CN111781343A - Method for detecting influence of DNA methylation modification on combination of transcription factor and DNA sequence - Google Patents
Method for detecting influence of DNA methylation modification on combination of transcription factor and DNA sequence Download PDFInfo
- Publication number
- CN111781343A CN111781343A CN202010690993.5A CN202010690993A CN111781343A CN 111781343 A CN111781343 A CN 111781343A CN 202010690993 A CN202010690993 A CN 202010690993A CN 111781343 A CN111781343 A CN 111781343A
- Authority
- CN
- China
- Prior art keywords
- dna
- protein
- binding
- transcription factor
- methylation modification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Tropical Medicine & Parasitology (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting the influence of DNA methylation modification on the combination of a transcription factor and a DNA sequence, and relates to the technical field of molecular biology. The method can eliminate the influence of hybrid protein on the binding reaction, reduce the false positive of the experiment, and can quickly and accurately detect the influence of DNA methylation modification on the binding of the transcription factor. Taking the effect of DNA methylation modification of the promoter region of the poplar OM47 gene on the binding of the BPC2 transcription factor as an example, the DNA sequence of the OM47 gene promoter region which is not modified by DNA methylation has an obvious binding band with the BPC2 protein, and gradually becomes shallow along with the increase of the competition concentration of the cold probe, while the promoter sequence modified by DNA methylation and the BPC2 protein do not have an obvious binding band, which proves that the DNA methylation modification of the promoter region can inhibit the binding efficiency with the transcription factor protein.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a method for detecting the influence of DNA methylation modification on the combination of a transcription factor and a DNA sequence.
Background
Transcription Factors (TF) are proteins which can be combined with a specific DNA sequence in a target gene promoter region, and directly activate or inhibit the transcription of a target gene, so that the expression mode and level of the target gene are finely regulated, and the TF plays an important role in the growth and development of organisms and the response to the external environment. DNA methylation is an important type of epigenetic modification, and genetic modification of gene function under the condition of no change of nucleic acid sequence and finally phenotypic variation are considered to be one of important forms for regulating gene expression of animals and plants. In higher eukaryotes, DNA methylation transfers the methyl group of S-adenosylmethionine (SAM) to the 5 th carbon atom of cytosine, primarily by DNA methyltransferase, forming 5-methylcytosine (m 5C). At present, a great deal of research shows that the DNA methylation modification of the gene promoter region can inhibit the effective combination with the transcription factor, and the DNA methylation modification is considered as a marker of gene silencing, particularly, the gene of which the promoter region is modified by high-level methylation is usually in an inactivated state, and the specific combination of the transcription factor and the combination site of the gene promoter region is a key factor for the regulation and control of gene transcription, so that the detection of the influence of the DNA methylation modification on the combination of the transcription factor is beneficial to further disclosing the DNA methylation modification and the functional molecular mechanism of the transcription factor for regulating and controlling the downstream gene. However, there is currently no rapid and efficient method to detect the effect of promoter region DNA methylation modification on transcription factor binding.
Disclosure of Invention
In view of the above, the present invention is directed to a method for detecting the effect of DNA methylation modification on the binding of a transcription factor to a DNA sequence, which can easily and effectively study the effect of DNA methylation modification on the binding of the transcription factor.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a method for detecting the influence of DNA methylation modification on the combination of a transcription factor and a DNA sequence, which comprises the following steps: (1) inducing the transcription factor to express the coding protein, and purifying and expressing the obtained protein to obtain purified protein;
(2) designing a specific DNA probe according to the binding site of the transcription factor, and carrying out methylation modification and biotin labeling on cytosine of the specific DNA probe to obtain a promoter DNA probe;
(3) allowing the purified protein and the promoter DNA probe to generate a binding reaction, and evaluating the influence of DNA methylation modification on the binding of transcription factors according to the strength of a binding band and the specific binding capacity of the detection protein-DNA;
no chronological sequence exists between the step (1) and the step (2).
Preferably, the step (1) uses a prokaryotic expression method to induce the transcription factor to express the coding protein.
Preferably, the step (1) is carried out by using a tag carried by the protein obtained by expression.
Preferably, the step (3) of performing the binding reaction further comprises: and setting a combination reaction system of the purified protein and the promoter DNA probe without DNA methylation modification, and setting a competition gradient of the cold probe, so as to detect the specific combination capability of the protein-DNA according to the strength of the combination band.
The invention provides a method for detecting that DNA methylation modification affects the combination of a transcription factor and a DNA sequence, which comprises the step of detecting the DNA methylation modification through a gel migration experiment so as to affect the combination of the transcription factor. The method comprises the steps of purifying the target protein, eliminating the influence of the hybrid protein on the binding reaction and reducing the false positive of the experiment; the method can rapidly and accurately detect the influence of DNA methylation modification on the combination of transcription factors by utilizing a method combining bioinformatics and molecular biology. In the embodiment of the invention, when the influence of DNA methylation modification of the promoter region of the poplar OM47 gene on the binding of the BPC2 transcription factor is detected, a DNA sequence of the OM47 gene promoter region, which is not modified by DNA methylation, has an obvious binding band with the BPC2 protein, and gradually becomes shallow along with the increase of the competition concentration of the cold probe, while a promoter sequence modified by DNA methylation and the BPC2 protein do not have an obvious binding band, which proves that the DNA methylation modification of the promoter region can inhibit the binding efficiency with the transcription factor protein.
Drawings
FIG. 1 is a schematic flow diagram of the process of the present invention;
FIG. 2 shows the effect of BPC2 protein purification, wherein lane M is 180kDa marker; CL is bacterial lysate (celllysate); FT is flow through; w1 and W5 are washes 1, 5(wash 1, 5); E1-E5 are eluents 1-5 (eluations 1-5), respectively;
FIG. 3 is a diagram of the result of EMSA methylation modification of OM47 gene promoter DNA, wherein m represents the methylation modified promoter sequence.
Detailed Description
The invention provides a method for detecting the influence of DNA methylation modification on the combination of a transcription factor and a DNA sequence, which comprises the following steps: (1) inducing the transcription factor to express the coding protein, and purifying and expressing the obtained protein to obtain purified protein;
(2) designing a specific DNA probe according to the binding site of the transcription factor, and carrying out methylation modification and biotin labeling on cytosine of the specific DNA probe to obtain a promoter DNA probe;
(3) allowing the purified protein and the promoter DNA probe to generate a binding reaction, and evaluating the influence of DNA methylation modification on the binding of transcription factors according to the strength of a binding band and the specific binding capacity of the detection protein-DNA;
no chronological sequence exists between the step (1) and the step (2).
The invention induces the transcription factor to express the coding protein, and purifies and expresses the obtained protein to obtain the purified protein. The invention preferably utilizes a prokaryotic expression method to induce the transcription factor to express the coding protein. The specific steps of the prokaryotic expression are not particularly limited, and preferably include: constructing a gene prokaryotic expression vector; transferring the constructed vector into BL21 escherichia coli; inducing protein expression with IPTG at a final concentration of 1 mM; detecting the expression of the target protein by non-denaturing polyacrylamide gel electrophoresis; collecting the thalli after induction expression, and extracting protein. The protein obtained by extraction is purified, preferably according to the label carried by the protein obtained by expression.
According to the invention, a specific DNA probe is designed according to the binding site of the transcription factor, and methylation modification and biotin labeling are carried out on cytosine of the specific DNA probe to obtain a promoter DNA probe. The invention preferably designs a specific DNA probe after determining the transcription factor binding site through bioinformatics, carries out methylation modification on cytosine carried by the DNA probe, and then labels biotin. The method for labeling the biotin is not particularly limited, and the biotin labeling of the probe is preferably performed by adopting a Biyuntian EMSA probe biotin labeling kit. The invention can facilitate the later detection of protein-DNA compound after the probe is labeled by biotin.
After the purified protein and the promoter DNA probe are obtained, the invention leads the purified protein and the promoter DNA probe to generate a binding reaction, and evaluates the influence of DNA methylation modification on the binding of transcription factors according to the strength of a binding strip and the specific binding capacity of the detection protein-DNA. The present invention preferably detects binding of the protein of interest to DNA based on the relative positions of the protein-DNA complex and the free probe band. The detection method of the binding product is not particularly limited, and preferably, a DNA probe is detected by adopting a chemiluminescence method, and in the embodiment of the invention, a Biyuntian chemiluminescence method EMSA kit is selected for detection. When the invention sets a binding reaction system by using the Biyuntian chemiluminescence EMSA kit, the invention preferably comprises the binding reaction systems which are respectively set with the target protein and the probe which is not subjected to DNA methylation modification and is subjected to DNA methylation modification, and sets the competition gradient of the cold probe, so that the invention more preferably comprises the following steps according to the strength of a binding strip and the specific binding capacity of the detection protein-DNA, namely the existence of the detection protein-DNA: the protein-DNA binding band is gradually shallow along with the increase of the competition concentration of the cold probe, and the promoter sequence modified by DNA methylation and the protein have no obvious binding band, so that the DNA methylation can obviously inhibit the binding of the transcription factor.
The following examples are provided to illustrate the method for detecting the influence of DNA methylation modification on transcription factors of the present invention, but they should not be construed as limiting the scope of the present invention.
Example 1
According to the scheme shown in FIG. 1, the influence of DNA methylation modification of promoter region of poplar OM47 gene on the binding of BPC2 transcription factor is detected
Step S1 is implemented, based on bisulfite sequencing technology and bioinformatics prediction, DNA methylation modification of the binding site of OM47 gene promoter region and BPC2 transcription factor protein is identified, and then induction of BPC2 protein is carried out: specific primers (Table 1) were designed based on the BPC2 gene sequence and the full length of the gene was cloned from cDNA template using NEW ENGLANDBIOLabs
The High-Fidelity PCR Kit set up a PCR reaction system (50. mu.l system, Table 2), and the PCR program was set up as follows: pre-denaturation at 98 ℃ for 30 s; denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 30s, and 30 cycles; extending for 7min at 72 ℃; storing at 4 ℃, and connecting between BamHI and SalI enzyme cutting sites of pGEX vector; transferring the connected vector into BL21 escherichia coli, and screening a positive monoclonal colony; the positive monoclonal colonies were inoculated into LB liquid medium containing ampicillin, and IPTG was added to a final concentration of 1mM, and incubated at 37 ℃ for 6 hours. Then, the cells were collected by centrifugation and disrupted by ultrasonication on ice. The bacterial lysate supernatant, i.e. containing the expression-inducing BPC2 protein, was collected by centrifugation.
Wherein: the promoter sequence of the populus tomentosa OM47 gene is shown as SEQ ID NO. 1: ATTTTATTTCCTTTTCTTATTAATATTTTTTTCTTACTTTTATGATTTTTTTCCTTTGTATTTCTAAAAAAATTAAAATTTAATGCAAGAAAGTAAATGTTTTAGAATTTCTTTTCTGTTAATGATAGAATGATAATTTTGAAATATATATATATATATATATATATATATATATATATATATATATATATATATATAACTGTATTAATGTCTTAGGGCCATGTCGCATCTCATTTTCTAAGACATCTTATAAACTAAGACGTTTTGTCCTTGTTTCTACAGCTAAATAATTTTTTATTTCAATTGTCTTTGTATATTTTATTTTAAAATATTAACCAAAAACTACATAATTATGATGGCACGTGTCCATCCTAAATTGCGCATGCCTACCTCCATAATAAATTTTATTATTTCTAAAGATGAATGATTTTATTATATTAAAATCCAGAGCAAAGAGTATTGTATAAATGTAAAATATATAATGATTTATTTGGTTTTTTGTTCTAGGATTTCTCTGATGAACTTTGTTTTATAAGTGTAAAATATTTTTTTTTCTATTACCATTATAATTTATTTAATAAAAATTGATCATGAAAAAAAACCATGCGGCTCTTCAACAAAATCCATCTTACAAAGATGAACATATATGGAAAATTAAAACTTTTCTAACATTACATCACATTTAACATAGAAAATTAAAAAATTTCTATTACCATTATAATGTAGGGTGTGTTTGGGATTCCCAAAAAAATTTATTTACCTAATGCAATAAAAAAAATAAAAGTTTTCTCTCTTTTGTTTCTTCTATTTTTTTAATTTAATTCTTTTTTCATTTTTTTTTAAAAATTATTTTTTACTTATATTTAAATCAATACCATTTCTCTCTTTTATTTTATTTATATATTTTCTTTTAAATGACAATTATTTTTTAGTTATTTCGTATGTATTTAATATTTGAAGAGATTTTTCCGATTCATCTATATTTTTTTATATATAGATGAACTTTATTTTTTAAAATAAAAAATATTTATTTTCATATAATATTTCTAATATATACAAACTTATGATATATTCTTTTTTTTTTTATTTTATTCAATCAATTTAATATGTTTCCTTTTTTTACTATCATTTGATTAAATAAATAAATCTAGCAAACACAACCGAATAAATATCTTCTATTGTGAGATAAAATATTTTATTCTATATTTACCTCTTATTTTTTCTATTTTTATTTTGTAGTTATCATTTATGATTTTTTTTATTTATTAACACATAGTTCTTGATTTATATGATTATATATATGCATAATTTTTTTATTTTCACTTTAAATTTTCTTAGCTACAAAAATCTTCTAAAAAACATTACATATATTTTTTATAAAAAAGGATTTGACATTGGTGAAATAATTAGTTCTATCAATTGATGATAAGAGTTTTCCATTGACATGTCTTTTTTATATAGATATAAACAGCCTTGAAATCGTTATGTAGAAAACAAAAATCGAAATGAACGAGGACAACAAGTAGCTAACAAGTGACCGCGCAAACTATAGGTTATAGATCCATAGACAAAAGAAAAAAGTGACAGGAGAGAATAACTTTATAACATGACATTAAAATTATGAAGAAAAGAAAAGAAAAGAAGAGAAAAAATCACTTTTTTAAAAATAAAGTATGAGTGCTTTTAAAAAAATATTTTTCAATTGAAAATATATCAATAATTCTTCTTCATTTTTTTTTATTTTTGACATAATAAAAACAACAAAACTATAAAAAAACAAATAAAGTAAAAAAAACACACACGCTCAAAGACAAGAAGTTACTTTCATGGCCACTATGGTAACGTGGTCGGGGGCCATAACTCCACAAGTTGGATTATTAATCGGCAAATCAAATTCATGGAACTTTATCTGTACTTTTTCCCCCCCAAGAAAACGTTAGACTTGCCCCACTGTGTTAATTAATTTTTTTATGTCCTCCAGTAACCGCACTTGTGGCTGC, respectively;
the sequence of the BPC2 transcription factor is shown in SEQ ID NO. 2: ATGGACGACGATGCATTGAACATGCGCAATTGGGGTTATTATGAACCGTCATACAAGGAGCCACTAGGTCTCCAGCTAATGCCAGCCATGGTAGACCGTGATTCGAAGCATCTCCTACCCAGGCGTGATCCGAATAACATCATGGTTGGTGCCACTGGAGCCTACCTTCCGCGTGAGTCTTTGGTTTCGGATGCCTCTATGCATATGAATTATATGAGGGATAGTTGGATAAACCGGGAGAAGTTTTTAAATATGCTACCCCCAAATCCTAGTTATGTTGTTCACCCTGAAACTTCTGGAGCTCAGTCCATGCCAATGTTACAGCCACCCGATTCATCAAGGGATGAGAGGGTGAGTAGGATGGAGGAGCCTAGTGTAAGTAAGGAAGGTAGCCAGTTGAAGAAAAGACAAGTTGGGGGTACCGCCCCCAAAACTCCCAAACCTAAGAAACCTAGAAAGCCAAAAGATGGTAACAACAATACAGTTCAGCGTGCGAAGCCAGCTAAGAAAAGTGTGGATGTTGTTATAAATGGGATTGATATGGACATTTCAGGTATCCCAATTCCGGTCTGCTCATGTACCGGAATTCCTCAGCAATGTTATCGATGGGGCTGTGGAGGATGGCAGTCTGCATGTTGCACCACAAATGTCTCGATGTATCCTCTGCCAATGAGTACCAAAAGACGCGGTGCAAGGATAGCTGGAAGGAAAATGAGTCAGGGTGCATTTAAGAAGGTACTGGAGAAGCTCGCGGCTGAAGGTTATAACTTTGCTAACCCAATTGATTTAAGGACTCACTGGGCAAGACATGGAACCAACAAGTTTGTCACTATCAGGTAG are provided.
TABLE 1 clone BPC2 Gene design primer sequences
| Primer name | Sequence (5 '-3') | SEQ ID NO. |
| BPC2-F | GGATCCATGGACGACGATGCATTGAACAT | 3 |
| BPC2-R | GTCGACCTACCTGATAGTGACAAACTTGTT | 4 |
TABLE 2 BPC2 Gene clone PCR System
| Reagent | Dosage (50. mu.l) |
| Phusion DNA Polymerase | 0.5μl |
| 5×Phusion HF or GC Buffer | 10μl |
| 10uM Forward Primer | 2.5μl |
| 10uM Reverse Primer | 2.5μl |
| 10mM dNTPs | 1μl |
| Template DNA | 20ng |
| DMSO(optional) | (1.5μl) |
| Nuclease-Free Water | To 50. mu.l |
Step S2 is performed using BeyogoldTMThe GST-tag Purification Resin kit is used for purifying BPC2 protein, after the Purification process is finished, the Purification effect can be further detected by non-denaturing polyacrylamide gel electrophoresis, and as shown in figure 2, EMSA binding reaction is carried out by using the protein obtained by three times of elution.
Step S3 is performed, a specific DNA probe is designed and synthesized according to the sequence of BPC2 transcription factor binding site of OM47 promoter region (table 3), and DNA methylation modification is performed on cytosine bases contained in the DNA probe (table 3), and then the DNA methylation modified probe and the DNA unmethylated modified probe are biotin-labeled respectively by using the pecan EMSA probe biotin labeling kit.
TABLE 3 DNA probes and sequences after methylation modification
And S4, performing EMSA binding reaction, respectively setting binding reaction systems of BPC2 purified protein, a probe which is not subjected to DNA methylation modification and a DNA methylation modified probe by using a Biyuntian chemiluminescence EMSA kit, setting competition gradients of 50 times and 70 times of a cold probe, adding the cold probe and other various reagents before adding the labeled probe, uniformly mixing, and allowing the cold probe to preferentially react for 30 min.
The step S5 is implemented, and the detection is carried out by using a Biyuntian chemiluminescence method EMSA kit, which mainly comprises the following steps:
the bound products were separated by native polyacrylamide gel electrophoresis. Pre-electrophoresing for 30min at 120V with 0.5 × TBE as electrophoresis buffer, loading, and electrophoresing at 10V/cm voltage until bromophenol blue is at 1/4 below the gel;
film transfer and crosslinking. Soaking a nylon membrane with a size similar to that of EMSA and four pieces of filter paper with the same size in 0.5 × TBE electrophoresis buffer for at least 10 min. And (3) carrying out ice bath film transfer for 2h, and immediately carrying out ultraviolet crosslinking after the film transfer is finished so as to crosslink the protein-DNA compound on the film.
And washing the membrane by using an EMSA kit of the Biyuntian chemiluminescence method. The kit is a detection kit for realizing chemiluminescence detection of an EMSA probe marked by Biotin through Streptavidin-HRP and a subsequent BeyoECL Star reagent; and (3) developing: the nylon film is placed between two preservative films or other appropriate transparent films and fixed in a pressing film cassette (also called a film clamp), and the film is pressed for 1-5 min by an X-ray film, and the observation result is immediately developed and fixed. Comparing the relative positions of the free probe and the protein-DNA complex band, as shown in FIG. 3, the DNA sequence of OM47 gene promoter region which is not modified by DNA methylation has obvious binding band with BPC2 protein, and gradually becomes shallower along with the increase of the competition concentration of the cold probe, while the promoter sequence modified by DNA methylation has no obvious binding band with BPC2 protein, thus proving that the DNA methylation modification of the promoter region can inhibit the binding efficiency with the transcription factor protein.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Beijing university of forestry
<120> a method for detecting the influence of DNA methylation modification on the binding of transcription factors and DNA sequences
<160>7
<170>SIPOSequenceListing 1.0
<210>1
<211>2000
<212>DNA
<213>Populus tomentosa
<400>1
attttatttc cttttcttat taatattttt ttcttacttt tatgattttt ttcctttgta 60
tttctaaaaa aattaaaatt taatgcaaga aagtaaatgt tttagaattt cttttctgtt 120
aatgatagaa tgataatttt gaaatatata tatatatata tatatatata tatatatata 180
tatatatata tatatataac tgtattaatg tcttagggcc atgtcgcatc tcattttcta 240
agacatctta taaactaaga cgttttgtcc ttgtttctac agctaaataa ttttttattt 300
caattgtctt tgtatatttt attttaaaat attaaccaaa aactacataa ttatgatggc 360
acgtgtccat cctaaattgc gcatgcctac ctccataata aattttatta tttctaaaga 420
tgaatgattt tattatatta aaatccagag caaagagtat tgtataaatg taaaatatat 480
aatgatttat ttggtttttt gttctaggat ttctctgatg aactttgttt tataagtgta 540
aaatattttt ttttctatta ccattataat ttatttaata aaaattgatc atgaaaaaaa 600
accatgcggc tcttcaacaa aatccatctt acaaagatga acatatatgg aaaattaaaa 660
cttttctaac attacatcac atttaacata gaaaattaaa aaatttctat taccattata 720
atgtagggtg tgtttgggat tcccaaaaaa atttatttac ctaatgcaat aaaaaaaata 780
aaagttttct ctcttttgtt tcttctattt ttttaattta attctttttt catttttttt 840
taaaaattat tttttactta tatttaaatc aataccattt ctctctttta ttttatttat 900
atattttctt ttaaatgaca attatttttt agttatttcg tatgtattta atatttgaag 960
agatttttcc gattcatcta tattttttta tatatagatg aactttattt tttaaaataa 1020
aaaatattta ttttcatata atatttctaa tatatacaaa cttatgatat attctttttt 1080
tttttatttt attcaatcaa tttaatatgt ttcctttttt tactatcatt tgattaaata 1140
aataaatcta gcaaacacaa ccgaataaat atcttctatt gtgagataaa atattttatt 1200
ctatatttac ctcttatttt ttctattttt attttgtagt tatcatttat gatttttttt 1260
atttattaac acatagttct tgatttatat gattatatat atgcataatt tttttatttt 1320
cactttaaat tttcttagct acaaaaatct tctaaaaaac attacatata ttttttataa 1380
aaaaggattt gacattggtg aaataattag ttctatcaat tgatgataag agttttccat 1440
tgacatgtct tttttatata gatataaaca gccttgaaat cgttatgtag aaaacaaaaa 1500
tcgaaatgaa cgaggacaac aagtagctaa caagtgaccg cgcaaactat aggttataga 1560
tccatagaca aaagaaaaaa gtgacaggag agaataactt tataacatga cattaaaatt 1620
atgaagaaaa gaaaagaaaa gaagagaaaa aatcactttt ttaaaaataa agtatgagtg 1680
cttttaaaaa aatatttttc aattgaaaat atatcaataa ttcttcttca ttttttttta 1740
tttttgacat aataaaaaca acaaaactat aaaaaaacaa ataaagtaaa aaaaacacac 1800
acgctcaaag acaagaagtt actttcatgg ccactatggt aacgtggtcg ggggccataa 1860
ctccacaagt tggattatta atcggcaaat caaattcatg gaactttatc tgtacttttt 1920
cccccccaag aaaacgttag acttgcccca ctgtgttaat taattttttt atgtcctcca 1980
gtaaccgcac ttgtggctgc 2000
<210>2
<211>840
<212>DNA
<213>Populus tomentosa
<400>2
atggacgacg atgcattgaa catgcgcaat tggggttatt atgaaccgtc atacaaggag 60
ccactaggtc tccagctaat gccagccatg gtagaccgtg attcgaagca tctcctaccc 120
aggcgtgatc cgaataacat catggttggt gccactggag cctaccttcc gcgtgagtct 180
ttggtttcgg atgcctctat gcatatgaat tatatgaggg atagttggat aaaccgggag 240
aagtttttaa atatgctacc cccaaatcct agttatgttg ttcaccctga aacttctgga 300
gctcagtcca tgccaatgtt acagccaccc gattcatcaa gggatgagag ggtgagtagg 360
atggaggagc ctagtgtaag taaggaaggt agccagttga agaaaagaca agttgggggt 420
accgccccca aaactcccaa acctaagaaa cctagaaagc caaaagatgg taacaacaat 480
acagttcagc gtgcgaagcc agctaagaaa agtgtggatg ttgttataaa tgggattgat 540
atggacattt caggtatccc aattccggtc tgctcatgta ccggaattcc tcagcaatgt 600
tatcgatggg gctgtggagg atggcagtct gcatgttgca ccacaaatgt ctcgatgtat 660
cctctgccaa tgagtaccaa aagacgcggt gcaaggatag ctggaaggaa aatgagtcag 720
ggtgcattta agaaggtact ggagaagctc gcggctgaag gttataactt tgctaaccca 780
attgatttaa ggactcactg ggcaagacat ggaaccaaca agtttgtcac tatcaggtag 840
<210>3
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ggatccatgg acgacgatgc attgaacat 29
<210>4
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gtcgacctac ctgatagtga caaacttgtt 30
<210>5
<211>41
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ataaaaaaaa taaaagtttt ctctcttttg tttcttctat t 41
<210>6
<211>41
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
tatttttttt attttcaaaa gagagaaaac aaagaagata a 41
<210>7
<211>44
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
ataaaaaaaa taaaagtttt mctmctmctt ttgtttcttc tatt 44
Claims (4)
1. A method for detecting the effect of a methylation modification of DNA on the binding of a transcription factor to a DNA sequence, comprising the steps of: (1) inducing the transcription factor to express the coding protein, and purifying and expressing the obtained protein to obtain purified protein;
(2) designing a specific DNA probe according to the binding site of the transcription factor, and carrying out methylation modification and biotin labeling on cytosine of the specific DNA probe to obtain a promoter DNA probe;
(3) allowing the purified protein and the promoter DNA probe to generate a binding reaction, and evaluating the influence of DNA methylation modification on the binding of transcription factors according to the strength of a binding band and the specific binding capacity of the detection protein-DNA;
no chronological sequence exists between the step (1) and the step (2).
2. The method of claim 1, wherein the transcription factor is induced to express the encoded protein in step (1) by prokaryotic expression.
3. The method of claim 1, wherein the step (1) comprises purifying the protein obtained by expression using a tag carried by the protein.
4. The method of claim 1, wherein step (3) further comprises, when performing the binding reaction: and setting a combination reaction system of the purified protein and the promoter DNA probe without DNA methylation modification, and setting a competition gradient of the cold probe, so as to detect the specific combination capability of the protein-DNA according to the strength of the combination band.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010690993.5A CN111781343B (en) | 2020-07-17 | 2020-07-17 | Method for detecting influence of DNA methylation modification on combination of transcription factor and DNA sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010690993.5A CN111781343B (en) | 2020-07-17 | 2020-07-17 | Method for detecting influence of DNA methylation modification on combination of transcription factor and DNA sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111781343A true CN111781343A (en) | 2020-10-16 |
| CN111781343B CN111781343B (en) | 2023-03-21 |
Family
ID=72764505
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010690993.5A Active CN111781343B (en) | 2020-07-17 | 2020-07-17 | Method for detecting influence of DNA methylation modification on combination of transcription factor and DNA sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111781343B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112708635A (en) * | 2020-12-30 | 2021-04-27 | 南通大学附属医院 | Method for regulating CPEB1 gene expression by combining transcription factor CEBPB with CPEB1 gene promoter region |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000014234A1 (en) * | 1998-09-08 | 2000-03-16 | Urocor, Inc. | Prostate specific promoter and regulation of gene expression |
| CN104069482A (en) * | 2013-03-27 | 2014-10-01 | 中国农业大学 | Applications of transcription factor CREB in JHDM2A gene expression regulation and pig lipid deposition reduction |
| WO2016063202A1 (en) * | 2014-10-24 | 2016-04-28 | Indiana University Research & Technology Corporation | The role of a cluster of long noncoding rna transcripts in protecting the heart from pathological hypertrophy |
| CN108351350A (en) * | 2015-08-25 | 2018-07-31 | 杜克大学 | The composition and method of type endonuclease improvement genome project specificity are instructed using RNA |
-
2020
- 2020-07-17 CN CN202010690993.5A patent/CN111781343B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000014234A1 (en) * | 1998-09-08 | 2000-03-16 | Urocor, Inc. | Prostate specific promoter and regulation of gene expression |
| CN104069482A (en) * | 2013-03-27 | 2014-10-01 | 中国农业大学 | Applications of transcription factor CREB in JHDM2A gene expression regulation and pig lipid deposition reduction |
| WO2016063202A1 (en) * | 2014-10-24 | 2016-04-28 | Indiana University Research & Technology Corporation | The role of a cluster of long noncoding rna transcripts in protecting the heart from pathological hypertrophy |
| CN108351350A (en) * | 2015-08-25 | 2018-07-31 | 杜克大学 | The composition and method of type endonuclease improvement genome project specificity are instructed using RNA |
Non-Patent Citations (5)
| Title |
|---|
| CEM KUSCU等: "Transcriptional and Epigenetic Regulation of KIAA1199 Gene Expression in Human Breast Cancer", 《PLOS ONE》 * |
| 娄桂予等: "HNF1α对人FXR启动子的调控作用", 《中国生物化学与分子生物学报》 * |
| 孙宇航等: "DNA与蛋白质的相互作用及其生物学研究方法", 《生命科学》 * |
| 王颖洁等: "小鼠DAZL基因启动子核心区域分析及甲基化对其启动活性的影响", 《安徽农业大学学报》 * |
| 钟焱等: "DNA甲基化在基因表达调控中的意义及研究进展", 《中国医药导报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112708635A (en) * | 2020-12-30 | 2021-04-27 | 南通大学附属医院 | Method for regulating CPEB1 gene expression by combining transcription factor CEBPB with CPEB1 gene promoter region |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111781343B (en) | 2023-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Diaz et al. | Tetrahymena metallothioneins fall into two discrete subfamilies | |
| Liu et al. | Genome-wide identification, comprehensive gene feature, evolution, and expression analysis of plant metal tolerance proteins in tobacco under heavy metal toxicity | |
| CN106866825B (en) | Silkworm internal reference protein GAPDH polyclonal antibody and preparation method thereof | |
| Piccinni et al. | Cadmium metallothionein gene of Tetrahymena pyriformis | |
| ZHOU et al. | The infectious bronchitis virus nucleocapsid protein binds RNA sequences in the 3′ terminus of the genome | |
| Vera et al. | Proteomic and genomic analysis of the phosphate starvation response of Acidithiobacillus ferrooxidans | |
| JP2008526197A (en) | Novel L-lysine-inducible promoter | |
| CN111781343B (en) | Method for detecting influence of DNA methylation modification on combination of transcription factor and DNA sequence | |
| Lee et al. | Screening of a novel strong promoter by RNA sequencing and its application to H 2 production in a hyperthermophilic archaeon | |
| Daga et al. | Identification of novel SNPs in the Sarda breed goats POU1F1 gene and their association with milk productive performance | |
| Deeba et al. | Molecular characterization of a MYB protein from Oryza sativa for its role in abiotic stress tolerance | |
| Ouhammouch | Transcriptional regulation in Archaea | |
| CN102021195B (en) | Method for efficiently preparing protein molecular weight standard by utilizing prokaryotic expression system | |
| Kashyap et al. | Nitric oxide modulates Lycopersicon esculentum C-repeat binding factor 1 (LeCBF1) transcriptionally as well as post-translationally by nitrosylation | |
| Takahashi et al. | Roles of CmpR, a LysR family transcriptional regulator, in acclimation of the cyanobacterium Synechococcus sp. strain PCC 7942 to low‐CO2 and high‐light conditions | |
| CN108588235B (en) | Genetic marker related to velvet production and velvet layer height of meridian-ridge black goats and application of genetic marker | |
| Toledo et al. | Characterization of an oxidative stress response regulator, homologous to Escherichia coli OxyR, from the phytopathogen Xylella fastidiosa | |
| La Teana et al. | Characterization of the structural genes for the DNA‐binding protein H‐NS in Enterobacteriaceae | |
| CA3079473A1 (en) | Single nucleotide polymorphisms and feeding efficiency in cattle | |
| CN106929520B (en) | Tomato spotted wilf virus gene and application thereof | |
| Ehlers et al. | Characterization of GlnK1 from Methanosarcina mazei strain Go1: complementation of an Escherichia coli glnK mutant strain by GlnK1 | |
| Couvillion et al. | Biochemical approaches including the design and use of strains expressing epitope-tagged proteins | |
| CN103739696B (en) | Cynoglossus semilaevis female specificity CSW3 protein as well as gene and application thereof | |
| Reddy et al. | Molecular cloning and differential expression of cytosolic class I small Hsp gene family in Pennisetum glaucum (L.) | |
| Gao et al. | Identification and functional characterization of three irf7 transcript variants in obscure puffer (Takifugu obscurus) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |