the PsNCR3 gene obtained in the example 1 into protoplasts of phytophthora sojae double knockout transformant delta NCR2/4-26 (the resistance of the fluorothiazole pyrithylone is lost after multiple generations), culturing and screening grown transformants through a fluorothiazole pyrithylone resistant V8 solid medium plate at 25 ℃, collecting mycelium of suspected transformants, and extracting DNA for PCR sequencing verification; RNA was extracted for Q-PCR validation. After verification, delta N2/4/3 series three knockout transformants inactivated by phytophthora sojae PsNCR2 protein, PsNCR3 protein and PsNCR4 protein are obtained.

The four knockout transformants are obtained by transferring vector plasmids (Donor vector pBS-GFP-NCR1, sgRNA and Cas9 co-expression plasmid pYF515-PcMuORP1-NCR1) of the PsNCR1 gene obtained in the example 1 into protoplasts of phytophthora sojae triple knockout transformant delta NCR2/4/3-70 (the resistance of the fluorothiazole pyrithylone is lost after multiple generations), culturing and screening grown transformants by a fluorothiazole pyrithylone resistance V8 solid medium plate at 25 ℃, collecting mycelium of suspected transformants, and extracting DNA for PCR sequencing verification; RNA was extracted for Q-PCR validation. After verification, the delta N2/4/3/1 series four knockout transformants inactivated by the phytophthora sojae PsNCR1 protein, PsNCR2 protein, PsNCR3 protein and PsNCR4 protein are obtained.

Example 4 biological analysis of Phytophthora sojae PsNCR1, PsNCR2, PsNCR3 and PsNCR4 knockout transformants

First, hypha growth rate detection

Wild-type P6497(WT) P, CK control transformants (. DELTA.N 1-CK,. DELTA.N 2-CK,. DELTA.N 3-CK,. DELTA.N 4-CK), various types of knockout transformants obtained in example 3: a PsNCR1 single knockout transformant delta N1 series of strains (delta N1-69, delta N1-106, delta N1-30, delta N1-15, delta N1-49), a PsNCR2 single knockout transformant delta N2 series of strains (delta N2-12, delta N2-14, delta N2-23, delta N2-42, delta N2-44), a PsNCR3 single knockout transformant delta N3 series of strains (delta N3-11, delta N3-23, delta N3-8, delta N3-14), a PsNCR4 single knockout transformant delta N4 series of strains (delta N4-12, delta N4-18, delta N4-19, delta N4-29, delta N4-109); PsNCR2 protein and PsNCR4 protein inactivated delta N2/4 series double knockout transformants (delta N2/4-2, delta N2/4-6, delta N2/4-8, delta N2/4-16, delta N2/4-18, delta N2/4-26); three knockout transformants of the delta N2/4/3 series in which the PsNCR2 protein, the PsNCR3 protein and the PsNCR4 protein were inactivated (delta N2/4/3-70, delta N2/4/3-71, delta N2/4/3-100, delta N2/4/3-105, delta N2/4/3-122); PsNCR1 protein, PsNCR2 protein, PsNCR3 protein and PsNCR4 protein inactivated delta N2/4/3/1 series four knockout transformants (delta N2/4/3/1-31, delta N2/4/3/1-107, delta N2/4/3/1-125, delta N2/4/3/1-174 and delta N2/4/3/1-211) were inoculated respectively into sterile petri dishes (diameter 9cm) to which 15ml of V8 solid medium was added, cultured for 5 days at 25 ℃ in the dark, and the colony diameter of each strain was measured by the cross method, 3 replicates per strain.

The results show that the hyphal growth rate of all the tested PsNCR1 single knockout transformants Δ N1 series strains is significantly reduced compared to the wild-type phytophthora sojae strain P6497(WT) and the control transformants Δ N1-CK; while the hyphal growth rate of the single knockout transformants of the other 3 phytophthora sojae NCR genes was not significantly different overall compared to P6497 and CK, with slight differences between transformants (fig. 1). Hypha growth rates of the delta N2/4 series double-knockout transformants, the delta N2/4/3 series triple-knockout transformants and the delta N2/4/3/1 series quadruple-knockout transformants are remarkably reduced compared with that of a phytophthora sojae strain P6497(WT) and a control transformant CK. The experimental results show that the NCR protein is involved in regulating the hyphal growth of Phytophthora sojae (FIG. 3).

Second, detecting the number and form of sporangium and zoospore

10% V8 solid and liquid media were prepared, and wild type Phytophthora sojae strain P6497(WT), empty vector control transformant CK, various types of knock-out transformants obtained in example 3: a strain of a PsNCR1 single knockout transformant delta N1 series, a strain of a PsNCR2 single knockout transformant delta N2 series, a strain of a PsNCR3 single knockout transformant delta N3 series, and a strain of a PsNCR4 single knockout transformant delta N4 series; the PsNCR2 and PsNCR4 double knockout transformants Δ N2/4 series of strains; three knockout transformants, strain series Δ N2/4/3, PsNCR2, PsNCR3 and PsNCR 4; the method comprises the following steps of respectively inoculating PsNCR1, PsNCR2, PsNCR3 and PsNCR4 four knockout transformants delta N2/4/3/1 series of strains on a V8 solid culture medium, culturing in the dark at 25 ℃ for 5-7 days, punching 10 fungus cakes from each strain by using a 5mm puncher, putting the 10 fungus cakes into a sterile culture dish (diameter is 9cm) with 20ml of V8 sap culture medium, after culturing in the dark at 25 ℃ for 3 days, washing with 20ml of sterile deionized water for 1 time every 30min, washing for 5 times, adding 10ml of deionized water for constant volume, placing in the dark at 25 ℃ for 4-6 hours, and observing the number and the form of sporangia sporangium on the fungus cakes through a microscope; after 8-10h, the number and morphology of zoospores produced in the sterile water were observed by microscopy for 3 replicates.

The results show that compared with the wild type phytophthora sojae strain P6497(WT) and the empty vector control transformant CK, the PsNCR1 single knockout transformant delta N1 series obtained in example 3 has obviously reduced numbers of sporangium and released zoospore (observed after standing for 10 h), but the sporangium and zoospore forms are normal, which indicates that the PsNCR1 protein mainly affects the numbers of phytophthora sojae sporangium and zoospore. While the sporulation yield of the single knockout transformant of the other 3 phytophthora sojae NCR genes was not significantly different as a whole compared with that of P6497 and CK, and there was a slight difference between each transformant (table 3). No difference was observed between the Δ N2/4 series double knockout transformants, the Δ N2/4/3 series triple knockout transformants and the number of sporangia within the same detection time, but normal zoospores could not be released (observed after standing for 10 h), releasing the dough-like contents (Table 3, FIG. 4). FIG. 4 is a photograph of the morphology of sporozoites released by sporangium of A. glycines strain P6497 (A, B and C in FIG. 4), a.DELTA.N 2/4 series of double knockout transformants (D, E and F in FIG. 4). The morphology of zoospores released by the sporangium of the three knockout transformants of the Δ N2/4/3 series and the four knockout transformants of the Δ N2/4/3/1 series was identical to that of the two knockout transformants of the Δ N2/4 series. The Δ N2/4/3/1 series of four knockout transformants had a significant decrease in sporangium numbers and failed to release normal zoospores within the same test period (Table 4). This suggests that the NCR protein may affect the cytokinesis of Phytophthora sojae sporangium and thus fail to produce normal zoospores.

TABLE 3 sporulation yield of individual single-gene knockout mutants of P6497. soyabean strain

Table 4 sporulation yields of the.DELTA.N 2/4 series double knockout transformants, the.DELTA.N 2/4/3 series triple knockout transformants, and the.DELTA.N 2/4/3/1 series quadruple knockout transformants of the strain P6497 of P6497.

Thirdly, oospore quantity, shape detection and teratogenesis rate statistics

Wild-type P6497(WT) strain of P.sojae, control transformants CK (. DELTA.N 1-CK,. DELTA.N 2-CK,. DELTA.N 3-CK,. DELTA.N 4-CK), and various types of knockout transformants obtained in example 3 were inoculated into the center of a sterile petri dish (diameter 9cm) to which 15ml of V8 solid medium was added, cultured at 25 ℃ in the dark for 7 to 14 days, observed by a microscope for the number and morphology of oospores produced, and counted for the rate of aberration, 3 replicates.

The results showed that the number of oospores of each type of knockout transformant obtained in example 3 did not change significantly compared to the wild-type strain P6497(WT) and the control transformant CK. However, the oospore morphology of the Δ N2/4/3/1 series four knockout transformants was found to be malformed by observation through a common optical microscope (40-fold objective) and a transmission electron microscope, which is specifically characterized in that the boundary between the inner layer and the outer layer of the oospore wall is not obvious, and the oosome and the fat area cannot be filled and shrunk (fig. 5A and B). Statistical analysis of the aberration rates revealed that the oospore aberration rate of the Δ N2/4/3/1-31 four knockout transformants was almost 100%, while that of the PsNCR1 single knockout transformant Δ N1-15 had an oospore aberration rate of less than 5%, while the aberration rates of the other types of knockout transformants were not significantly different from that of the wild type strain P6497(WT) (FIG. 5C). Thus indicating that the NCR proteins possibly participate in the regulation of the morphological structure of the phytophthora sojae oospore.

Detection of pathogenicity

The soybean plant variety to be tested was japanese green, planted in a nursery tray (540mm × 280mm, 80 plants per hole), and the culture medium was 2: adding a proper amount of deionized water into the peat soil and the vermiculite which are mixed according to the proportion of 1, and culturing for 7 days in a greenhouse (27 +/-2 ℃ and 24h of dark treatment) for later use.

For strains capable of producing zoospores, zoospore suspensions (2X 10) were prepared as described above⁴Zoospores/ml); for the strain incapable of producing zoospores, a hypha suspension is prepared, and a 5mm fungus cake is beaten on a phytophthora sojae V8 solid culture medium cultured for 5-7 days. Inoculating 10 μ l of zoospore suspension or a bacterial cake at about 1cm of hypocotyl of soybean yellow flower seedling, inoculating 10-20 yellow flower seedlings to each strain, performing dark moisture-keeping culture at 25 deg.C for 3d, and examining length (mm) of lesion of soybean phytophthora infested with hypocotyl of yellow flower seedling.

The results show that various types of knock-out transformants obtained in example 3 compared to wild-type P6497(WT) and the empty vector control transformant CK: a PsNCR1 single knockout transformant delta N1 series strain, a PsNCR2 single knockout transformant delta N2 series strain, and a PsNCR4 single knockout transformant delta N4 series strain; the PsNCR2 and PsNCR4 double knockout transformants Δ N2/4 series of strains; three knockout transformants, strain series Δ N2/4/3, PsNCR2, PsNCR3 and PsNCR 4; the pathogenicity of the four knockout transformants Δ N2/4/3/1 series strains PsNCR1, PsNCR2, PsNCR3 and PsNCR4 was significantly reduced (FIG. 2, FIG. 6). While the pathogenicity of the PsNCR3 single knockout transformant Δ N3 series of strains was not significantly reduced. And the pathogenicity of the delta N2/4 series double knockout transformant and the delta N2/4/3 series triple knockout transformant is not obviously different, while the delta N2/4/3/1 series four knockout transformant almost loses the capability of infecting yellow plantlets and only generates a lesion of about 5mm at the inoculated strain cake. This demonstrates that the NCR protein has the ability to participate in regulating phytophthora sojae infection in host plants.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Sequence listing

<110> university of agriculture in china; northwest university of agriculture and forestry

<120> phytophthora sojae 4 NCR proteins and coding gene and application thereof

<130>MP2019630Z

<160>18

<170>SIPOSequenceListing 1.0

<210>1

<211>4917

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>1

atgtggctgt tcgcggccat cagcctcgcg atcgcgacgc cgtgcttccg cgcgtggctc 60

gaggcgctgt tcgccgagct gtccatcatc ttcttcacgt acctgcggct ggtgtcggcc 120

ggcctgagcc tcgtgctgct gctggcgctg gccttccacg gccgccgctt cctgcgcagt 180

cgtcgggtcg ccaaggcgcc gcgagcgggc ggcagcggca gccaagcggc ggatgaggga 240

tccaaggcgt cgctgtcggc caagacgggc ctggcgcgcg tccactggcg gcgcggcacc 300

aggcgccgcg cgctcatgct gcgcgtcaag agcacgacca gcgagatcgc gggcagcggc 360

ttctacccgc cgcagctctg gacctcgtcg ctcttcgcgc tggccatgct gcccattatc 420

aacagcgtcg tggtcggggg cggaggcggc tcgagtctgc gcggactcaa gagcgagacg 480

gcggccgccg cccaaacggc tttcgacgcc gacgcggcgg cactcgtgac gctgcagcag 540

cagctgacga cctgcaagta ctcgggaggc gacgactgtc ttgacgacgt gactgccatc 600

tctgtgctgg ggagctatca gcaggcgagt ggatactgcg tggcctttga cgcggcctat 660

gtgaatgtga cgacgggggc ggcactaccg gcccagtact tccccatcgg ggtggaggag 720

gcccacgccc agggctttgc caacaacttc tcggcgtggt ccgagaccaa ccaggagaag 780

ttcaagacgg actgccccct gctgttcaac gagacggtga gtggagacgg agaggggctg 840

ctgtgctgta ccgagacgca gtacgagatg ctgagcctgc aggtccggaa gctgcctgga 900

gagtgcacgt cctgcaagca gaacctgcgc aacctgtggt gccagttcac gtgccatccg 960

agcaacagcc tgttcgtgga cgtgacgcag gtgcggctta tggagggaga cgcggaccac 1020

gcggacgagg tcttccccgc catcgaggag gccacctact acgtgggcag tgacatggtg 1080

cgcgacctgc acgacttttg tgaggccgac tcgggcttca tgccgctgtt gtgcgggatg 1140

aatgccgatg gtaattgctc gacgacaggc tcggacatgt tggggtacct tggagcgtac 1200

agctttgacg gtgtgggatc gccctcgcag gtgatcttca ctacgatgga gcagctgtca 1260

gcggctgagc aggaggacaa gatctgtgcc tgtgacagca gcaacacgac tggctgcttt 1320

tcgccgatgg atacgcggct tgagtcgtgc gtggatacgt gtggctcgct ctgtgctgtg 1380

agtgatgatg acagccggca gtatcaggcg gcttgctaca gttccggcag tacgtcggca 1440

tccgacgatt tgagcactgt cactacagcc acgaccagca ccagcgctgc tgataagctt 1500

gagtctttac tgtcggattt gtcgtcccgt gcggagggtg gtagttttgc cgtgctaaac 1560

tatgtccttg ctgttctcgc attctttggc gccacagcgc ttgcgctcgg cttcgcgtac 1620

tcgacgcggt acggcaggaa gaagcgccag tctgtgctgg acgaccctgt taacggtttg 1680

ggatctggaa tgctgtcact cgtgaatttg gatcagttga agggaatcgg acgttgggat 1740

gaccggctga cgatgcactt gaaacgctgg ggagatttcg tggccatggg gaaccacccg 1800

ttgtacatta ttctactgtc gttgatggtt gtcgtttgct gctcgagtgg gttgatccgc 1860

atggaagtgg agacggactc catgaagctg tgggtttccg gtaggagctc tgtttttcag 1920

gagaggacgc gcttcggcga gatgcttggg ccagtggatc gtatggaacg actggtcctt 1980

gtcactaagg acggcggcgc agtgaccaga ccagcgtata tcaaggaggc gatccgcttg 2040

cagcaagtca ttggaagcga ggttgccgct gacagtatta cactgagtga gatctgcgtc 2100

aaagacgcct cgagctctcc atgccaggtg aattccgtaa cgcagtactt ccagaacagc 2160

atggatcact tcaacatgta cgatgcgtat gggctcgtag gcaagcactt gagcaactgc 2220

gctaatgctc cggaacgagc ggacggtaat gtgtgcagtg agctgcaagt gcaactcaat 2280

gcctcgggtg cttcgcttcc gacgagtatg agcggctgcc cttgtgcgtc gtcgtttggg 2340

gtgccgatgg ctgagctgga gaagtacctg ggcggattga gtactgacgg tggatcattg 2400

aatgccagtg cttatctgga gcaagcgaca actctctttt caactgccat ggtgactaac 2460

caccaggatg gtgctaagaa cgcagatgca atcgcttggg aacgcgcgta tatcgcgcgg 2520

atggagaaag aatcggatac caacacgatg tatgatatct attatgctgc agaggtgtct 2580

gctgacgacg agttcgtggc tgcttccaac ttggacatcg tcttcaaggc tggaattgca 2640

ggctttctct ttatgtttgt ttacgtggtc attggactga accactggaa gctggactac 2700

cgcttcttcc attcgtcaaa gatcggtgtg ggtttcatgg gcgttgcgtg catcctgatg 2760

gccgtgggcg ggaccttggg tatctttgcg tggactggag taaagcttca gatcgtgacg 2820

ctcgttgtga tgccggtggt tgtacttgcg atcggcactg gaaacatctt cctgatcctg 2880

catgccgtcg acctgaagca agaagagttg aagatggagc agcgctcact gtttgtgggt 2940

cttgaagaca acgatttcgg tattcatgag atcacgtgtg tgctgctgtg cgaggcaacg 3000

ggttatatcg gccccagcat gatcgcgacg tgcgtatgcg agtgctgtat cgttgctttt 3060

gcagcatatt cgaccatgcc agctgcacag tggctcgctg gatcgttggt gcttgggctc 3120

gcagccagtt ttgctttgca aatgaccttg ttcctcgcca tcgtagcgct ggacaagcgt 3180

cgtgagctca gcggcacgta cgatgtgatc tgctgtaagc gggcatcgtt cgctcgccgc 3240

cctcgcctct ccgaagacga gacgactgct gcgaccgaaa actcgtcgtt ccctggaagc 3300

actatttcac tgcccgactt gaacttgatg aaccgatgcg ttgctggata catccatgtg 3360

ctgctcaaga aggtgtcgaa ggtgttggtg ctcctcgtgt ttgccgcgtg tactctggcg 3420

gcgattgtct ccatcgaggc aatggatcgc ggtctttcac cgaactcgtt catcccgacg 3480

aactcgtatc tgcacgcata ctaccgtgca gtggacgaaa atgacttgtc gacgaaggag 3540

ttccctgcct atttcgttgt tgaagctggc tacggaagca accctaccgg attcaacgat 3600

ctcgccaacg atgcggaagc tcaatgcaaa ctgtgctcgt cgaaggagtt ctgcgacgac 3660

ttgtcgatcc cgaatattct cagtgcgttg gttgccgctg gggaaagcaa cgtcacgttt 3720

ttcaaggacg gcactgttgt tggatcatgg ttggacgact tctggagctt tgttgaccca 3780

gccagtgagt gctgccgcgt cgatgcggag aacgactact cgtattacgc tattctaccg 3840

gaagagagca gcgctgaata tgtgctcaag cgcgcgtcca acgcgccatc gtgtctcgct 3900

gactcaagtg cggtgctctc agtgcccgat gaatcgttca tgtcgttgtt cagcatgttc 3960

tcgactgcgg ctgctggacc cttgtgctcg tacgcagcag gcacgcgcta ccatggacag 4020

ctcagcgttg atagccaacc tattcctgcc atgagcagta gtgctgctgc gggcgtgact 4080

ctcaatggca ctggctacgg cagtgatgtg acggcgtttg tgtacaaggt tctgagcact 4140

acagtcggct cgtcaaagat ttcaggaagc caagaaggag caatcgcagc ctactcgcaa 4200

gctcagcaca ttgccaagtg gatcagcgag gaaactggca tcgatgtgtg ggcgtactcc 4260

cccgagtacg tttatctgga tcagttccac tcggttcgtc gtactgcgta cattgtggtg 4320

ggtgtcggac tcgcagtggt gttcgtgctg cagagtttgg ctctggggag ttactggtat 4380

ggatttgcgg tgacttgtgt cgctgcagcc acggttgtcc aagtcgctgg cctcatgatg 4440

ccgatggggg tcccaatcaa ctcgctttcg attgtgagcc tctcgatcgc cgtcaccttt 4500

tccgtcggat tctcggggca ttttgctcgt ctttttgcca aggctcgcac catcactgac 4560

gacttgggct actcacctgg cggcgatgcc tgcgttcgga aggtgttggc gcagcttctc 4620

gcgtcgtgga cgttgggcgt cgccgtctcc aagttcgttg ccatcgcagc gctcgcgctt 4680

gtcgccacgc ccgtcttcga acccgctggg aactgtttct tccggacgct gatggctgca 4740

gcggtgtgcg cgtggctgaa cagcgccgtg ctgcttcccg tcgggctcag catttgtgtg 4800

gatgccacgg aaggccgcgt gcgtgacgtg aagccgacga atgaagaggg cggggagtac 4860

tcgcgtgaga gcccttcgtc gtcataccac actgcgccgc cgactagcaa gtactga 4917

<210>2

<211>4477

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>2

atgcgcgtct cggccctcgc gtcgctgctg ctgccgctgg gcgtggcccg cgccgccagc 60

tcctcgagct ccacgacgtc gtcgggcgtg tcgtccgcct ccagctacgt gccgtggagc 120

ctcgccgaca acgccaccaa cctggccatc atcgagtcgc agctcaccat ctgcacgtac 180

tccaaggtgg aggagtgcat ccaggacccc aagctcgtgc aggagctcgg ctcgctctac 240

cgcgcgccgg gctactgcgt agccttcgac tcggcctacg tcaacatcac cacgaccagc 300

gctgccatcc ccaaccgcta ctacccgacg tccgtggagg acgcgtacga cgccggcttc 360

tccaacaagt tctccgagtg gtcggacacc aaccgcgagc agttcgaagt ggactgtccg 420

ctgctctaca atgagaccat cgccctgggc gacgacatgc tctgctgtac tgagtcccag 480

tacacagggc tgtccacgca ggtgcgcatg atccccggtc tgtgctcggc ctgcaaggag 540

aacctgcgca acatcttctg ccagttcacg tgcaacccga acaacagcat gttcctggac 600

atcaacgagg tgcgcatcat gtcgggcgac gacgagcacg aaggtcagat cttcccagcg 660

gtggaggagg caacgtacta cgtgggcaag gactggatcc gcgacatcta cgacttctgc 720

gaagacgaca gctccttctc gctgctgtgc aaccccaacc aggactgtac cgacggctac 780

ggcctcatgg agtacatggg caagtacgcc tacaacagca tcgggtcccc agagcagatc 840

aacgtgacaa ctatggatca gctttcggag gagctgcaaa tgaccgagtt ctgccattgc 900

gactacgcca acgagaccaa ttgcatttcg cccatgaaca acaagatgac gtcgtgtgtg 960

ggcgtctgcg gctcgctttg tgccgttagc tccgacgata cgcgcacgta cacggatgct 1020

tgctacggtg ccaaatccgc gtcctcttccggtagtggca gcgtcgtgga caacgatgac 1080

gacgcgactt ggatggagct caacgagtac ctcgccaaca acctgcccgc gacggattgg 1140

accccgttca actacttcct cgtgatcttt ggaggcgtgg tgggtgtgct gctgattgtg 1200

ggcttcatcg tcgccatgct ccgtgagagg aggtacagcg cagtcgagcg taactcgggc 1260

actccgcagg tagttggccc taacacacca gacttccatg gcgtggcgag cgcgatggct 1320

ggcagcgtcg gatacttgag cttcttggac gatctgatga caaacaagct gcggttgtgg 1380

gcggcgttcg tctccaaggg taaccgaccg aagaagatca ccccgatggt gctgtgcgtt 1440

gtcgtcattt gcgccgtcgg cttgtacaac attgatatcg aaacggaccc gatcaagctg 1500

tgggtttcta cgtcaagtac ttcgtacgag cagcgccaac attatggcga gatcttcaac 1560

ccgttctacc gctcggagca gatcattatg gtcccgaagg acggtggcaa catctaccgc 1620

tcgtcgatca tcaaggaggc catccgcgtg cagactgtgg cagccaacgt gacgtacact 1680

tcggacgacg gtgacgagac gattactctg gacgacattt gctggaaagc tacgggcacg 1740

ggctgcaccg tcaactcgat cacgcagtac ttccagaaca acatggagca cttcgagttc 1800

tacgagaagt atggattgga gctggagcac tttagtaact gcctttactc tccgaccacg 1860

tcggacgtgg cgctttgcac cgagttgaag aacgctttgg aggatggcga ttcgctcccg 1920

tcgagcatga gcgactgccc ctgcttgtcg gcgtttggct cgcccatgaa cctgtacaac 1980

acgtacctgg gtgggttccc tgacggcgct gagagcaact acacgctgtt cctcgaatcg 2040

gaagcgtttg tttcttcgta cctcaactac aactacgctg atgacgacaa gaacgaacct 2100

gccatcaagt gggagcgcga gtacatcaag acgatgaaga aggaggctgc gtctaacacg 2160

atcttcgacg tctatttcta cgccgaaatc tccgtcaacg atgaggtcga cgttgaatca 2220

aacaacggaa tgggccctgt ggcgctcagt tactgtttga tgctcatcta catttcgttg 2280

ggcattaatc gcatcaagtt cagtcgagag ttcttcattt cgtccaagat cctggccgga 2340

ttctgcggtg tgataagtat tgcctgcggt gtggcttcga cgatcggtat ctacatgtgg 2400

gctggagtca agctccagct tattatcatg gaagtggttc ccttcctgtc gctggccatc 2460

ggtgtcgaca acatcttctt gatcatccac gccatgacgg agaaggaaga tcagctccga 2520

cgcgaccagc caagtctctt tattggtctg gagcacaacc ccaaggcgat cgaggagatc 2580

acaacggtca tcttgtctga gagtatcgcg tacatcggcc ccagtatctt catggcctcc 2640

gctgctgagt cggtggcatt tgcgttcggt tccatctcgg cgatgcctgt cgtgctgtgg 2700

ttcgctgcga tggcatgctg tgctgtggcg atcaactttt gcttccagat gacgttcttc 2760

ctctctgttc ttactctgga caagcgtcgc gagctgagcg gcaagtacga catcattttc 2820

aagcgggcgt cagcggtggc agcacaggca cccgccgctc ctgagactgt tcagcattcc 2880

tcagagccgc ttgtgtcgct gcagcccaag actccagcag cggacgatgt ccgtccttct 2940

gtcacgcccg agaacagcac gctgacggat gtccttgact attgcgtgga tgtctacgcg 3000

tcgatattaa cccacaagct tgtgaagctc gtcgtgctgt tactgttcct cgcgtggaca 3060

ttgtggtcta tctactcgat ggaatcgctg gaccagggcc tgccgcagaa ggaggccatg 3120

ccttcagact cgtacatgat cgagtacttc aacgcactgg atgtgtacct cgccacgggt 3180

gtgccggtgt acttcgtggt cgagactggc tatggtcgga accccgatgc ttggtcactg 3240

aacgatgaga gtgtcgagac gatcttctgc aagtccaagg atatctgcgg gacgtactca 3300

attcccaaca ttatgaacgc attggcaaac gacggtgaca aaacgaatac ccacatcagc 3360

cccggcacga cctactcgtg gatggatgac ttctggggct tcgtcaaccc tgacagcgag 3420

tgttgccgtg tggattccga gggcgcctac gtcccgatcg aaactggcaa cgacacgtac 3480

acgactctgc gcgcggacga cgacacgtgc cttgctacgt cggtgatgat tccccccgtg 3540

cctgaggccc aatacatgtc gctcttcagt atgttcgcga cggcaagtgc tggtacgtcg 3600

tgctcgtacg gtggtggttc gatctaccgt ggccagttca gtatcgactc ggagcccatt 3660

ccgaccgtca acgcctcgac gcctgcggtg aagatcaaca gcagtggcta cggtgacgag 3720

atcacggctt ggtcgtacat ggtgacgggc acgtcgaacc cgacgcagca gcgctacatc 3780

gactcgtaca agcagaacct tgcggcggcc gagtggatca gcgagaagac tggtgtggac 3840

atctgggtgt actcgctgac gtacgtgtac ttcgagcagt acctgactgt ggtcgacgac 3900

gcctacaagc tcatcggtct ggcgctggcg gctatcttcg tgatcacgac gctgtacctg 3960

ggcaacgtgt tctactcgct ggtgatcgcg ttgacggcga ccaacatcgt cgtgctcgtg 4020

ctgggtctga tgcagccgct ggacatcatg ctcaacggtc tgtccattgt gaacctgatc 4080

atcgcggctg gcatctcggt tgagttctgc ggtcactacg tccggttctt cgcgaaggct 4140

cgtggtacgg gcgacgagcg agctcgcgat gctcttcgcc aggtcttgac gtcggttgtg 4200

tttggcatca ccatcacgaa ggtcatcggt ctgagtgtgc tgacactcgc ggactcgcgc 4260

gtgttcaaga agtactactt ccgcatgtac atgatggtcg tggtgtgcgg tgtgctcaac 4320

ggcatgttgc tgctgcctgt ggtgctgagc accatcatgg acgtcaagaa ctttttcctc 4380

cgcaagcgct cgaggaagag cgagctcccg ttggcccctg tcactcgcgt agagtaagtc 4440

agcctactct gtcaccaact gtgtggagct ttcaacg 4477

<210>3

<211>3138

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>3

atggcgcgcg ccttctatcg cctgggcgcg ctctgcagcg gctcccccgt gctcatggcg 60

ctggcggcgc tgctctgcgg cggcgtgctg tgcctggggc tgctcaacat gcggctgcag 120

accgacccgc agggcctgtg ggtgcctccg cgcagcgtcg cggcccggga gcaggcgcgc 180

ttcgacgagc tcttcgggcc cttcttccgc gtccagcagc tcatcttcta cgcggactca 240

gactcagatg gtctctctgc gacgtgtgac gcctcgcgcg acctggtgca gcgccgcttc 300

ctgctgcaga tggccaaggt gcaggcgcag atcgccgacg ccgccgtcac agtgcagggc 360

gacggcgccc agggcaaggt gacgctctcg ctcgaggact tctgctaccg ccccatccgc 420

ggcaagggct gcctcgtcac cagccccttc cagtactggc tcggcaacgc gtcgctgctg 480

gagggcgacc cggacatcaa gctcacgacc gcgtgccaga ccacggaccc acagctccag 540

gagcgcgcgc cctgcatgga ccagaatggc gtccccgtca tgcgcgacgt cgtgttcggc 600

ggcctgtcga gggacgactg ccaccagaac ccggacccgt gcggggaggc cacgccgcag 660

gcccaggcgc tcgtggtcac gttcctgctc aacaacaggc ccgagaacga gacgtacacg 720

aggtacgtgg agcagtggga gcagcaggcg ttcctcaaga ttgcagcaca ggcggcggag 780

gcgcttaagc cctcctcgac cgccaacaag agcgacgagt tcatctggga cagcgtgcag 840

gaccaggagc tggcggacgt gggcgtcgac ggcatgcgcc tatcctacat ggcggagcgg 900

tcggtggccg actcgctcgt ggtgcagacc aaccagaacg cgtttattgt ggtggtgagc 960

tacctcgtca tgttcttgta cgtgtcggcg tcgctcggca agttcacgga cccggtgcgc 1020

tcgcggttcg ggctggggct cacgggcatc ctgatcgtgc tgctgtcgct gggggcggct 1080

atgggggtga gctgcgccat tctgcagatg gaggtgacga tgatcacgtt ggaggtcgtg 1140

ccgttcctgg tgctggctat cggcgtcgac aacatgttta tcttgaccaa cgagttcgat 1200

cgactcgcgg ctctgcgtgg cctcgcaacg ctggacacca ggcgcaacac gcgcgaccgg 1260

gcagaggacg aactgttgat gttgaagcag gtgctgggag aaaccatggt caatgtcgga 1320

ccctcgatcg tcgtggcggc tgttgcagaa acgttggcgt tcttggtggg ggctctcaca 1380

cgtatccccg ccctaacgag cttctgcgtg gttgctgcgc tggctgttgc cgctgacttt 1440

gcgctgcaaa tgacgtggtt tgcctcggcc ctcgtgttgg acgcgcgccg cgtgcgtgcc 1500

cgacgctacg atttgttccc gtggatgaag cagaaactca ccctcacgcc gcccacaaag 1560

ggcaagcgga ggatcgagtc caagattcac taccagtatg acttgctggt tgacgaaagc 1620

gagcgaagtg acgagccagc agctcgtgtg agcagcactg gcacacttca gcgtttcgtg 1680

gagaaaacct acatcccgtt cctgttacgc cggtccacga aagtgctggt gcttgtgacg 1740

gctctttcag tggtaactct tagtgctttt ggctcctccg aactcccact cggactcgag 1800

caggagcttg cggtgcctac ggatttttac ctgcatgagt acttcaagaaacagaccgcg 1860

cttggtgagg cggggccacc agcttacgtt gttctggata gcgatgtgga ttacacagat 1920

gcacgcctcc agcaagatgt gaacgtgcta ttggatcagc tttccggtct tcgccagtat 1980

atccagctgc cggtgtgctc gtggctgcat acgttcaacc aatggcgtca aatgcgcttc 2040

ttcctacagg acaagattaa acaaggtcag tgcgattgtc cggtgcagcc aatggatccg 2100

ttcccgtacg aactcgcgaa tgttggagtc gaggacccca gtggagacgt tgatttgttc 2160

ctagcgcccg agtatgggta tggcgctctg gcaacggcgc atgtgacccc caatgcgctg 2220

ttctacccgt tggtgaagaa cttcacaaag atctcaattg actcaacgtg ctgccagcat 2280

ttcgggctgt gtggagcgca gtatgaagga gacatcatat tcaacgagcc aaatgcaggt 2340

gatgacgact ctacgggcat gtctatcgtc ggttctcgta tacgcttcca gctgaatgca 2400

ctccgcaacc agtccatgtt cgtgaactcg tactactacc ttcatgatgt ggtggggcgt 2460

tggagcatcg accatgccgc cactgccttc ccgtacgctc ttgtcttcgt gtacgaagag 2520

caatacacgt acatccaggg agtggcgctg caaagtgtgc tgctggcgct ggccgtggtg 2580

ttcggagcgc tcttcgtgct gatggacggg agcttgcggc tgaccaccgt tgtcaccttg 2640

tgcgtgctgt cgatgacttt ctcgcagttg ggcttcctct tcgtgtggaa tatgattgct 2700

gggccgggcg cagaaacgtc gatcaatgca gtctcggtgg tgaatctgct cgcctgtgtt 2760

gggcttggtg tcgagttttg cgtgcacacg gcacaccagt ttgccttttc gcgacggcat 2820

cacctgggca caactgccaa cgaccacaca cgatacgctc tgagcagtgt gggcgcatcc 2880

atcttctccg gtattacgct caccaagttc tgcggcatcg gtgtccttgc gttcgcgccg 2940

tccatgttgt tccgcgtgta cttcttccgc atgtacctgg gcattgtcgt gttgggctgc 3000

ttccacggtc tcgtactgct gccagtgctg ctgagtctca ttggccagcc gcagaagtac 3060

ccgaacgatc tcagctcgtt tctactttct gaagagcgag acgacgagtt agaggacgaa 3120

gtgagagcgt tcaagtga 3138

<210>4

<211>4461

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>4

atgcgcgtct cggccctcgc gtcgctgctg ctgccgctgg gcgtggcccg cgccgccagc 60

tcctcgggct ccacgacgtc cacggcgacc acgacgacaa cgggcacgtc gtccgtctcc 120

agctacgtgc cctggacgct ggccgacaac gccaccaacc tggccgacat caaggcgcag 180

ctcaccatgt gcacgtactc caaggtggag gagtgcatcc aggacccggc gctggtgcac 240

gagctcggcg cgctcgtgcg cgctcctggc cactgcgtgg ccttcgactc gtcctacgtc 300

aacgtcacca cggccggtgt cgccatcccc aaccgctact acccgacgtc cgtggaggac 360

gcgtacgacg ccggcttctc caacaagttc tccgagtggt cggacaccaa ccgcgagcag 420

ttcgaggtgg actgcccgct gctctacaac gagaccatcg cccagggcga cgacatgctc 480

tgctgtaccg agaaccagta cacggggctg tccacgcagg tgcgcatgat ccccggtctg 540

tgctcggcct gcaaggagaa cctgcgcaac atcttctgtc agatgacgtg cagccccaac 600

aacagcatgt tcctggacgt caacgaggtg cgcatcatgc ccggcgacga cgagcacccg 660

gacgccgtgt tccccgccgt ggaggaggtc acgtactacg tgggcagcga ctggatccgc 720

gacatctacg acttctgcga ggccgacagc tccttctcgc tgctgtgcaa ccccaatcag 780

gactgccatg acggctacgg cctcctcgag tacatgggca agtacgcctt caacagcatc 840

gggtctccgc tccagattaa cgtgacgacc atggacaagg tccccgagat caaccaaatg 900

accgagttct gccactgcga caacgtgaat gccaccaact gcatcctgcc gcagaacagc 960

aggatgacgt cctgcgtcgg cacctgcggc tcgctgtgtg ccgtgagctc gagcgacgac 1020

cgcacgtaca cagagtcctg ctacggcgcc agcaatgcgg tcgccacgtc ctcctcggcc 1080

agcggaagcg tcggctccgg ctcggacgac tcgacgtggg ccgagctgaa cgcgtacctg 1140

gccagcaaca tcccggtgac ggactggacg ggcctcaact acttcctcgt catcttcggt 1200

ggagccgtcg ccctgctgct cattgtgggc ttcattgtcg ctggctgccg cgagcggagg 1260

gcccgcatcc ccaacccgca cacgggcacg ccccacatcg gcccgtacac gcctgaggct 1320

cacggcgtgg cgcacgcgat ggagacgagc aacacgcgtc tgagctatct ggacgagctc 1380

atgacgaaca agctgcgcac gtgggcggta ttcgtgtcga cgggcaaccg gcccaagaag 1440

atgatcccga tggtgctgtg cgttgtcgct gtctgcgttg tcggcctgta caacattgat 1500

atcgagacgg acccgatcaa gctgtgggtg tcctcgtcca gtacctcgta ccagcagcgc 1560

cagcactacg gcgagatctt caacccgttc taccgctccg agcaggtcat tatggtgccc 1620

aaggacggcg gcaacatcta ccgctcgtcg atcatcaagg aggccatccg cgtgcagact 1680

gtggcagcca acgtgacgta cacttcggac gacggtgacg agacgattac tctggacgac 1740

atttgctgga aggctacggg cacgggctgc accgtcaact cgatcacgca gtacttccag 1800

aacaacatgg agcacttcga gttctacgag aagtatgggc tggagatgga gcactttagt 1860

aactgccttt actctccgac cacgtcggac gtggcgcttt gcaccgagtt gaagaacgct 1920

ctggaggatg gcgactcgct cccgtcgagc atgagcgact gcccctgctt gtcagcgttt 1980

ggctcgccca tgaacctgta caacacctac ctgggtggct tccctgacgg cgctgaaagc 2040

aactacacgt tgttcctcga ctctgtggcg tttgtttcct cgtacctgaa ctacaactac 2100

gctgacgacg acaagaacga acctgccatc aagtgggagc gcgagtacat caagacgatg 2160

aaggaggagg ctgcgtccaa cacgatcttc gacgtctact tctatgccga aatctccgtc 2220

aacgatgaga tcgacgccga gtcgagcaac ggtatgggcc ctgtggcgct cagttactgt 2280

ttgatgatca tctacatctc gctcggtatc aaccgcatca agttcagccg cgagtttttc 2340

atctcgtcca agatcgtggc cggtttctgc ggtgtcatga gcattgtgtg cggtgtggcg 2400

tcgacgatcg gtatctacat gtgggctgga gtcaagctcc agcttattat catggaagtg 2460

gttcccttcc tgtcgctggc catcggtgtc gacaacatct tcttgatcat ccacgctatg 2520

acggagaagg aagaccagat gcgccgtgag cagccaagtc tcttcatcgg tctggagcac 2580

aaccccacgg cgatcgagga gatcaccacg acgattctgt ccgagagtct ggcgtacatc 2640

ggccccagta tcttcatggc ctccgctgcc gagtccgtgg ccttcgcgtt cggttccatt 2700

tcgccgatgc ctgtcgtgct gtggttcgcc gccatggctt gctgcgctgt ggcgatcaac 2760

ttctgcctcc agatgaccct gttcctgtct gttcttacgc tggacaagcg ccgcgagctg 2820

agcggcaagt acgacattat cttcaagcgc gcctcgtacg tcaggtcgca gccgcctgcc 2880

ggtggcccgg agactcagca gactgcccaa ccccttgtct ctctcgagcc caagaccccg 2940

gcgcccgaag atgcccgccg ctctatcacg cctgagaacc gcacgctgac ggacgtcctc 3000

gactactgcg tggatgtcta cgcgtcgatc ctgacgtaca agattgtgaa gctcgtcgtg 3060

ctgctggtct tcctcttctg gacgttgtgg tcgatctact cgatggaatc gttggaccag 3120

ggtctgccgc agaaggaggc catgccttca gactcgtaca tgattgagta cttcaacgcg 3180

ctggatgtgt acctcgccac gggtgtgcct gtgtacttca tcgttgaaac tggctacggt 3240

cgcaacccgg acacgtggtc gctgaacgac gagagcgtcg agacgctctt ctgcaagtcg 3300

aaggacatct gtggaacgta ctcaatcccc aacatcatga acgcgctggc caaccacgga 3360

gacaagaatg tgacgcacat cagccccggc acgacctact cgtggatgga tgacttctgg 3420

ggcttcgtca accctgacag cgagtgttgc cgtgtggatt ccgagggcgc ctacgtcccg 3480

atcgaaactg gcaacgacac gtacacgact ctgcgcgcgg acgacgacac gtgccttgct 3540

acgtcggtga cgattccccc cgtgcctgag gcccaataca tgtcgctctt cagtatgttc 3600

gcgacggcaa gtgctggtac gtcgtgctcg tacggtggtg gttcgatcta ccgtggccag 3660

ttcagtatcg actcggagcc cattccgacc gtcaacgcct cgacgcctgc ggtgaagatc 3720

aacagcagtg gctacggtga cgagatcacg gcttggtcgt acatggtgac gggcacgtcg 3780

aacccgacgc agcagcgcta catcgactcg tacaagcaga accttgcggc ggccgagtgg 3840

atcagcgaga agactggtgt ggacatctgg gtgtactcgc tgacgtacgt gtacttcgag 3900

cagtacctga ctgtggtcga cgacgcctac aagctcatcg gtctggcgct ggcggctatc 3960

ttcgtgatca cggcgctgta cctgggcaac gtgttctact cgctggtgat cgcgttgacg 4020

gcgaccaaca tcgtcgtgct cgtgctgggt ctgatgcagc cgctggacat catgctcaac 4080

ggtctgtcca ttgtgaacct gatcatcgcg gccggtatcg ccgtcgagtt ctgcggtcac 4140

tacgtccggt tcttcgcgaa ggctcgcggt acgggcgacg agcgcgctcg cgatgctctt 4200

cgccaggtct tgacgtcggt tgtgtttggc atcaccatca cgaaggtcat cggtctgagt 4260

gtgctgacac tcgcggactc gcgcgtgttc aagaagtact acttccgtat gtacatgatc 4320

gtcgtgctct gcggtgtgct caacggcatg ctgctgctgc ccgtgctgct cagcaccatc 4380

acagacgtca aggacttctt cttgcgtaga ggatcacgga aaaccgacct gccttcggcg 4440

cctgttactc gggtggagta a 4461

<210>5

<211>1597

<212>PRT

<213> Phytophthora sojae (Phytophthora sojae)

<400>5

Met Trp Leu Phe Ala Ala Ile Ser Leu Ala Ile Ala Thr Pro Cys Phe

1 5 10 15

Arg Ala Trp Leu Glu Ala Leu Phe Ala Glu Leu Ser Ile Ile Phe Phe

20 25 30

Thr Tyr Leu Arg Leu Val Ser Ala Gly Leu Ser Leu Val Leu Leu Leu

35 40 45

Ala Leu Ala Phe His Gly Arg Arg Phe Leu Arg Ser Arg Arg Thr Gly

5055 60

Leu Ala Arg Val His Trp Arg Arg Gly Thr Arg Arg Arg Ala Leu Met

65 70 75 80

Leu Arg Val Lys Ser Thr Thr Ser Glu Ile Ala Gly Ser Gly Phe Tyr

85 90 95

Pro Pro Gln Leu Trp Thr Ser Ser Leu Phe Ala Leu Ala Met Leu Pro

100 105 110

Ile Ile Asn Ser Val Val Thr Ala Ala Ala Ala Gln Thr Ala Phe Asp

115 120 125

Ala Asp Ala Ala Ala Leu Val Thr Leu Gln Gln Gln Leu Thr Thr Cys

130 135 140

Lys Tyr Ser Gly Gly Asp Asp Cys Leu Asp Asp Val Thr Ala Ile Ser

145 150 155 160

Val Leu Gly Ser Tyr Gln Gln Ala Ser Gly Tyr Cys Val Ala Phe Asp

165 170 175

Ala Ala Tyr Val Asn Val Thr Thr Gly Ala Ala Leu Pro Ala Gln Tyr

180 185 190

Phe Pro Ile Gly Val Glu Glu Ala His Ala Gln Gly Phe Ala Asn Asn

195 200 205

Phe Ser Ala Trp Ser Glu Thr Asn Gln Glu Lys Phe Lys Thr Asp Cys

210 215220

Pro Leu Leu Phe Asn Glu Thr Val Ser Gly Asp Gly Glu Gly Leu Leu

225 230 235 240

Cys Cys Thr Glu Thr Gln Tyr Glu Met Leu Ser Leu Gln Val Arg Lys

245 250 255

Leu Pro Gly Glu Cys Thr Ser Cys Lys Gln Asn Leu Arg Asn Leu Trp

260 265 270

Cys Gln Phe Thr Cys His Pro Ser Asn Ser Leu Phe Val Asp Val Thr

275 280 285

Gln Val Arg Leu Met Glu Gly Asp Ala Asp His Ala Asp Glu Val Phe

290 295 300

Pro Ala Ile Glu Glu Ala Thr Tyr Tyr Val Gly Ser Asp Met Val Arg

305 310 315 320

Asp Leu His Asp Phe Cys Glu Ala Asp Ser Gly Phe Met Pro Leu Leu

325 330 335

Cys Gly Met Asn Ala Asp Gly Asn Cys Ser Thr Thr Gly Ser Asp Met

340 345 350

Leu Gly Tyr Leu Gly Ala Tyr Ser Phe Asp Gly Val Gly Ser Pro Ser

355 360 365

Gln Val Ile Phe Thr Thr Met Glu Gln Leu Ser Ala Ala Glu Gln Glu

370 375380

Asp Lys Ile Cys Ala Cys Asp Ser Ser Asn Thr Thr Gly Cys Phe Ser

385 390 395 400

Pro Met Asp Thr Arg Leu Glu Ser Cys Val Asp Thr Cys Gly Ser Leu

405 410 415

Cys Ala Val Ser Asp Asp Asp Ser Arg Gln Tyr Gln Ala Ala Cys Tyr

420 425 430

Ser Ser Gly Ser Thr Ser Ala Ser Asp Asp Leu Ser Thr Val Thr Thr

435 440 445

Ala Thr Thr Ser Thr Ser Ala Ala Asp Lys Leu Glu Ser Leu Leu Ser

450 455 460

Asp Leu Ser Ser Arg Ala Glu Gly Gly Ser Phe Ala Val Leu Asn Tyr

465 470 475 480

Val Leu Ala Val Leu Ala Phe Phe Gly Ala Thr Ala Leu Ala Leu Gly

485 490 495

Phe Ala Tyr Ser Thr Arg Tyr Gly Arg Lys Lys Arg Gln Ser Val Leu

500 505 510

Asp Asp Pro Val Asn Gly Leu Gly Ser Gly Met Leu Ser Leu Val Asn

515 520 525

Leu Asp Gln Leu Lys Gly Ile Gly Arg Trp Asp Asp Arg Leu Thr Met

530 535 540

His Leu Lys Arg Trp Gly Asp Phe Val Ala Met Gly Asn His Pro Leu

545 550 555 560

Tyr Ile Ile Leu Leu Ser Leu Met Val Val Val Cys Cys Ser Ser Gly

565 570 575

Leu Ile Arg Met Glu Val Glu Thr Asp Ser Met Lys Leu Trp Val Ser

580 585 590

Gly Arg Ser Ser Val Phe Gln Glu Arg Thr Arg Phe Gly Glu Met Leu

595 600 605

Gly Pro Val Asp Arg Met Glu Arg Leu Val Leu Val Thr Lys Asp Gly

610 615 620

Gly Ala Val Thr Arg Pro Ala Tyr Ile Lys Glu Ala Ile Arg Leu Gln

625 630 635 640

Gln Val Ile Gly Ser Glu Val Ala Ala Asp Ser Ile Thr Leu Ser Glu

645 650 655

Ile Cys Val Lys Asp Ala Ser Ser Ser Pro Cys Gln Val Asn Ser Val

660 665 670

Thr Gln Tyr Phe Gln Asn Ser Met Asp His Phe Asn Met Tyr Asp Ala

675 680 685

Tyr Gly Leu Val Gly Lys His Leu Ser Asn Cys Ala Asn Ala Pro Glu

690 695 700

Arg Ala Asp Gly Asn Val Cys Ser Glu Leu Gln Val Gln Leu Asn Ala

705 710 715 720

Ser Gly Ala Ser Leu Pro Thr Ser Met Ser Gly Cys Pro Cys Ala Ser

725 730 735

Ser Phe Gly Val Pro Met Ala Glu Leu Glu Lys Tyr Leu Gly Gly Leu

740 745 750

Ser Thr Asp Gly Gly Ser Leu Asn Ala Ser Ala Tyr Leu Glu Gln Ala

755 760 765

Thr Thr Leu Phe Ser Thr Ala Met Val Thr Asn His Gln Asp Gly Ala

770 775 780

Lys Asn Ala Asp Ala Ile Ala Trp Glu Arg Ala Tyr Ile Ala Arg Met

785 790 795 800

Glu Lys Glu Ser Asp Thr Asn Thr Met Tyr Asp Ile Tyr Tyr Ala Ala

805 810 815

Glu Val Ser Ala Asp Asp Glu Phe Val Ala Ala Ser Asn Leu Asp Ile

820 825 830

Val Phe Lys Ala Gly Ile Ala Gly Phe Leu Phe Met Phe Val Tyr Val

835 840 845

Val Ile Gly Leu Asn His Trp Lys Leu Asp Tyr Arg Phe Phe His Ser

850 855 860

Ser Lys Ile Gly Val Gly Phe Met Gly Val Ala Cys Ile Leu Met Ala

865 870 875 880

Val Gly Gly Thr Leu Gly Ile Phe Ala Trp Thr Gly Val Lys Leu Gln

885 890 895

Ile Val Thr Leu Val Val Met Pro Val Val Val Leu Ala Ile Gly Thr

900 905 910

Gly Asn Ile Phe Leu Ile Leu His Ala Val Asp Leu Lys Gln Glu Glu

915 920 925

Leu Lys Met Glu Gln Arg Ser Leu Phe Val Gly Leu Glu Asp Asn Asp

930 935 940

Phe Gly Ile His Glu Ile Thr Cys Val Leu Leu Cys Glu Ala Thr Gly

945 950 955 960

Tyr Ile Gly Pro Ser Met Ile Ala Thr Cys Val Cys Glu Cys Cys Ile

965 970 975

Val Ala Phe Ala Ala Tyr Ser Thr Met Pro Ala Ala Gln Trp Leu Ala

980 985 990

Gly Ser Leu Val Leu Gly Leu Ala Ala Ser Phe Ala Leu Gln Met Thr

995 1000 1005

Leu Phe Leu Ala Ile Val Ala Leu Asp Lys Arg Arg Glu Leu Ser Gly

1010 1015 1020

Thr Tyr Asp Val Ile Cys Cys Lys Arg Ala Ser Phe Ala Arg Arg Pro

1025 1030 1035 1040

Arg Leu Ser Glu Asp Glu Thr Thr Ala Ala Thr Glu Asn Ser Ser Phe

1045 1050 1055

Pro Gly Ser Thr Ile Ser Leu Pro Asp Leu Asn Leu Met Asn Arg Cys

1060 1065 1070

Val Ala Gly Tyr Ile His Val Leu Leu Lys Lys Val Ser Lys Val Leu

1075 1080 1085

Val Leu Leu Val Phe Ala Ala Cys Thr Leu Ala Ala Ile Val Ser Ile

1090 1095 1100

Glu Ala Met Asp Arg Gly Leu Ser Pro Asn Ser Phe Ile Pro Thr Asn

1105 1110 1115 1120

Ser Tyr Leu His Ala Tyr Tyr Arg Ala Val Asp Glu Asn Asp Leu Ser

1125 1130 1135

Thr Lys Glu Phe Pro Ala Tyr Phe Val Val Glu Ala Gly Tyr Gly Ser

1140 1145 1150

Asn Pro Thr Gly Phe Asn Asp Leu Ala Asn Asp Ala Glu Ala Gln Cys

1155 1160 1165

Lys Leu Cys Ser Ser Lys Glu Phe Cys Asp Asp Leu Ser Ile Pro Asn

1170 1175 1180

Ile Leu Ser Ala Leu Val Ala Ala Gly Glu Ser Asn Val Thr Phe Phe

1185 1190 1195 1200

Lys Asp Gly Thr Val Val Gly Ser Trp Leu Asp Asp Phe Trp Ser Phe

1205 1210 1215

Val Asp Pro Ala Ser Glu Cys Cys Arg Val Asp Ala Glu Asn Asp Tyr

1220 1225 1230

Ser Tyr Tyr Ala Ile Leu Pro Glu Glu Ser Ser Ala Glu Tyr Val Leu

1235 1240 1245

Lys Arg Ala Ser Asn Ala Pro Ser Cys Leu Ala Asp Ser Ser Ala Val

1250 1255 1260

Leu Ser Val Pro Asp Glu Ser Phe Met Ser Leu Phe Ser Met Phe Ser

1265 1270 1275 1280

Thr Ala Ala Ala Gly Pro Leu Cys Ser Tyr Ala Ala Gly Thr Arg Tyr

1285 1290 1295

His Gly Gln Leu Ser Val Asp Ser Gln Pro Ile Pro Ala Met Ser Ser

1300 1305 1310

Ser Ala Ala Ala Gly Val Thr Leu Asn Gly Thr Gly Tyr Gly Ser Asp

1315 1320 1325

Val Thr Ala Phe Val Tyr Lys Val Leu Ser Thr Thr Val Gly Ser Ser

1330 1335 1340

Lys Ile Ser Gly Ser Gln Glu Gly Ala Ile Ala Ala Tyr Ser Gln Ala

1345 1350 1355 1360

Gln His Ile Ala Lys Trp Ile Ser Glu Glu Thr Gly Ile Asp Val Trp

1365 1370 1375

Ala Tyr Ser Pro Glu Tyr Val Tyr Leu Asp Gln Phe His Ser Val Arg

1380 1385 1390

Arg Thr Ala Tyr Ile Val Val Gly Val Gly Leu Ala Val Val Phe Val

1395 1400 1405

Leu Gln Ser Leu Ala Leu Gly Ser Tyr Trp Tyr Gly Phe Ala Val Thr

1410 1415 1420

Cys Val Ala Ala Ala Thr Val Val Gln Val Ala Gly Leu Met Met Pro

1425 1430 1435 1440

Met Gly Val Pro Ile Asn Ser Leu Ser Ile Val Ser Leu Ser Ile Ala

1445 1450 1455

Val Thr Phe Ser Val Gly Phe Ser Gly His Phe Ala Arg Leu Phe Ala

1460 1465 1470

Lys Ala Arg Thr Ile Thr Asp Asp Leu Gly Tyr Ser Pro Gly Gly Asp

1475 1480 1485

Ala Cys Val Arg Lys Val Leu Ala Gln Leu Leu Ala Ser Trp Thr Leu

1490 1495 1500

Gly Val Ala Val Ser Lys Phe Val Ala Ile Ala Ala Leu Ala Leu Val

1505 1510 1515 1520

Ala Thr Pro Val Phe Glu Pro Ala Gly Asn Cys Phe Phe Arg Thr Leu

1525 1530 1535

Met Ala Ala Ala Val Cys Ala Trp Leu Asn Ser Ala Val Leu Leu Pro

1540 1545 1550

Val Gly Leu Ser Ile Cys Val Asp Ala Thr Glu Gly Arg Val Arg Asp

1555 1560 1565

Val Lys Pro Thr Asn Glu Glu Gly Gly Glu Tyr Ser Arg Glu Ser Pro

1570 1575 1580

Ser Ser Ser Tyr His Thr Ala Pro Pro Thr Ser Lys Tyr

1585 1590 1595

<210>6

<211>1478

<212>PRT

<213> Phytophthora sojae (Phytophthora sojae)

<400>6

Met Arg Val Ser Ala Leu Ala Ser Leu Leu Leu Pro Leu Gly Val Ala

1 5 10 15

Arg Ala Ala Ser Ser Ser Ser Ser Thr Thr Ser Ser Gly Val Ser Ser

20 25 30

Ala Ser Ser Tyr Val Pro Trp Ser Leu Ala Asp Asn Ala Thr Asn Leu

35 40 45

Ala Ile Ile Glu Ser Gln Leu Thr Ile Cys Thr Tyr Ser Lys Val Glu

50 55 60

Glu Cys Ile Gln Asp Pro Lys Leu Val Gln Glu Leu Gly Ser Leu Tyr

65 70 75 80

Arg Ala Pro Gly Tyr Cys Val Ala Phe Asp Ser Ala Tyr Val Asn Ile

85 90 95

Thr Thr Thr Ser Ala Ala Ile Pro Asn Arg Tyr Tyr Pro Thr Ser Val

100 105 110

Glu Asp Ala Tyr Asp Ala Gly Phe Ser Asn Lys Phe Ser Glu Trp Ser

115 120 125

Asp Thr Asn Arg Glu Gln Phe Glu Val Asp Cys Pro Leu Leu Tyr Asn

130 135 140

Glu Thr Ile Ala Leu Gly Asp Asp Met Leu Cys Cys Thr Glu Ser Gln

145 150 155 160

Tyr Thr Gly Leu Ser Thr Gln Val Arg Met Ile Pro Gly Leu Cys Ser

165 170 175

Ala Cys Lys Glu Asn Leu Arg Asn Ile Phe Cys Gln Phe Thr Cys Asn

180 185 190

Pro Asn Asn Ser Met Phe Leu Asp Ile Asn Glu Val Arg Ile Met Ser

195 200 205

Gly Asp Asp Glu His Glu Gly Gln Ile Phe Pro Ala Val Glu Glu Ala

210 215 220

Thr Tyr Tyr Val Gly Lys Asp Trp Ile Arg Asp Ile Tyr Asp Phe Cys

225 230 235 240

Glu Asp Asp Ser Ser Phe Ser Leu Leu Cys Asn Pro Asn Gln Asp Cys

245 250 255

Thr Asp Gly Tyr Gly Leu Met Glu Tyr Met Gly Lys Tyr Ala Tyr Asn

260 265 270

Ser Ile Gly Ser Pro Glu Gln Ile Asn Val Thr Thr Met Asp Gln Leu

275 280 285

Ser Glu Glu Leu Gln Met Thr Glu Phe Cys His Cys Asp Tyr Ala Asn

290 295 300

Glu Thr Asn Cys Ile Ser Pro Met Asn Asn Lys Met Thr Ser Cys Val

305 310 315 320

Gly Val Cys Gly Ser Leu Cys Ala Val Ser Ser Asp Asp Thr Arg Thr

325 330 335

Tyr Thr Asp Ala Cys Tyr Gly Ala Lys Ser Ala Ser Ser Ser Gly Ser

340 345 350

Gly Ser Val Val Asp Asn Asp Asp Asp Ala Thr Trp Met Glu Leu Asn

355 360 365

Glu Tyr Leu Ala Asn Asn Leu Pro Ala Thr Asp Trp Thr Pro Phe Asn

370 375 380

Tyr Phe Leu Val Ile Phe Gly Gly Val Val Gly Val Leu Leu Ile Val

385 390 395 400

Gly Phe Ile Val Ala Met Leu Arg Glu Arg Arg Tyr Ser Ala Val Glu

405 410 415

Arg Asn Ser Gly Thr Pro Gln Val Val Gly Pro Asn Thr Pro Asp Phe

420 425 430

His Gly Val Ala Ser Ala Met Ala Gly Ser Val Gly Tyr Leu Ser Phe

435 440 445

Leu Asp Asp Leu Met Thr Asn Lys Leu Arg Leu Trp Ala Ala Phe Val

450 455 460

Ser Lys Gly Asn Arg Pro Lys Lys Ile Thr Pro Met Val Leu Cys Val

465 470 475 480

Val Val Ile Cys Ala Val Gly Leu Tyr Asn Ile Asp Ile Glu Thr Asp

485 490 495

Pro Ile Lys Leu Trp Val Ser Thr Ser Ser Thr Ser Tyr Glu Gln Arg

500 505 510

Gln His Tyr Gly Glu Ile Phe Asn Pro Phe Tyr Arg Ser Glu Gln Ile

515520 525

Ile Met Val Pro Lys Asp Gly Gly Asn Ile Tyr Arg Ser Ser Ile Ile

530 535 540

Lys Glu Ala Ile Arg Val Gln Thr Val Ala Ala Asn Val Thr Tyr Thr

545 550 555 560

Ser Asp Asp Gly Asp Glu Thr Ile Thr Leu Asp Asp Ile Cys Trp Lys

565 570 575

Ala Thr Gly Thr Gly Cys Thr Val Asn Ser Ile Thr Gln Tyr Phe Gln

580 585 590

Asn Asn Met Glu His Phe Glu Phe Tyr Glu Lys Tyr Gly Leu Glu Leu

595 600 605

Glu His Phe Ser Asn Cys Leu Tyr Ser Pro Thr Thr Ser Asp Val Ala

610 615 620

Leu Cys Thr Glu Leu Lys Asn Ala Leu Glu Asp Gly Asp Ser Leu Pro

625 630 635 640

Ser Ser Met Ser Asp Cys Pro Cys Leu Ser Ala Phe Gly Ser Pro Met

645 650 655

Asn Leu Tyr Asn Thr Tyr Leu Gly Gly Phe Pro Asp Gly Ala Glu Ser

660 665 670

Asn Tyr Thr Leu Phe Leu Glu Ser Glu Ala Phe Val Ser Ser Tyr Leu

675680 685

Asn Tyr Asn Tyr Ala Asp Asp Asp Lys Asn Glu Pro Ala Ile Lys Trp

690 695 700

Glu Arg Glu Tyr Ile Lys Thr Met Lys Lys Glu Ala Ala Ser Asn Thr

705 710 715 720

Ile Phe Asp Val Tyr Phe Tyr Ala Glu Ile Ser Val Asn Asp Glu Val

725 730 735

Asp Val Glu Ser Asn Asn Gly Met Gly Pro Val Ala Leu Ser Tyr Cys

740 745 750

Leu Met Leu Ile Tyr Ile Ser Leu Gly Ile Asn Arg Ile Lys Phe Ser

755 760 765

Arg Glu Phe Phe Ile Ser Ser Lys Ile Leu Ala Gly Phe Cys Gly Val

770 775 780

Ile Ser Ile Ala Cys Gly Val Ala Ser Thr Ile Gly Ile Tyr Met Trp

785 790 795 800

Ala Gly Val Lys Leu Gln Leu Ile Ile Met Glu Val Val Pro Phe Leu

805 810 815

Ser Leu Ala Ile Gly Val Asp Asn Ile Phe Leu Ile Ile His Ala Met

820 825 830

Thr Glu Lys Glu Asp Gln Leu Arg Arg Asp Gln Pro Ser Leu Phe Ile

835840 845

Gly Leu Glu His Asn Pro Lys Ala Ile Glu Glu Ile Thr Thr Val Ile

850 855 860

Leu Ser Glu Ser Ile Ala Tyr Ile Gly Pro Ser Ile Phe Met Ala Ser

865 870 875 880

Ala Ala Glu Ser Val Ala Phe Ala Phe Gly Ser Ile Ser Ala Met Pro

885 890 895

Val Val Leu Trp Phe Ala Ala Met Ala Cys Cys Ala Val Ala Ile Asn

900 905 910

Phe Cys Phe Gln Met Thr Phe Phe Leu Ser Val Leu Thr Leu Asp Lys

915 920 925

Arg Arg Glu Leu Ser Gly Lys Tyr Asp Ile Ile Phe Lys Arg Ala Ser

930 935 940

Ala Val Ala Ala Gln Ala Pro Ala Ala Pro Glu Thr Val Gln His Ser

945 950 955 960

Ser Glu Pro Leu Val Ser Leu Gln Pro Lys Thr Pro Ala Ala Asp Asp

965 970 975

Val Arg Pro Ser Val Thr Pro Glu Asn Ser Thr Leu Thr Asp Val Leu

980 985 990

Asp Tyr Cys Val Asp Val Tyr Ala Ser Ile Leu Thr His Lys Leu Val

995 10001005

Lys Leu Val Val Leu Leu Leu Phe Leu Ala Trp Thr Leu Trp Ser Ile

1010 1015 1020

Tyr Ser Met Glu Ser Leu Asp Gln Gly Leu Pro Gln Lys Glu Ala Met

1025 1030 1035 1040

Pro Ser Asp Ser Tyr Met Ile Glu Tyr Phe Asn Ala Leu Asp Val Tyr

1045 1050 1055

Leu Ala Thr Gly Val Pro Val Tyr Phe Val Val Glu Thr Gly Tyr Gly

1060 1065 1070

Arg Asn Pro Asp Ala Trp Ser Leu Asn Asp Glu Ser Val Glu Thr Ile

1075 1080 1085

Phe Cys Lys Ser Lys Asp Ile Cys Gly Thr Tyr Ser Ile Pro Asn Ile

1090 1095 1100

Met Asn Ala Leu Ala Asn Asp Gly Asp Lys Thr Asn Thr His Ile Ser

1105 1110 1115 1120

Pro Gly Thr Thr Tyr Ser Trp Met Asp Asp Phe Trp Gly Phe Val Asn

1125 1130 1135

Pro Asp Ser Glu Cys Cys Arg Val Asp Ser Glu Gly Ala Tyr Val Pro

1140 1145 1150

Ile Glu Thr Gly Asn Asp Thr Tyr Thr Thr Leu Arg Ala Asp Asp Asp

1155 11601165

Thr Cys Leu Ala Thr Ser Val Met Ile Pro Pro Val Pro Glu Ala Gln

1170 1175 1180

Tyr Met Ser Leu Phe Ser Met Phe Ala Thr Ala Ser Ala Gly Thr Ser

1185 1190 1195 1200

Cys Ser Tyr Gly Gly Gly Ser Ile Tyr Arg Gly Gln Phe Ser Ile Asp

1205 1210 1215

Ser Glu Pro Ile Pro Thr Val Asn Ala Ser Thr Pro Ala Val Lys Ile

1220 1225 1230

Asn Ser Ser Gly Tyr Gly Asp Glu Ile Thr Ala Trp Ser Tyr Met Val

1235 1240 1245

Thr Gly Thr Ser Asn Pro Thr Gln Gln Arg Tyr Ile Asp Ser Tyr Lys

1250 1255 1260

Gln Asn Leu Ala Ala Ala Glu Trp Ile Ser Glu Lys Thr Gly Val Asp

1265 1270 1275 1280

Ile Trp Val Tyr Ser Leu Thr Tyr Val Tyr Phe Glu Gln Tyr Leu Thr

1285 1290 1295

Val Val Asp Asp Ala Tyr Lys Leu Ile Gly Leu Ala Leu Ala Ala Ile

1300 1305 1310

Phe Val Ile Thr Thr Leu Tyr Leu Gly Asn Val Phe Tyr Ser Leu Val

1315 13201325

Ile Ala Leu Thr Ala Thr Asn Ile Val Val Leu Val Leu Gly Leu Met

1330 1335 1340

Gln Pro Leu Asp Ile Met Leu Asn Gly Leu Ser Ile Val Asn Leu Ile

1345 1350 1355 1360

Ile Ala Ala Gly Ile Ser Val Glu Phe Cys Gly His Tyr Val Arg Phe

1365 1370 1375

Phe Ala Lys Ala Arg Gly Thr Gly Asp Glu Arg Ala Arg Asp Ala Leu

1380 1385 1390

Arg Gln Val Leu Thr Ser Val Val Phe Gly Ile Thr Ile Thr Lys Val

1395 1400 1405

Ile Gly Leu Ser Val Leu Thr Leu Ala Asp Ser Arg Val Phe Lys Lys

1410 1415 1420

Tyr Tyr Phe Arg Met Tyr Met Met Val Val Val Cys Gly Val Leu Asn

1425 1430 1435 1440

Gly Met Leu Leu Leu Pro Val Val Leu Ser Thr Ile Met Asp Val Lys

1445 1450 1455

Asn Phe Phe Leu Arg Lys Arg Ser Arg Lys Ser Glu Leu Pro Leu Ala

1460 1465 1470

Pro Val Thr Arg Val Glu

1475

<210>7

<211>1045

<212>PRT

<213> Phytophthora sojae (Phytophthora sojae)

<400>7

Met Ala Arg Ala Phe Tyr Arg Leu Gly Ala Leu Cys Ser Gly Ser Pro

1 5 10 15

Val Leu Met Ala Leu Ala Ala Leu Leu Cys Gly Gly Val Leu Cys Leu

20 25 30

Gly Leu Leu Asn Met Arg Leu Gln Thr Asp Pro Gln Gly Leu Trp Val

35 40 45

Pro Pro Arg Ser Val Ala Ala Arg Glu Gln Ala Arg Phe Asp Glu Leu

50 55 60

Phe Gly Pro Phe Phe Arg Val Gln Gln Leu Ile Phe Tyr Ala Asp Ser

65 70 75 80

Asp Ser Asp Gly Leu Ser Ala Thr Cys Asp Ala Ser Arg Asp Leu Val

85 90 95

Gln Arg Arg Phe Leu Leu Gln Met Ala Lys Val Gln Ala Gln Ile Ala

100 105 110

Asp Ala Ala Val Thr Val Gln Gly Asp Gly Ala Gln Gly Lys Val Thr

115 120 125

Leu Ser Leu Glu Asp Phe Cys Tyr Arg Pro Ile Arg Gly Lys Gly Cys

130135 140

Leu Val Thr Ser Pro Phe Gln Tyr Trp Leu Gly Asn Ala Ser Leu Leu

145 150 155 160

Glu Gly Asp Pro Asp Ile Lys Leu Thr Thr Ala Cys Gln Thr Thr Asp

165 170 175

Pro Gln Leu Gln Glu Arg Ala Pro Cys Met Asp Gln Asn Gly Val Pro

180 185 190

Val Met Arg Asp Val Val Phe Gly Gly Leu Ser Arg Asp Asp Cys His

195 200 205

Gln Asn Pro Asp Pro Cys Gly Glu Ala Thr Pro Gln Ala Gln Ala Leu

210 215 220

Val Val Thr Phe Leu Leu Asn Asn Arg Pro Glu Asn Glu Thr Tyr Thr

225 230 235 240

Arg Tyr Val Glu Gln Trp Glu Gln Gln Ala Phe Leu Lys Ile Ala Ala

245 250 255

Gln Ala Ala Glu Ala Leu Lys Pro Ser Ser Thr Ala Asn Lys Ser Asp

260 265 270

Glu Phe Ile Trp Asp Ser Val Gln Asp Gln Glu Leu Ala Asp Val Gly

275 280 285

Val Asp Gly Met Arg Leu Ser Tyr Met Ala Glu Arg Ser Val Ala Asp

290295 300

Ser Leu Val Val Gln Thr Asn Gln Asn Ala Phe Ile Val Val Val Ser

305 310 315 320

Tyr Leu Val Met Phe Leu Tyr Val Ser Ala Ser Leu Gly Lys Phe Thr

325 330 335

Asp Pro Val Arg Ser Arg Phe Gly Leu Gly Leu Thr Gly Ile Leu Ile

340 345 350

Val Leu Leu Ser Leu Gly Ala Ala Met Gly Val Ser Cys Ala Ile Leu

355 360 365

Gln Met Glu Val Thr Met Ile Thr Leu Glu Val Val Pro Phe Leu Val

370 375 380

Leu Ala Ile Gly Val Asp Asn Met Phe Ile Leu Thr Asn Glu Phe Asp

385 390 395 400

Arg Leu Ala Ala Leu Arg Gly Leu Ala Thr Leu Asp Thr Arg Arg Asn

405 410 415

Thr Arg Asp Arg Ala Glu Asp Glu Leu Leu Met Leu Lys Gln Val Leu

420 425 430

Gly Glu Thr Met Val Asn Val Gly Pro Ser Ile Val Val Ala Ala Val

435 440 445

Ala Glu Thr Leu Ala Phe Leu Val Gly Ala Leu Thr Arg Ile Pro Ala

450 455460

Leu Thr Ser Phe Cys Val Val Ala Ala Leu Ala Val Ala Ala Asp Phe

465 470 475 480

Ala Leu Gln Met Thr Trp Phe Ala Ser Ala Leu Val Leu Asp Ala Arg

485 490 495

Arg Val Arg Ala Arg Arg Tyr Asp Leu Phe Pro Trp Met Lys Gln Lys

500 505 510

Leu Thr Leu Thr Pro Pro Thr Lys Gly Lys Arg Arg Ile Glu Ser Lys

515 520 525

Ile His Tyr Gln Tyr Asp Leu Leu Val Asp Glu Ser Glu Arg Ser Asp

530 535 540

Glu Pro Ala Ala Arg Val Ser Ser Thr Gly Thr Leu Gln Arg Phe Val

545 550 555 560

Glu Lys Thr Tyr Ile Pro Phe Leu Leu Arg Arg Ser Thr Lys Val Leu

565 570 575

Val Leu Val Thr Ala Leu Ser Val Val Thr Leu Ser Ala Phe Gly Ser

580 585 590

Ser Glu Leu Pro Leu Gly Leu Glu Gln Glu Leu Ala Val Pro Thr Asp

595 600 605

Phe Tyr Leu His Glu Tyr Phe Lys Lys Gln Thr Ala Leu Gly Glu Ala

610 615620

Gly Pro Pro Ala Tyr Val Val Leu Asp Ser Asp Val Asp Tyr Thr Asp

625 630 635 640

Ala Arg Leu Gln Gln Asp Val Asn Val Leu Leu Asp Gln Leu Ser Gly

645 650 655

Leu Arg Gln Tyr Ile Gln Leu Pro Val Cys Ser Trp Leu His Thr Phe

660 665 670

Asn Gln Trp Arg Gln Met Arg Phe Phe Leu Gln Asp Lys Ile Lys Gln

675 680 685

Gly Gln Cys Asp Cys Pro Val Gln Pro Met Asp Pro Phe Pro Tyr Glu

690 695 700

Leu Ala Asn Val Gly Val Glu Asp Pro Ser Gly Asp Val Asp Leu Phe

705 710 715 720

Leu Ala Pro Glu Tyr Gly Tyr Gly Ala Leu Ala Thr Ala His Val Thr

725 730 735

Pro Asn Ala Leu Phe Tyr Pro Leu Val Lys Asn Phe Thr Lys Ile Ser

740 745 750

Ile Asp Ser Thr Cys Cys Gln His Phe Gly Leu Cys Gly Ala Gln Tyr

755 760 765

Glu Gly Asp Ile Ile Phe Asn Glu Pro Asn Ala Gly Asp Asp Asp Ser

770 775 780

Thr Gly Met Ser Ile Val Gly Ser Arg Ile Arg Phe Gln Leu Asn Ala

785 790 795 800

Leu Arg Asn Gln Ser Met Phe Val Asn Ser Tyr Tyr Tyr Leu His Asp

805 810 815

Val Val Gly Arg Trp Ser Ile Asp His Ala Ala Thr Ala Phe Pro Tyr

820 825 830

Ala Leu Val Phe Val Tyr Glu Glu Gln Tyr Thr Tyr Ile Gln Gly Val

835 840 845

Ala Leu Gln Ser Val Leu Leu Ala Leu Ala Val Val Phe Gly Ala Leu

850 855 860

Phe Val Leu Met Asp Gly Ser Leu Arg Leu Thr Thr Val Val Thr Leu

865 870 875 880

Cys Val Leu Ser Met Thr Phe Ser Gln Leu Gly Phe Leu Phe Val Trp

885 890 895

Asn Met Ile Ala Gly Pro Gly Ala Glu Thr Ser Ile Asn Ala Val Ser

900 905 910

Val Val Asn Leu Leu Ala Cys Val Gly Leu Gly Val Glu Phe Cys Val

915 920 925

His Thr Ala His Gln Phe Ala Phe Ser Arg Arg His His Leu Gly Thr

930 935 940

Thr Ala Asn Asp His Thr Arg Tyr Ala Leu Ser Ser Val Gly Ala Ser

945 950 955 960

Ile Phe Ser Gly Ile Thr Leu Thr Lys Phe Cys Gly Ile Gly Val Leu

965 970 975

Ala Phe Ala Pro Ser Met Leu Phe Arg Val Tyr Phe Phe Arg Met Tyr

980 985 990

Leu Gly Ile Val Val Leu Gly Cys Phe His Gly Leu Val Leu Leu Pro

995 1000 1005

Val Leu Leu Ser Leu Ile Gly Gln Pro Gln Lys Tyr Pro Asn Asp Leu

1010 1015 1020

Ser Ser Phe Leu Leu Ser Glu Glu Arg Asp Asp Glu Leu Glu Asp Glu

1025 1030 1035 1040

Val Arg Ala Phe Lys

1045

<210>8

<211>1486

<212>PRT

<213> Phytophthora sojae (Phytophthora sojae)

<400>8

Met Arg Val Ser Ala Leu Ala Ser Leu Leu Leu Pro Leu Gly Val Ala

1 5 10 15

Arg Ala Ala Ser Ser Ser Gly Ser Thr Thr Ser Thr Ala Thr Thr Thr

2025 30

Thr Thr Gly Thr Ser Ser Val Ser Ser Tyr Val Pro Trp Thr Leu Ala

35 40 45

Asp Asn Ala Thr Asn Leu Ala Asp Ile Lys Ala Gln Leu Thr Met Cys

50 55 60

Thr Tyr Ser Lys Val Glu Glu Cys Ile Gln Asp Pro Ala Leu Val His

65 70 75 80

Glu Leu Gly Ala Leu Val Arg Ala Pro Gly His Cys Val Ala Phe Asp

85 90 95

Ser Ser Tyr Val Asn Val Thr Thr Ala Gly Val Ala Ile Pro Asn Arg

100 105 110

Tyr Tyr Pro Thr Ser Val Glu Asp Ala Tyr Asp Ala Gly Phe Ser Asn

115 120 125

Lys Phe Ser Glu Trp Ser Asp Thr Asn Arg Glu Gln Phe Glu Val Asp

130 135 140

Cys Pro Leu Leu Tyr Asn Glu Thr Ile Ala Gln Gly Asp Asp Met Leu

145 150 155 160

Cys Cys Thr Glu Asn Gln Tyr Thr Gly Leu Ser Thr Gln Val Arg Met

165 170 175

Ile Pro Gly Leu Cys Ser Ala Cys Lys Glu Asn Leu Arg Asn Ile Phe

180 185190

Cys Gln Met Thr Cys Ser Pro Asn Asn Ser Met Phe Leu Asp Val Asn

195 200 205

Glu Val Arg Ile Met Pro Gly Asp Asp Glu His Pro Asp Ala Val Phe

210 215 220

Pro Ala Val Glu Glu Val Thr Tyr Tyr Val Gly Ser Asp Trp Ile Arg

225 230 235 240

Asp Ile Tyr Asp Phe Cys Glu Ala Asp Ser Ser Phe Ser Leu Leu Cys

245 250 255

Asn Pro Asn Gln Asp Cys His Asp Gly Tyr Gly Leu Leu Glu Tyr Met

260 265 270

Gly Lys Tyr Ala Phe Asn Ser Ile Gly Ser Pro Leu Gln Ile Asn Val

275 280 285

Thr Thr Met Asp Lys Val Pro Glu Ile Asn Gln Met Thr Glu Phe Cys

290 295 300

His Cys Asp Asn Val Asn Ala Thr Asn Cys Ile Leu Pro Gln Asn Ser

305 310 315 320

Arg Met Thr Ser Cys Val Gly Thr Cys Gly Ser Leu Cys Ala Val Ser

325 330 335

Ser Ser Asp Asp Arg Thr Tyr Thr Glu Ser Cys Tyr Gly Ala Ser Asn

340 345350

Ala Val Ala Thr Ser Ser Ser Ala Ser Gly Ser Val Gly Ser Gly Ser

355 360 365

Asp Asp Ser Thr Trp Ala Glu Leu Asn Ala Tyr Leu Ala Ser Asn Ile

370 375 380

Pro Val Thr Asp Trp Thr Gly Leu Asn Tyr Phe Leu Val Ile Phe Gly

385 390 395 400

Gly Ala Val Ala Leu Leu Leu Ile Val Gly Phe Ile Val Ala Gly Cys

405 410 415

Arg Glu Arg Arg Ala Arg Ile Pro Asn Pro His Thr Gly Thr Pro His

420 425 430

Ile Gly Pro Tyr Thr Pro Glu Ala His Gly Val Ala His Ala Met Glu

435 440 445

Thr Ser Asn Thr Arg Leu Ser Tyr Leu Asp Glu Leu Met Thr Asn Lys

450 455 460

Leu Arg Thr Trp Ala Val Phe Val Ser Thr Gly Asn Arg Pro Lys Lys

465 470 475 480

Met Ile Pro Met Val Leu Cys Val Val Ala Val Cys Val Val Gly Leu

485 490 495

Tyr Asn Ile Asp Ile Glu Thr Asp Pro Ile Lys Leu Trp Val Ser Ser

500 505510

Ser Ser Thr Ser Tyr Gln Gln Arg Gln His Tyr Gly Glu Ile Phe Asn

515 520 525

Pro Phe Tyr Arg Ser Glu Gln Val Ile Met Val Pro Lys Asp Gly Gly

530 535 540

Asn Ile Tyr Arg Ser Ser Ile Ile Lys Glu Ala Ile Arg Val Gln Thr

545 550 555 560

Val Ala Ala Asn Val Thr Tyr Thr Ser Asp Asp Gly Asp Glu Thr Ile

565 570 575

Thr Leu Asp Asp Ile Cys Trp Lys Ala Thr Gly Thr Gly Cys Thr Val

580 585 590

Asn Ser Ile Thr Gln Tyr Phe Gln Asn Asn Met Glu His Phe Glu Phe

595 600 605

Tyr Glu Lys Tyr Gly Leu Glu Met Glu His Phe Ser Asn Cys Leu Tyr

610 615 620

Ser Pro Thr Thr Ser Asp Val Ala Leu Cys Thr Glu Leu Lys Asn Ala

625 630 635 640

Leu Glu Asp Gly Asp Ser Leu Pro Ser Ser Met Ser Asp Cys Pro Cys

645 650 655

Leu Ser Ala Phe Gly Ser Pro Met Asn Leu Tyr Asn Thr Tyr Leu Gly

660 665 670

Gly Phe Pro Asp Gly Ala Glu Ser Asn Tyr Thr Leu Phe Leu Asp Ser

675 680 685

Val Ala Phe Val Ser Ser Tyr Leu Asn Tyr Asn Tyr Ala Asp Asp Asp

690 695 700

Lys Asn Glu Pro Ala Ile Lys Trp Glu Arg Glu Tyr Ile Lys Thr Met

705 710 715 720

Lys Glu Glu Ala Ala Ser Asn Thr Ile Phe Asp Val Tyr Phe Tyr Ala

725 730 735

Glu Ile Ser Val Asn Asp Glu Ile Asp Ala Glu Ser Ser Asn Gly Met

740 745 750

Gly Pro Val Ala Leu Ser Tyr Cys Leu Met Ile Ile Tyr Ile Ser Leu

755 760 765

Gly Ile Asn Arg Ile Lys Phe Ser Arg Glu Phe Phe Ile Ser Ser Lys

770 775 780

Ile Val Ala Gly Phe Cys Gly Val Met Ser Ile Val Cys Gly Val Ala

785 790 795 800

Ser Thr Ile Gly Ile Tyr Met Trp Ala Gly Val Lys Leu Gln Leu Ile

805 810 815

Ile Met Glu Val Val Pro Phe Leu Ser Leu Ala Ile Gly Val Asp Asn

820 825 830

Ile Phe Leu Ile Ile His Ala Met Thr Glu Lys Glu Asp Gln Met Arg

835 840 845

Arg Glu Gln Pro Ser Leu Phe Ile Gly Leu Glu His Asn Pro Thr Ala

850 855 860

Ile Glu Glu Ile Thr Thr Thr Ile Leu Ser Glu Ser Leu Ala Tyr Ile

865 870 875 880

Gly Pro Ser Ile Phe Met Ala Ser Ala Ala Glu Ser Val Ala Phe Ala

885 890 895

Phe Gly Ser Ile Ser Pro Met Pro Val Val Leu Trp Phe Ala Ala Met

900 905 910

Ala Cys Cys Ala Val Ala Ile Asn Phe Cys Leu Gln Met Thr Leu Phe

915 920 925

Leu Ser Val Leu Thr Leu Asp Lys Arg Arg Glu Leu Ser Gly Lys Tyr

930 935 940

Asp Ile Ile Phe Lys Arg Ala Ser Tyr Val Arg Ser Gln Pro Pro Ala

945 950 955 960

Gly Gly Pro Glu Thr Gln Gln Thr Ala Gln Pro Leu Val Ser Leu Glu

965 970 975

Pro Lys Thr Pro Ala Pro Glu Asp Ala Arg Arg Ser Ile Thr Pro Glu

980 985 990

Asn Arg Thr Leu Thr Asp Val Leu Asp Tyr Cys Val Asp Val Tyr Ala

995 1000 1005

Ser Ile Leu Thr Tyr Lys Ile Val Lys Leu Val Val Leu Leu Val Phe

1010 1015 1020

Leu Phe Trp Thr Leu Trp Ser Ile Tyr Ser Met Glu Ser Leu Asp Gln

1025 1030 1035 1040

Gly Leu Pro Gln Lys Glu Ala Met Pro Ser Asp Ser Tyr Met Ile Glu

1045 1050 1055

Tyr Phe Asn Ala Leu Asp Val Tyr Leu Ala Thr Gly Val Pro Val Tyr

1060 1065 1070

Phe Ile Val Glu Thr Gly Tyr Gly Arg Asn Pro Asp Thr Trp Ser Leu

1075 1080 1085

Asn Asp Glu Ser Val Glu Thr Leu Phe Cys Lys Ser Lys Asp Ile Cys

1090 1095 1100

Gly Thr Tyr Ser Ile Pro Asn Ile Met Asn Ala Leu Ala Asn His Gly

1105 1110 1115 1120

Asp Lys Asn Val Thr His Ile Ser Pro Gly Thr Thr Tyr Ser Trp Met

1125 1130 1135

Asp Asp Phe Trp Gly Phe Val Asn Pro Asp Ser Glu Cys Cys Arg Val

1140 1145 1150

Asp Ser Glu Gly Ala Tyr Val Pro Ile Glu Thr Gly Asn Asp Thr Tyr

1155 1160 1165

Thr Thr Leu Arg Ala Asp Asp Asp Thr Cys Leu Ala Thr Ser Val Thr

1170 1175 1180

Ile Pro Pro Val Pro Glu Ala Gln Tyr Met Ser Leu Phe Ser Met Phe

1185 1190 1195 1200

Ala Thr Ala Ser Ala Gly Thr Ser Cys Ser Tyr Gly Gly Gly Ser Ile

1205 1210 1215

Tyr Arg Gly Gln Phe Ser Ile Asp Ser Glu Pro Ile Pro Thr Val Asn

1220 1225 1230

Ala Ser Thr Pro Ala Val Lys Ile Asn Ser Ser Gly Tyr Gly Asp Glu

1235 1240 1245

Ile Thr Ala Trp Ser Tyr Met Val Thr Gly Thr Ser Asn Pro Thr Gln

1250 1255 1260

Gln Arg Tyr Ile Asp Ser Tyr Lys Gln Asn Leu Ala Ala Ala Glu Trp

1265 1270 1275 1280

Ile Ser Glu Lys Thr Gly Val Asp Ile Trp Val Tyr Ser Leu Thr Tyr

1285 1290 1295

Val Tyr Phe Glu Gln Tyr Leu Thr Val Val Asp Asp Ala Tyr Lys Leu

1300 1305 1310

Ile Gly Leu Ala Leu Ala Ala Ile Phe Val Ile Thr Ala Leu Tyr Leu

1315 1320 1325

Gly Asn Val Phe Tyr Ser Leu Val Ile Ala Leu Thr Ala Thr Asn Ile

1330 1335 1340

Val Val Leu Val Leu Gly Leu Met Gln Pro Leu Asp Ile Met Leu Asn

1345 1350 1355 1360

Gly Leu Ser Ile Val Asn Leu Ile Ile Ala Ala Gly Ile Ala Val Glu

1365 1370 1375

Phe Cys Gly His Tyr Val Arg Phe Phe Ala Lys Ala Arg Gly Thr Gly

1380 1385 1390

Asp Glu Arg Ala Arg Asp Ala Leu Arg Gln Val Leu Thr Ser Val Val

1395 1400 1405

Phe Gly Ile Thr Ile Thr Lys Val Ile Gly Leu Ser Val Leu Thr Leu

1410 1415 1420

Ala Asp Ser Arg Val Phe Lys Lys Tyr Tyr Phe Arg Met Tyr Met Ile

1425 1430 1435 1440

Val Val Leu Cys Gly Val Leu Asn Gly Met Leu Leu Leu Pro Val Leu

1445 1450 1455

Leu Ser Thr Ile Thr Asp Val Lys Asp Phe Phe Leu Arg Arg Gly Ser

1460 1465 1470

Arg Lys Thr Asp Leu Pro Ser Ala Pro Val Thr Arg Val Glu

1475 1480 1485

<210>9

<211>717

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>9

atgggcaagg gcgaggaact gttcactggc gtggtcccaa tcctggtgga actggatggt 60

gatgtgaacg ggcacaagtt ctccgtcagc ggagagggtg aaggtgatgc cacctacgga 120

aagctcaccc tgaagttcat ctgcactacc ggaaagctcc ctgttccgtg gccaaccctc 180

gtcaccactt tcacctacgg tgttcagtgc ttctcccggt acccagatca catgaagcag 240

catgacttct tcaagagcgc catgcccgaa ggctacgtgc aagaaaggac tatcttcttc 300

aaggatgacg ggaactacaa gacacgtgcc gaagtcaagt tcgaaggtga taccctggtg 360

aaccgcatcg agctgaaagg catcgatttc aaggaagatg gaaacatcct cggacacaag 420

ctggagtaca actacaactc ccacaacgta tacatcatgg ccgacaagca gaagaacggc 480

atcaaggtga acttcaagat caggcacaac atcgaagatg gaagcgtgca actggcggac 540

cactaccagc agaacacgcc catcggcgat ggccctgtcc tgctgccgga caaccattac 600

ctgtccacgc aatctgccct ctccaaggac cccaacgaga agagggacca catggtcctg 660

ctggagttcg tgacggctgc tgggatcacg catggcatgg atgaactcta caagtga 717

<210>10

<211>678

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>10

atggcctcct ccgaggacgt catcaaggag ttcatgcgct tcaaggtgcg catggagggc 60

tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120

acccagaccg ccaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180

ctgtcccctc agttccagta cggctccaag gcctacgtga agcaccccgc cgacatcccc 240

gactacttga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300

gacggcggcg tggtgaccgt gacccaggac tcctccctgc aggacggcga gttcatctac 360

aaggtgaagc tgcgcggcac caacttcccc tccgacggcc ccgtaatgca gaagaagacc 420

atgggctggg aggcctccac cgagcggatg taccccgagg acggcgccct gaagggcgag 480

atcaagatga ggctgaagct gaaggacggc ggccactacg acgccgaggt caagaccacc 540

tacatggcca agaagcccgt gcagctgccc ggcgcctaca agaccgacat caagctggac 600

atcacctccc acaacgagga ctacaccatc gtggaacagt acgagcgcgc cgagggccgc 660

cactccaccg gcgcctaa 678

<210>11

<211>1000

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>11

gtcgtcgcga ggatacatcg acgtagacgt ctctgccgat ggtggagccg ctgagctcct 60

tgagctcctt cgctcgaagc cggcaccact ggtggtgtgc tgctggccgg cccgccgtcc 120

tggcggtgca gcaacgatga ctcagcgccg ccgcgcgtca aagtgaacaa gtccagacaa 180

gttcagtcga gctgaaggcg tcgccacgtc gagcggcttc gctttcggtg tgcgacaagc 240

gatgcccctc tcttcaaggg acaatgctgt ccctacagca aggggccggc acgctgtgcc 300

cctggagcag acgccgcagt tgatcccttc gcggcaacag caacagcgac tcgaacaggc 360

agctcggcga gctctcgctg cccgcgtctg ctccggatgg gagtgccgca cccactttgc 420

aggcccacgc tcgaccaggt tgattcaagc ccgcgacagc aagcccgaga tttgaggcgg 480

gagggaacag tagaccatgc tgcagcccaa cgccatgctg ccgtccttgt cgtccaaggc 540

gacagagctc acagtcaagt tgtcgccagg cttacttgcg atgagaagac ctccagcgcg 600

cgagcgagcg gaggctccgt gcagccaaga aggcggcggc agcgagcgag cagattcact 660

cgagcacgtc gatgtgcgtc tgtcgaccga cagactcgga agaggtgtcg caacggaccg 720

catactgagc ccaggtcact ttatggaaaa aaccatatgg atacgcgcat ctggtttcag 780

aggtttttac acagcctctc attacctgaa cgccaatgtc gataccgtcg tgctatacag 840

gcaatgtgtt gtcgaaggtg atggcccctc tccgtcgccc cgtcgctgca gtgatgaagt 900

gccactctgt cactatcctc ccccgcttta cgctttcgcc ttgcggctgc tatgacatca 960

tttcgatatc ggcgcccaga ggatcacagg accaggcgcc 1000

<210>12

<211>1000

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>12

tgggctggct ggctatccga ccgctcacta gcactcggta tgcatgtata tgaaccacaa 60

gacgacaaaa cacgagaaaa aagcgacgaa gacgctggag atgatcccga atgaacaaga 120

agcccatgtg tacacttctg ctatgggcaa gcagcaaaag gacaaacaaa agccggagat 180

tgcaacagcg catgaatgta ttttatattt tcatttcctg agggcttgcc cccccgtccc 240

ctttgcgtcc actgcttcga gtcggggttt cctgccttgg tcgcgaatgg cgagtatttc 300

ggccccggaa gctacaggta agtcctctcc aaaatagttg tgccagcacc acttcaacgt 360

tgtccccatt taggctgaag gagctggcgc tgctgcggtt gagcggtcga acaacctgaa 420

ggtgtccagg cgacggcgtg cttcctctcg cgaccatgag caacgcgcct acggcggggg 480

gcgccatgtc caacatgttc agtcctcgca gtacgaatgg gaacaaccgg tatcacctgg 540

ccagcggtgg agctcgtacg ccgcgtgtgt ttccgccaga tgtgcagagt atcccgctga 600

gtccgtcgcg gctcgagagc ccgatgtttc gagagcgggt gacggcgctg atgcagcaag 660

gcgacacgta cgcgaagcgg ctggacagcg agcgtcgtcg gtcccatgac ctggatctag 720

cgctgcgcac cctgcgagtc gagcacttcc aagcgcgcaa ggcgctgtgt gacgccacga 780

acgcccagct ctgcgctgct acgacagagc tgaagccgat tcggacgctc gagaaccgcc 840

tggacaaagt gctcacgcgc tacaacgagg tctgcaacgc gaacaaggcg ctgcgcgagc 900

agatccaggc cttgcgccgt gaaaaggtgc agcaggctgc agtgctcgac aagctcgagc 960

gggagactgc gcaggcccag gcggaggctg ctcaagtcgc 1000

<210>13

<211>1000

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>13

agggggcggc aaacgctgcg gcgcgggggc tgccgcattg cttcctgggc gttggcgacg 60

agttggcagc tccgagcaga cccacgaccc gaagcaccga ctggctgcgg acggctcggt 120

cggcgtcgtc ctccgcgtgg agactgtccg cgtccacgta gcgaggaaac agcagcggcc 180

ctgccgccgg cagctcgagg cgaggcgtcg gcattggcat gggcatgggc gcgaggaagc 240

gatatgtagc caaatgtatt tttaccttca acgaccatca ctctggtgga acatatggtg 300

agagctcatc cagcatacca ccacgaccta cactgtactt ggcccagctt gcctgcgtgt 360

atccgtcgcg tcgtcttggt gatcctcgcg tcttggcgat ccctgtgcct gcccccgctg 420

aagcggctgc acgcaccctg aatcccacga ccataatcat ctcgtctctc ggtatgacgc 480

ttggccttcc ttccaacgcc tcgagcgctg actcagcccc catgcaacaa ggcggatgcc 540

gcctccttcc tcgcgcgcgc atcgactcgt gtgggccaag ccgaccttcg gctggctgtc 600

agccctccgc cgccgtctcc tttcaccgtt aggtcaggag tgcctgttac ctaaccgtgt 660

ggtgcatttt gatccgggga ccgcgcaggc gcagccgagc gcggctgaag caggcccgac 720

taacggagcc attcggcact acggggccgc cagacgcgcg atgcagacgc acagcgacac 780

cctccaccat tgacaaggcc ggcgagtcga gcgtgaccca cggcggtcaa gccgacggca 840

acgccggcga tgccgagtgc cacccctgga tacatctgat ccgtctcaaa ctcgagcgcg 900

gggatccccg tgctccccta tgcgacctgc acctgcaccc ccactcctcc cgagctcctc 960

acttcccaat cgaccggcgc caggacaagt cgacaccctc 1000

<210>14

<211>1000

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>14

gtcagcctac tctgtcacca actgtgtgga gctttcaacg cgtcgagtgc gtaggtataa 60

acgagtatat aatcaatcaa gcacatcttc aaaatgcgcc tacatgtaca tgaatgaatg 120

cttcttgggt tgctggaagc cgcgtggagg ttgcaccgca acttcaacat gtacgaccat 180

cactctgcat tagatcatgt cgccgccacg ggcttctcct cctccttggc cccgttggca 240

gcctcctcca cgacggcgcg gccgatcggt tcgggcgccg tatccgtcgc ctcggcctgc 300

tgcagcacca cgagcgtgaa cctcaagtgc tgggcgatga tcatctcgtg catcttggtg 360

cgcagccgca gccactcgat ctcgctgtcg ttcgggtccg ggaagagctt ctgcaggtgt 420

ttcttggtgc gtccgtagag gctcaggacg tggtaggcgt gcatgatggc ctccttgtac 480

tcgaggttct cgtacttgac cacgatgccg tcgttgttca tgaggatgta ggacgagaag 540

ccgggcttgc tcttgagctg cttgatcacc tcctccacct cgttcggagc cgctgccgcc 600

atcgtatccc gccttgtctt gtcttggaga gagagaggaa cgcaaagtga tcaaggatcc 660

gtgcgactcg actcgaaccg acgcaaaacg gctggggtca acaggactct tcaactgctc 720

gagcgtcaag ccaagcatgg cccagggctc cggctcgtac tacgatgact acatgcgcag 780

caacgcgatg ctcaagcact gcggcgaaaa gaacgccaag aagctgctga cggaccggaa 840

cgcctacatt tccttcctcg aggtgcagct cgagcgcgtg tcggccgcgt gcttgaccac 900

gcaaaccttc gagcggcgtc tggcggagct cgagtgcgcc cagctcgcca acgaccagaa 960

ggtggggtcg ctctccaagg tcttccgact gaaccaggag 1000

<210>15

<211>1000

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>15

gcccagtccc gtcttcttgt acaggtggcc ggccttgcgc aggaaggagg aggacgacga 60

gccgttgccc gcggagctcg agagcgcggc ggcggccgat gacgccaatg gcgcaggcgg 120

cggcgactgc ggcgagttgt gcatcgtagc ggcggcgcca gcagtagcgg cttcttggct 180

ggtgcttggg tgggcgctgg gcagcgactt gcggactgat gagaagctcg ccatctttcg 240

cttgtcacgc agttacgcgg agggatcagg ccgggcccat actgggcgct agtgaaatgg 300

caaggacggg gcaggttgaa gcccagttct gcgtactgtg ggtgacctgg cgccgccagt 360

ttcacgcgcg atgcgcgcac gtcaagctcc cgctttgctt gacggcaacg tcctcgccga 420

tctgccttgg tctgccatgc tgacttgcat ccgcggcctt cgtgcattgc ggattcgtta 480

gtgtttctgc ccaggtggat gccagcggtt caacgccagc ttcggctcgg cacattggcg 540

ttggctgact cacttggcgc tggtggtgga gtccacgcca ccagcatttt gtcgctcgag 600

cagactgcgg cagcattgtc gatcgaatcc caccagattg ctggagctca atgccgctcg 660

tttgtccgtc gggtccgtcg ttcaactgac cccaagctct tctataggag ctataggtct 720

gcatttgaaa gcgttatcag agcacgtttg actaccatgg ttggctggcc aaggagcact 780

cgaagcatgt tggctagacg gccaaagtca tcgactttgt ggtactcgaa gtgaagacgc 840

acgaactcgt ctgctgcgtt ttcaagcagc acagacagcc ctcgtatcag ctcgcacttc 900

aaccactcac ttggtctttg taatgatccc tcgtctcgac gctcattggc caatagtccc 960

cattcagctt caatctcctt cctccctccc tctccgagcc 1000

<210>16

<211>1000

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>16

gtggtgctag gtgtcaacaa tacttctctg gcccacataa gaaacaacac ttcggttttc 60

tggacataac tatttacaaa aaaatcgttt ggcgactcgc cgaacactgc gcatttgctc 120

cgtttcacgc tatgatttaa aaaatctagc agcagaaaga aaagagaaac agccttttat 180

ctgaagtccg ttttaggcaa cattaggttt tttagcgagg tgccgtcaaa aattagcgat 240

attagaaaat aaaatatcac cgtaatcgcg agtgactgct ttacccttat gttcggttgt 300

cgatgttgta gcgcctgttg gagacgagtt agaagggcta cagttttgag ggttttctac 360

gcgattatct cgacatgcgc agacccattt attttggcca atagtaagct gaaacagttg 420

attataccca atcatatgtg acatgtggtc cacatcaaat tgaggtttaa tgccgaatgt 480

tgttacttaa gtgggccaga gaagtataaa ccagactgtg ctgaagtcac gtggttttca 540

attcgaggta gactcttact gttcgcaagt ctacgaattt gcgttgtcat agaaaatgat 600

ctcgcggatg agtggatgcc agcctaccac gcattcttgc gccagaactg ccaccattcc 660

ttggccagca atcccttttt gcgtcgccag agcgcagaga actccaaata ctcatggaag 720

cgcgggtcgt ctttcagttt ttagtcccag cgtagtcaag atggtaatcg ggttttcatc 780

ctccttgagc cactggcggt actttttgtt tttcgcgatc ttctccagct tcgcggggtc 840

cttggtgaac cggttcgtta gcttgatgat caaggtgaac gccctctcct cctcctcctc 900

cgcaatgccc gtgctgtcaa ctcgaagccg tctcttcctg gccaggctgt ccccatcggc 960

gagtccgtca aagtcagacg cggttacctt cgtcaatctc 1000

<210>17

<211>1000

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>17

ttaattagga cgtagtgggt atttacatga aaacaatgta tccattcata ttgataatga 60

tcgacttgga atggctattt aatcacgaca ggtacatttg taatgcgacg cttcagaagc 120

agctgtacca ctctgagtcc gtgttgccct tgatgttgcc cccgttgcac cgtgtatcct 180

tcttgcactt caggaagcag cttctcccgc gcgtccatct tggtgaaagc agactctgca 240

gagagtgcat tcacttggca tggtgcgact ctaagctgag ctgacggcgt taattttgct 300

gcgctttaat cgcggatgct tttggtacgc ttgctgtccg aggcactcgg agcaccgacg 360

gtatcaacac cacacggcaa tgccatcggt gcggccatcc ttacgaatct aaaatttaga 420

ttctaaatgc cccgacagga gtgccgcgcg agcatattcc gagtcgatgc agcctcgaac 480

cgaggtcctc ggtcaccgag tcggtgcggt tgctgtagga gagccgggtg tacagtatcc 540

gctcgaccag caggatggcc tcgttttcgc tggcgccgac ctgattcgtt cgtctgcggt 600

gatggaggtc tgccggccag cgtcgtgagt aacccagcgc gagaccagcc gcccgcacca 660

agacgccgct catcggggca gacgcccgag gtgatcacta tgtcggcggg ggatccatgc 720

atagccgcgc ccaggcgccg tcgcaggcgc agtatccgcg ctgcgcctct ggtcgagctc 780

ttgctgatcg acggtctctt taatccgcgc ttctggtcgc gggttcatgc agctccgcgc 840

cactctttcg ctcgctgctc ccgctgtccg aggtgtccgc ggtgcagtct cagcctcatt 900

tagaaatcta ccggcagtcg agcacgcgca gcgctagcgt ccgactgatt agggttggct 960

gcctccactg gttctcctcc cttccacaca tccccacatc 1000

<210>18

<211>1000

<212>DNA

<213> Phytophthora sojae (Phytophthora sojae)

<400>18

gccgacgtcc aagctgtgag caacttcgtg tatcctgcgt tgaagccaat ctgtacatat 60

gaggacgcca ccgatcccgt agccagcatc caagtcaagc ccggacgagt gcgatggagc 120

aatagagaag tgtgcgcgtg actacttcgt actactagta gtagtaagta gtacccagtc 180

gttaagtaaa taaaataggg accccctgtc ttccttctta ctctttgtgc tttggactcg 240

gcttggttgg cgacttcaag gcggtgtttg cctttgctgt tgaggtgagc ctgcatgacc 300

ctctcaatga gagtatcacg ccaacgttgt gagaggttga aagggctttt cacatggagt 360

ctggcagcag taagcttagc caattcaggg aactctgcag ccagggtatc aaactcccca 420

gctaggaagg cagccgacaa ctggccgatg gctcggagcg cgtggaagtg gtcgatcttg 480

ccggcggact tcagtagccg gttgagcgtt ggtgaaaaca cggggatgtc cgagaagttg 540

ttgtgccgag tgccgcggag ccacgtaagg cgcgactgct cgtgcgtaca ccccctcgca 600

tggcgctcag tgctctccgc attggggcgc cagtggagga agtgctccga catcaagtgg 660

agcgcaggaa cacgcgagcc gaggccgtcg cgcacatctg catccagggg ctccatccag 720

gcgtcgagca gtaccatctt cttgaaccgc gcgtcttggt gagcagcgct gagtgccgtc 780

gccgcaccga acgagtgtcc agcaacgctc acgttggcga ggttgcagtg gccgaagacg 840

ctgcccgatg cggcggcatc ttgcttgatg gcgtccagaa ctgcgcgcac ttcgctcaca 900

cgctgctgca gttgtccatt gcggaagcgg aagcctgctc cgtcgacgtc gtcccgaacc 960

tccggcgtga tctgctggta gtaatcgatg cggccagcct 1000

Claims (10)

1. A Phytophthora sojae (Phytophthora sojae) NCR protein is the following protein A1) or A2) or A3) or A4):

A1) the amino acid sequence is a protein shown as any one of SEQ ID NO. 6-8;

A2) a fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in any one of SEQ ID NO. 6-8;

A3) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in any one of SEQ ID NO.6-8, has the same function and is derived from the protein shown in any one of SEQ ID NO. 6-8;

A4) an amino acid sequence which has similarity of more than 75%, preferably more than 85%, more preferably more than 95% with the amino acid sequence shown in any one of SEQ ID NO.6-8 and has the same function with the amino acid sequence shown in SEQ ID NO. 6-8.

2. A gene encoding the NCR protein according to claim 1; preferably, the coding gene is B1) or B2) or B3) as follows:

B1) a DNA molecule shown by a nucleotide sequence in any one of SEQ ID NO.2-4 in a sequence table;

B2) a cDNA molecule or DNA molecule having 75% or more, 85% or more, or 95% or more identity to the nucleotide sequence represented by B1) and encoding the NCR protein according to claim 1;

B3) a cDNA molecule or a DNA molecule which hybridizes under stringent conditions with a nucleotide sequence defined in B1) or B2) and encodes the NCR protein as claimed in claim 1.

3. An RNA molecule transcribed from the coding gene of claim 2;

preferably, the sequence of the RNA molecule is C1) or C2) as follows:

C1) an RNA sequence which has similarity of more than 75%, more preferably more than 85%, and even more preferably more than 95% of the RNA sequence transcribed from the DNA sequence shown in SEQ ID NO.2-4 and has the same function as the RNA sequence transcribed from the DNA sequence shown in SEQ ID NO. 2-4;

C2) an RNA sequence transcribed from the DNA sequence shown in any one of SEQ ID NO. 2-4.

4. The biological material containing the nucleic acid molecule related to the coding gene of claim 2 or the RNA molecule of claim 3, which is any one of the following D1) to D10):

D1) an expression cassette comprising the encoding gene of claim 2;

D2) a recombinant vector comprising the gene encoding the gene of claim 2, or a recombinant vector comprising the expression cassette of D1);

D3) a recombinant microorganism containing the gene encoding the gene of claim 2, or a recombinant microorganism containing D1) the expression cassette, or a recombinant microorganism containing D2) the recombinant vector;

D4) a transgenic plant cell line comprising the gene encoding the gene of claim 2, or a transgenic plant cell line comprising the expression cassette of D1);

D5) transgenic plant tissue comprising the gene encoding the gene of claim 2, or transgenic plant tissue comprising the expression cassette of D2);

D6) a transgenic plant organ containing the gene encoding the gene of claim 2, or a transgenic plant organ containing the expression cassette of D2);

D7) a nucleic acid molecule that inhibits the expression of the encoding gene of claim 2;

D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line comprising the nucleic acid molecule of D7);

D9) a nucleic acid molecule that inhibits translation of the RNA molecule of claim 3;

D10) producing an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line of D9) said nucleic acid molecule.

5. A group of phytophthora sojae NCR protein combinations or DNA combinations for use in a kit, which are E1) or E2) below:

E1) any two or more of the protein shown by SEQ ID NO.6 in the sequence table, the protein shown by SEQ ID NO.7 in the sequence table, the protein shown by SEQ ID NO.8 in the sequence table and the protein shown by SEQ ID NO.5 in the sequence table;

E2) the DNA molecule shown by SEQ ID NO.2 in the sequence table, the DNA molecule shown by SEQ ID NO.3 in the sequence table, the DNA molecule shown by SEQ ID NO.4 in the sequence table and the DNA molecule shown by SEQ ID NO.1 in the sequence table.

6. Use of the NCR protein of claim 1, the coding gene of claim 2 or the RNA molecule of claim 3 or the biological material of claim 4 or the combination of proteins or DNA of claim 5, characterized in that: the application is any one or more of the following 1) to 6):

1) the application in regulating and controlling the yield of phytophthora sojae zoospores and/or maintaining the form of the phytophthora sojae zoospores;

2) the application in regulating and controlling the growth rate of phytophthora sojae hyphae;

3) the application of the compound in regulating and controlling the host infection capacity of phytophthora sojae;

4) the method is applied to maintaining the normal morphological structure of the phytophthora sojae oospore;

5) the application of the phytophthora sojae in regulating and controlling the pathogenicity of the phytophthora sojae on hosts;

6) the application in inhibiting and/or killing phytophthora sojae;

preferably, the use comprises the use of 1) -6) by inhibiting or inactivating transcription of one or more arbitrary combinations of the coding genes according to claim 2, or inhibiting translation of one or more arbitrary combinations of the RNA molecules according to claim 3, or inhibiting activity of one or more arbitrary combinations of the NCR proteins according to claim 1, or inhibiting or inactivating transcription of a combination of NCR proteins or a combination of DNA according to claim 5, or inhibiting transcription of a combination of DNA according to claim 5.

7. Use of the NCR protein of claim 1, the coding gene of claim 2, the RNA molecule of claim 3, the biological material of claim 4, the protein combination of claim 5, or the DNA combination as a bacteriostatic or bactericidal agent target for screening phytophthora sojae bacteriostatic or bactericidal agents.

8. A method for screening or assisting in screening Phytophthora sojae bacteriostasis and/or bactericide, the method comprising applying an object to be detected to the Phytophthora sojae, wherein the object to be detected is the Phytophthora sojae bacteriostasis and/or bactericide when the object to be detected can inhibit transcription of one or more than two of the coding genes according to claim 2 in any combination, or inhibit translation of one or more than two of the RNA molecules according to claim 3 in any combination, or inhibit and/or inactivate activity of one or more than two of the NCR proteins according to claim 1 in any combination.

9. A method for reducing the activity of Phytophthora sojae comprising the steps of: inhibiting transcription or deleting any combination of one or more than two of the coding genes of claim 2, or inhibiting translation of any combination of one or more than two of the RNA molecules of claim 3, or inhibiting or inactivating activity of any combination of one or more than two of the NCR proteins of claim 1, or inhibiting or inactivating a combination of NCR proteins or a combination of DNA of claim 5;

wherein the activity of the phytophthora sojae is reduced by reducing the infection capacity and/or pathogenicity of the phytophthora sojae on a host, and/or reducing the hypha growth speed of the phytophthora sojae, and/or reducing the number and/or changing the form of zoospores of the phytophthora sojae, and/or deforming the oospore structure of the phytophthora sojae;

preferably, the method is any one of F1) -F7) as follows:

F1) inhibiting the expression of or inactivating the protein shown by SEQ ID NO.5 in the sequence table and the protein shown by SEQ ID NO.6 in the sequence table of Phytophthora sojae;

F2) inhibiting the expression of or inactivating the protein shown by SEQ ID NO.6 in the sequence table and/or the protein shown by SEQ ID NO.8 in the sequence table of Phytophthora sojae;

F3) inhibiting the expression of or inactivating the protein shown by SEQ ID NO.6 in the sequence table, the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table of Phytophthora sojae;

F4) inhibiting the expression of or inactivating the protein shown by SEQ ID NO.5 in the sequence table, the protein shown by SEQ ID NO.6 in the sequence table, the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table of Phytophthora sojae;

F5) inhibiting expression or inactivating one or more of a protein shown by SEQ ID NO.5 in a sequence table of Phytophthora sojae, a protein shown by SEQ ID NO.6 in the sequence table, a protein shown by SEQ ID NO.7 in the sequence table and a protein shown by SEQ ID NO.8 in the sequence table;

F6) inhibiting the expression of or inactivating the protein shown by SEQ ID NO.6 in the sequence table and the protein shown by SEQ ID NO.7 in the sequence table of Phytophthora sojae;

F7) inhibiting the expression of or inactivating the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table of Phytophthora sojae;

more preferably, in the step F1), the gene shown by SEQ ID No.1 in the sequence table and the gene shown by SEQ ID No.2 in the sequence table in the phytophthora sojae are subjected to gene knockout, so that the protein shown by SEQ ID No.5 in the sequence table and the protein shown by SEQ ID No.6 in the sequence table are inactivated;

in the step F2), the gene shown by SEQ ID NO.2 in the sequence table and/or the gene shown by SEQ ID NO.4 in the sequence table in the phytophthora sojae are knocked out, so that the protein shown by SEQ ID NO.6 in the sequence table and/or the protein shown by SEQ ID NO.8 in the sequence table are inactivated;

in the step F3), the gene shown by SEQ ID NO.2 in the sequence table, the gene shown by SEQ ID NO.3 in the sequence table and the gene shown by SEQ ID NO.4 in the sequence table in the phytophthora sojae are subjected to gene knockout so as to inactivate the protein shown by SEQ ID NO.6 in the sequence table, the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table;

in step F4), the gene shown by SEQ ID NO.1 in the sequence table, the gene shown by SEQ ID NO.2 in the sequence table, the gene shown by SEQ ID NO.3 in the sequence table and the gene shown by SEQ ID NO.4 in the sequence table in phytophthora sojae are subjected to gene knockout so as to inactivate the protein shown by SEQ ID NO.5 in the sequence table, the protein shown by SEQ ID NO.6 in the sequence table, the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table;

in the step F5), one or more than two of the gene shown by SEQ ID NO.1 in the sequence table, the gene shown by SEQ ID NO.2 in the sequence table, the gene shown by SEQ ID NO.3 in the sequence table and the gene shown by SEQ ID NO.4 in the sequence table in the phytophthora sojae are knocked out so as to inactivate one or more than two of the protein shown by SEQ ID NO.5 in the sequence table, the protein shown by SEQ ID NO.6 in the sequence table, the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table;

in the step F6), performing gene knockout on a gene shown by SEQ ID NO.2 in a sequence table and a gene shown by SEQ ID NO.3 in the sequence table in the phytophthora sojae to inactivate a protein shown by SEQ ID NO.6 in the sequence table and a protein shown by SEQ ID NO.7 in the sequence table;

in the step F7), the gene shown by SEQ ID NO.3 in the sequence table and the gene shown by SEQ ID NO.4 in the sequence table in Phytophthora sojae are subjected to gene knockout, so that the protein shown by SEQ ID NO.7 in the sequence table and the protein shown by SEQ ID NO.8 in the sequence table are inactivated.

10. Use of a substance inhibiting the expression and/or activity of the NCR protein of claim 1 in the preparation of a phytophthora sojae fungicide; preferably, the substance inhibiting the expression and/or activity of the NCR protein is a substance inhibiting the expression of the NCR protein and/or inhibiting the transcription of a gene encoding the NCR protein and/or inhibiting the translation of an RNA molecule obtained by the transcription of a gene encoding the NCR protein.

Images