CN111778279A - HTLV-1 Env mediated cell-cell fusion model, preparation method and application - Google Patents

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to an HTLV-1 Env mediated cell-cell fusion model, a preparation method and application. In the application, an HTLV-1 Env gene fragment is obtained and replaces a vector pSRHS-Tat-Env_HIV‑1Transfecting an effector cell COS-1 with a gp145 fragment corresponding to the HIV-1 Env gene, and co-culturing with TZM-bl cells integrated with LTR and a firefly luciferase reporter gene connected downstream of the LTR in series in the genome; HTLV-1 Env-mediated cell-cell fusion capacity was indirectly measured by measuring the activity of firefly luciferase.The fusion system is verified by utilizing the inhibitory polypeptide P-400, which shows that the fusion system is very suitable for screening and verifying the entry inhibitor of the HTLV-1 virus and evaluating the indexes such as effective concentration, toxicity and the like of the entry inhibitor.

Description

HTLV-1 Env mediated cell-cell fusion model, preparation method and application

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to an HTLV-1 Env mediated cell-cell fusion model, a preparation method and application.

Background

Human T-lymphoblastic leukemia type 1 virus (HTLV-1), the first retrovirus demonstrated to be directly associated with human cancer as reported in 1980 by Robert-Gello research group, national cancer institute. Currently, the number of infected persons worldwide is more than ten million, and the infection can induce various diseases such as adult T cell leukemia (ATL) and HTLV-1 related myelopathy (HAM)/tropical spastic paraparesis (also called as spastic paraparesis, TSP). Despite the research of 40 years, until now there is no specific therapy and safe and long lasting effective vaccine formulation against HTLV-1 infection, which is an endemic disease that seriously threatens human health and puts a great pressure on the development of the global socioeconomic sector.

The entry inhibitor is an important anti-enveloped virus drug, blocks a central link of virus replication, namely invasion of target cells at the early stage of virus infection, can prevent viruses from infecting new host cells, reduces the virus load in blood plasma, has obvious superiority, is more and more concerned and emphasized by scientific researchers and drug developers, and has the potential of becoming an effective therapy for HTLV-1 virus infection. The screening and identification of new potent entry inhibitors are of great significance to human health and social development.

Viruses are microorganisms with extremely simple structures, do not have complete metabolic enzyme systems, and need to synthesize substances by host cells so as to complete the life cycle of the viruses. HTLV-1 is also an enveloped virus (also known as an enveloped virus) that first invades the host cell via membrane fusion to initiate a new life cycle and is therefore the primary link in the entire viral replication cycle. Enveloped viruses generally enter host cells by two means. In the first, envelope glycoproteins located on the surface of the virus bind to the receptor, inducing conformational changes that result in direct fusion of the viral envelope and host cell membrane at the cell surface. In the second, the virus invades the cell via an endocytic pathway, localizes to the endosomes, triggers a conformational change in the envelope glycoprotein in a pH and/or protease dependent manner, and thus triggers membrane fusion.

It has been found by researchers for a long time that, unlike human immunodeficiency virus type 1 (HIV-1), free HTLV-1 virions are paired with CD4⁺The infection efficiency of T lymphocytes is quite low, which applies to most HTLV-1 target cell types other than dendritic cells. Recent studies have found that free HTLV-1 virions can efficiently infect dendritic cells. Meanwhile, infected dendritic cells can rapidly and repeatedly transfer HTLV-1 to autologous CD4⁺T cells, causing CD4⁺Long-term prolific infection of T cells and results in interleukin-2-independent transformation of T cells. Dendritic cells, which are important antigen presenting cells, are considered to be the first cells encountered after invasion by various pathogens, and thus are likely to play a key role in the transmission of HTLV-1. Alais et al demonstrated by elaborate experiments that dendritic cells are more sensitive to infection by HTLV-1 than autologous lymphocytes and can efficiently transfer the virus to lymphocytes. Thus, dendritic cells, which are the first cells to be infected with HTLV-1 in vivo, are likely to represent a true viral pool.

Invasion of target cells such as dendritic cells by free HTLV-1 virus is mediated by the viral envelope glycoprotein envelope (env). HTLV-1 Env belongs to a type I transmembrane protein, is synthesized in a 488-amino acid precursor protein form in a rough endoplasmic reticulum, is folded and accompanied by oligomerization and initial glycosylation, is then transported to a Golgi apparatus, is cut by furin-like protease family to form mature surface glycoprotein gp46 and transmembrane glycoprotein gp21, and gp46 and gp21 are still non-covalently linked together to form heterodimers after being cut, and finally forms a trimeric spike consisting of three gp46 molecules and three gp21 molecules. Gp46 contains a receptor binding domain, which determines viral tropism and initiates viral infection; gp21 contains a trimerization domain, which dominates the trimerization of Env, and a membrane fusion domain, which mediates the membrane fusion process of virus and cells, completing virus invasion. Correspondingly, Env trimers located on the surface of target cells mediate fusion between target cells and receptor-expressing cells to form multicellular bodies. Furthermore, numerous studies have shown that Env is important for the formation of viral synapses of HTLV-1, and therefore Env plays a very important role in the cell-cell spread of HTLV-1 as well, and is associated with the ability to induce syncytial formation.

HTLV-1 Env plays a crucial role in the replication cycle, cell tropism and pathogenicity of the virus and is thus the most important and promising potential vaccine component and important antiviral drug target. An entry inhibitor against HTLV-1 Env can inhibit the entry of HTLV-1 virus into target cells, thereby inhibiting the spread of the virus in the initial stage of infection, and thus is one of the best ways to treat and prevent HTLV-1 infection at an early stage. The high-efficiency accurate invasion inhibitor screening model is necessary guarantee for obtaining medicines, at present, a plurality of cell-cell fusion models related to HIV-1 exist, and for HTLV-1, because the concerned degree is far less than that of HIV-1, the existing HTLV-1 envelope glycoprotein Env-mediated cell-cell fusion models have no high efficiency, convenience and quickness of HIV-1.

Disclosure of Invention

The invention provides an HTLV-1 Env mediated cell-cell fusion model, a preparation method and application aiming at solving part of problems in the prior art or at least alleviating part of problems in the prior art.

The invention is realized in such a way that a recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env_HTLV-1The construction method comprises the following steps:

plasmid pSRHS-Tat-Env_HIV-1CRF07Mutating the first amino acid residue (G713, according to the code of international standard strain HXB 2) behind the corresponding gp145 fragment in the HIV-1 Env into a stop codon to obtain a mutant;

replacement of the mutant with a full-length fragment of HTLV-1 EnvObtaining a gp145 fragment of the HIV-1 Env gene to obtain a recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env_HTLV-1。

After mutation is a stop codon, the protein expressed by the mutant is gp145, and the sequence is shown in SEQ ID NO. 1. Thereafter, the gp 145-expressing fragment of the mutant was removed, and the HTLV-1 Env-expressing fragment was ligated to a linearized vector from which the gp145 fragment was removed by inverse PCR, replacing the gp145 portion of the HIV-1 Env gene.

Furthermore, the G713 amino acid residue is mutated into a stop codon by using a rolling circle PCR technology, and the sequence of a point mutation primer related to the rolling circle PCR technology is shown in SEQ ID NO.2 and SEQ ID NO. 3.

Further, a linearized vector for removing the gp145 segment is obtained by using an inverse PCR technology, and primer sequences related to the inverse PCR technology are shown in SEQ ID NO.7 and SEQ ID NO. 8.

Further, a rolling circle PCR method point mutation reaction system:

the rolling circle PCR method point mutation reaction conditions are as follows:

further, the sequence of the HTLV-1 Env fragment is shown in SEQ ID NO. 4.

Further, a recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env was obtained_HTLV-1Then transformed into Top10 competent cells.

The recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env_HTLV-1The plasmid pSRHS-Tat-Env constructed by the construction method of (1)_HTLV-1。

Plasmid pSRHS-Tat-Env as described above_HTLV-1The application of the protein in an HTLV-1 Env mediated cell-cell fusion system.

Plasmid pSRHS-Tat-Env as described above_HTLV-1Use in screening and/or validation of entry inhibitors against HTLV-1 virusThe application is as follows.

An HTLV-1 Env mediated cell-cell fusion system comprising: effector COS-1, plasmid pSRHS-Tat-Env as defined in claim 6_HTLV-1And target cells TZM-bl.

Use of an HTLV-1 Env mediated cell-cell fusion system as described above for screening and/or validation of entry inhibitors against HTLV-1 virus.

The invention applies a cell-cell fusion model of mature HIV-1 to HTLV-1 virus. By transfection of pSRHS-Tat-Env_HIV-1Cells in which the plasmid co-expresses the HIV-1 envelope glycoprotein Env and the trans regulatory protein Tat are called effector cells (i.e., COS-1 cells in this application). The HIV-1 indicator cell line TZM-bl is selected as a target cell, is actually a derivative cell strain of HeLa, stably and highly expresses a CD4 receptor and CCR5 and CXCR4 coreceptors on a cell membrane, and integrates HIV-1 long terminal repeat sequence LTR containing a Tat response element in a genome, so as to start the expression of a firefly luciferase (firefly luciferase) reporter gene which is connected in series downstream of the LTR. When the effector cell and the target cell are fused, the transactivator Tat in the effector cell can activate LTR in the genome of the target cell so as to start the high-efficiency expression of luciferase (Luc). Therefore, the detected luciferase activity can indirectly reflect the HIV-1 Env mediated intercellular fusion level.

Given that the HeLa cell line itself expresses multiple functional receptors required for HTLV-1 virus invasion, there is theoretically the possibility of applying the mature HIV-1 cell-cell fusion model to HTLV-1 virus. However, the intracellular domain of HIV-1 Env contains the second codon region of the Tat protein (encoding a 67-101 fragment of Tat), which, when replaced, may affect Tat function. In the present application, pSRHS-Tat-Env was first subjected to the rolling circle PCR method_HIV-1CRF07The G713 amino acid residue of HIV-1 Env (encoded by International Standard strain HXB 2) in the plasmid was mutated to a stop codon and the results showed that the ability of the HIV-1 envelope glycoprotein gp145 produced by the mutation to mediate cell-cell fusion was not affected and was even slightly elevated compared to the full-length protein. Thus, the present application can creatively use HTLV-1 Env to transform pSRHS-Tat-Env_HIV-1CRF07The gp145 partial replacement of HIV-1 Env on the plasmid achieved expression of the more toxic HTLV-1 envelope glycoprotein in effector cells, and the HIV-1Tat protein was unaffected. Compared with a control vector, the target plasmid can obtain a higher-level luciferase activation multiple, which indicates that HTLV-1 Env successfully mediates fusion between effector cells and target cells, the fusion capability of the HTLV-1 Env is almost the same as that of HIV-1 Env, and the HTLV-1 cell-cell fusion system has the advantages of rapidness, simplicity, convenience, high efficiency, strong sensitivity, good applicability and the like of the original HIV-1 cell-cell fusion system.

The model is further used for verifying the reported inhibition effect of the polypeptide P-400 corresponding to the HTLV-1 Env 400-429 amino acid, the activity of luciferase is reduced by more than 20 times at the concentration of 20 mu g/ml, the inhibition effect is better than reported data, and the model is particularly suitable for screening and verifying the entry inhibitor of HTLV-1 virus and evaluating indexes such as effective concentration and toxicity of the entry inhibitor.

In summary, the advantages and positive effects of the invention are:

firstly, pSRHS-Tat-Env is subjected to rolling circle PCR (polymerase chain reaction) method_HIV-1CRF07The 713 th amino acid (the first amino acid after the transmembrane region) of the HIV-1 Env in the plasmid is mutated into a stop codon, and the capability of the generated HIV-1 envelope glycoprotein gp145 form for mediating cell-cell fusion is not influenced at all and is even increased compared with the full-length protein. Then obtaining an HTLV-1 Env gene fragment by utilizing a polymerase chain reaction PCR technology, and using the HTLV-1 Env gene fragment to express a classical envelope expression vector pSRHS-Tat-Env_HIV-1CRF07The corresponding gp145 fragment in the HIV-1 Env gene is replaced, and effector cell COS-1 is transfected, so that HTLV-1 envelope protein Env and trans regulatory protein Tat are co-expressed. TZM-bl is selected as a target cell, the cell expresses HTLV-1 receptor, HIV-1 long terminal repeat LTR is integrated in the genome, and the expression of a firefly luciferase (firefly luciferase) reporter gene connected in series downstream is controlled. Because the fusion level of the effector cells and the target cells is positively correlated with the expression level of luciferase (Luc), HTLV-1 Env-mediated cell fusion capacity can be indirectly detected by detecting the activity of Luc, and the cell fusion capacity can be utilizedThe reported inhibition polypeptide P-400 verifies the fusion system, and the obtained inhibition effect is more than 20 times and is superior to the reported data. Therefore, the cell-cell fusion system has the advantages of rapidness, simplicity, convenience, high efficiency, strong sensitivity, good applicability and the like, and is very suitable for screening the entry inhibitor aiming at the HTLV-1 virus, verifying the entry inhibitor screened by other systems, and evaluating the indexes such as the effective concentration and toxicity of the entry inhibitor.

Drawings

FIG. 1 is a representation of gp 145-mediated cell-cell fusion with premature termination of HIV-1 Env formation;

FIG. 2 is a schematic diagram of the principle of HTLV-1 Env mediated cell-cell fusion system;

FIG. 3 is an HTLV-1 Env-mediated fusion of cells with target cells in effector cells;

FIG. 4 is a graph of the inhibitory effect of the entry inhibitor P-400 based on the HTLV-1 Env-mediated cell-cell fusion system.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

Various modifications to the precise description of the invention will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit and scope of the appended claims. It is to be understood that the scope of the invention is not limited to the procedures, properties, or components defined, as these embodiments, as well as others described, are intended to be merely illustrative of particular aspects of the invention. Indeed, various modifications of the embodiments of the invention which are obvious to those skilled in the art or related fields are intended to be covered by the scope of the appended claims.

For a better understanding of the invention, and not as a limitation on the scope thereof, all numbers expressing quantities, percentages, and other numerical values used in this application are to be understood as being modified in all instances by the term "about". Accordingly, unless expressly indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. In the present invention, "about" means within 10%, preferably within 5% of a given value or range.

The genes, proteins or fragments thereof involved in the present invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant techniques.

The invention discloses an HTLV-1 Env mediated cell-cell fusion model, a preparation method and application, which are shown in the following embodiments.

Example 1 pSRHS-Tat-Env_HIV-1CRF07Premature termination mutation of HIV-1 Env

The intracellular region of HIV-1 Env contains the second codon region of the Tat protein (encoding a 67-101 fragment of Tat), and to verify that premature termination mutations of HIV-1 Env do not affect expression of the Tat protein, this example was performed in pSRHS-Tat-Env_HIV-1CRF07The first amino acid behind the gp145 fragment corresponding to HIV-1 Env is mutated into a stop codon, and the protein expressed by the mutant is an intracellular premature termination mutant gp145, and the nucleotide sequence is shown as SEQ ID NO. 1.

Human immunodeficiency virus Chinese recombination epidemic strain gp145(HIV-1CRF07 gp145) sequence:

GAATTCTGCAACAACTGCTGTTTATCCATTTCAGAATTGGGTGTCGACATAGCAGAATAGGCGTTACTCGACAGAGGAGAGCAAGAAATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATGACAAAAGCCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAGTAAGTAGTACATGTAATGCAACCTATAATAGTAGCAATAGTAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGTCCATAGTAATCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGACTAATAGAAAGAGCAGAAGACAGTGGCAATGAGAGTGAAGGAGAAGTATCAGCACTT

ATGGACAGGGCCAAGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCCCCAGGCCCAGGCCGTGGGCAACCTGTGGGTGACCGTGTACTACGGCGTGCCCGTGTGGAAGGGCGCCACCACCACCCTGTTCTGCGCCAGCGACGCCAAGGCCTACGACACCGAGGTGCACAACGTGTGGGCCACCCACGCCTGCGTGCCCGCCGACCCCAACCCCCAGGAGATGGTGCTGGAGAACGTGACCGAGAACTTCAACATGTGGAAGAACGAGATGGTGAACCAGATGCAGGAGGACGTCATCAGCCTGTGGGACCAGAGCCTGAAGCCCTGCGTGAAGCTGACCCCCCTGTGCGTGACCCTGGAGTGCAGGAACGTGAGCAGCAACAGCAACGACACCTACCACGAGACCTACCACGAGAGCATGAAGGAGATGAAGAACTGCAGCTTCAACGCCACCACCGTGGTGAGGGACAGGAAGCAGACCGTGTACGCCCTGTTCTACAGGCTGGACATCGTGCCCCTGACCAAGAAGAACTACAGCGAGAACAGCAGCGAGTACTACAGGCTGATCAACTGCAACACCAGCGCCATCACCCAGGCCTGCCCCAAGGTGACCTTCGACCCCATCCCCATCCACTACTGCACCCCCGCCGGCTACGCCATCCTGAAGTGCAACGACAAGATCTTCAACGGCACCGGCCCCTGCCACAACGTGAGCACCGTGCAGTGCACCCACGGCATCAAGCCCGTGGTGAGCACCCAGCTGCTGCTGAACGGCAGCCTGGCCGAGGGCGAGATCATCATCAGGAGCGAGAACCTGACCAACAACGTGAAAACCATCATCGTGCACCTGAACCAGAGCGTGGAGATCGTGTGCACCAGGCCCGGCAACAACACCAGGAAGAGCATCAGGATCGGCCCCGGCCAGACCTTCTACGCCACCGGCGACATCATCGGCGACATCAGGCAGGCCCACTGCAACATCAGCGAGGACAAGTGGAACGAGACCCTGCAGAGGGTGAGCAAGAAGCTTGCCGAGCACTTCCAGAACAAGACCATCAAGTTCGCCAGCAGCAGCGGCGGCGACCTGGAGGTGACCACCCACAGCTTCAACTGCAGGGGCGAGTTCTTCTACTGCAACACCAGCGGCCTGTTCAACGGCGCCTACACCCCCAACGGCACCAAGAGCAACAGCAGCAGCATCATCACCATCCCCTGCAGGATCAAGCAGATCATCAACATGTGGCAGGAGGTGGGCAGGGCCATGTACGCCCCTCCCATCAAGGGCAACATCACCTGCAAGAGCAACATCACCGGCCTGCTGCTGGTGAGGGACGGCGGCACCGAGCCCAACGACACCGAGACCTTCAGGCCCGGCGGCGGCGACATGAGGAACAACTGGAGGAGCGAGCTGTACAAGTACAAGGTGGTGGAGATCAAGCCCCTGGGCGTGGCCCCCACCACCACCAAGAGGAGGGTGGTGGAGAGGGAGAAGAGGGCCGTGGGCATCGGCGCCGTGTTCCTGGGCTTCCTGGGCGTGGCCGGCAGCACCATGGGCGCCGCCAGCATCACCCTGACCGTGCAGGCCAGGCAGCTGCTGAGCGGCATCGTGCAGCAGCAGAGCAACCTGCTGAGGGCCATCGAGGCCCAGCAGCACCTGCTGCAGCTGACCGTGTGGGGCATCAAGCAGCTGCAGACCAGGGTGCTGGCCATCGAGAGGTACCTGAAGGACCAGCAGCTGCTGGGCATCTGGGGCTGCAGCGGCAAGCTGATCTGCACCACCGCCGTGCCCTGGAACAGCAGCTGGAGCAACAAGAGCCAGAAGGAGATCTGGGACAACATGACCTGGATGCAGTGGGACAAGGAGATCAGCAACTACACCAACACCGTGTACAGGCTGCTGGAGGAGAGCCAGAACCAGCAGGAGAGGAACGAGAAGGACCTGCTGGCCCTGGACAGCTGGAAGAACCTGTGGAGCTGGTTCGACATCACCAACTGGGTGTGGTACATCAAGATCTTCATCATCATCGTGGGCGGCCTGATCGGCCTGAGGATCATCTTCGCCGTGCTGAGCATCGTGAACAGGGTGAGGCAGGGCTACTGA(here, the newly introduced stop codon TGA)

CCATTATCGTTTCAGACCCACCTCCCAATCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTAGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAACTTGCTCAATGCCACAGCCATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAGTATTACAAGCAGCTTATAGAGCTATTCGCCACATACCTAGAAGAATAAGACAGGGCTTGGAAAGGATTTTGCTATAAGATGGGTGGCAAGTGGTCAAAAAGTAGTGTGATTGGATGGCCTGCTGTAAGGGAAAGAATGAGACGAGCTGAGCCAGCAGCAGATGGGGTGGGAGCAGTATCTCGAG(the first and third sequences are sequences on the vector, containing the Tat protein coding region).

By using rolling circle PCR technology, base mutation is generated on PCR products, and after the PCR products are transformed into competent cells TOP10 due to complementary pairing, spontaneous looping can be realized, and gaps can be repaired by enzymes in the competent cells, so that the mutated plasmid pSRHS-Tat-gp145 is generated_CRF07。

With pSRHS-Tat-Env_HIV-1CRF07Performing rolling circle PCR as a template, wherein the rolling circle PCR condition is as follows, after the PCR is finished, 10 mu l of rolling circle PCR product is taken to perform agarose gel electrophoresis, plasmid with the same quantity as the template in a rolling circle PCR reaction system is taken as negative control, if the brightness of the product is obviously stronger than that of the template, the product is a positive product, otherwise, the product is negative, the PCR reaction needs to be carried out again, 8 mu l of point mutation PCR positive product is taken to be arranged in a PCR tube, 1 mu l of 10 × FastDigel Buffer and demethylase DpnI are added to treat and eliminate the methylated template, 2 mu l of digestion product is taken to convert plasmid amplification competent cells after incubation and digestion for 3h at 37 ℃, and the plasmid is extracted and sequenced and verified.

In other embodiments, site-directed mutagenesis may be performed by other methods known in the art, such as designing primers, performing PCR, amplifying dominant DNA fragments containing point mutations, and ligating them.

Rolling circle PCR method point mutation reaction system:

the rolling circle PCR method point mutation reaction conditions are as follows:

primers used for point mutation were:

HIV-1 CRF07 gp145 SDM Forward，SEQ ID NO.2：CGTGAACAGGGTGAGGCAGGGCTACtGACCATTATCGTTTCAGACCCACCTC

HIV-1 CRF07 gp145 SDM Reverse，SEQ ID NO.3：GAGGTGGGTCTGAAACGATAATGGTCaGTAGCCCTGCCTCACCCTGTTCACG

EXAMPLE 2 HIV-1 gp 145-mediated cell-cell fusion experiments

(1) The first day, lay 1 × 10⁵COS-1 effector cells were cultured in 12-well plates for 24 h.

(2) The next day, pSRHS-Tat-gp145 of wild-type HIV-1CRF07 and mutant HIV-1 gp145_CRF07The expression plasmid and the control plasmid were transfected into the effector cell COS-1.

(3) On the third day, 3 × 10 was added after 24h of incubation of transfected effector cells⁵Individual target cells TZM-bl were added to each well and co-cultured with effector cells for 24 h.

(4) On the fourth day, firefly luciferase activity assay was performed.

The firefly Luciferase activity assay (Luciferase assay) was performed as follows:

1) removing the culture medium from 12-well plate, washing with 1 × PBS for 2-3 times, and adding 150 μ l of pre-diluted 1 × cell lysate;

2) cracking on shaking table at room temperature for 15min, and tapping with hand for 2-3 times to fully crack cells;

3) the lysate was pipetted into a 1.5ml tube and centrifuged at 12,000rpm for 3min at room temperature;

4) 5. mu.l of the supernatant was spotted onto a 96-well chemiluminescence assay plate, and the fluorescence intensity was measured using a chemiluminescence detector.

The results are shown in FIG. 1, and the ability of HIV-1 Env to prematurely terminate the formed gp145 mediated cell-cell fusion is not affected, but is elevated compared to the full-length Env protein. This provides theoretical support for the subsequent replacement of gp145 of HIV-1 with HTLV-1 Env, and the establishment of HTLV-1 mediated fusion systems of effector and target cells (see FIG. 2).

Example 3 recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env_HTLV-1Construction of

HTLV-1ATK-1 Env which is synthesized by the whole gene of Jinzhi Biotechnology Limited company and optimized according to the preference of human codons is taken as a template, the nucleotide sequence is shown in SEQ ID NO.4, a DNA fragment of the HTLV-1ATK-1 Env full length is obtained by utilizing the PCR technology, and a target gene fragment is connected to the linearized pSRHS-Tat-Env obtained by the inverse PCR method_CRF07gp145Vector fragment (common mode in DNA seamless cloning technology, gp145 fragment in HIV-1CRF07 Env gene is removed in linearization process), it should be noted that the reverse PCR technology in seamless cloning technology is essentially the same as the ordinary PCR technology, and the difference is only that the design of primers is different, and the obtained PCR products are DNA fragments, so the application is not distinguished in the following. After the accuracy of the target gene fragment is verified by PCR identification and sequencing of a bacterial liquid, two target plasmids are greatly extracted by an endotoxin-free plasmid large-scale extraction kit so as to improve the concentration of the target plasmids and remove the influence of endotoxin on transfection.

The primers used in the vector construction process are (shown in SEQ ID NO.5-SEQ ID NO.8 in sequence):

HTLV-1 Env Forward:GAGCAGAAGACAGTGGCA ATGGGTAAGTTTCTCGCCAC

HTLV-1 Env Reverse:GGTCTGAAACGATAATGG TCAGAGGCTGCTTTCGGGCTTG

pSRHS Forward:CCATTATCGTTTCAGACC CACCTCCCAATCCCGA

pSRHSReverse:TGCCACTGTCTTCTGCTC TTTCTATTAGTCTATC

in order to obtain the target fragment and the linearized vector, a PCR reaction is required, and the system is as follows:

the reaction procedure was as follows:

after the PCR reaction is finished, the PCR product is identified, recovered and quantified by agarose nucleic acid gel electrophoresis. The recombination is carried out by utilizing a recombination cloning kit, and the reaction system is as follows:

10.0 mul of recombinant product is transformed into Top10 competence, positive clone is identified by a bacterial liquid method, the accuracy of a target gene fragment is further verified by DNA sequencing, and plasmids which construct a correct usage method are largely extracted by an endotoxin-free plasmid large-extraction kit so as to improve the concentration of the target plasmid and remove the influence of endotoxin on transfection.

Example 4 HTLV-1 Env-mediated cell-cell fusion experiments and determination of firefly Luciferase Activity (Luciferase assay)

Example 2 (2) was replaced with: the next day, the recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env obtained in example 3 was used_HTLV-1And pSRHS-Tat-gp145 expressing HIV-1 gp145 as a positive control_CRF07The effector cell COS-1 was transfected with the plasmid and the negative control plasmid. The rest steps are the same.

As a result, as shown in FIG. 3, based on the measurement result of firefly luciferin, HTLV-1 Env-mediated cell-cell fusion ability was relatively strong, which was only slightly lower than that of HIV-1 Env.

Example 5 validation of the use of fusion systems prepared according to the invention for inhibitor screening

The fusion system prepared by the invention is verified by using the reported inhibitory polypeptide P-400.

(1) The first day, lay 1 × 10⁵COS-1 effector cells were cultured in 12-well plates for 24 h.

(2) The next day, pSRHS-Tat-Env was administered_HTLV-1And pSRHS-Tat-gp145_CRF07And control plasmid transfected effector cell COS-1.

(3) On the third day, after 24h of culture of transfected effector cells, P-400 inhibitory peptide or control peptide was added to a final concentration of 20. mu.g/ml, DMSO was added to the control group, and 3 × 10 was added⁵Individual target cells TZM-bl were added to each well and co-cultured with effector cells for 24 h.

(4) On the fourth day, the firefly luciferase activity was measured in the same manner as in example 2.

The sequence of the synthetic peptide used was:

P-400：CRFPNITNSH VPILQERPPL ENRVLTGWGL，SEQ ID NO.9；

control peptide: LAGPCILRQL RHLPSRVRYP HYSLIKPESS, SEQ ID NO. 10.

As a result, as shown in FIG. 4, it is known that the fusion inhibitor P-400 of HTLV-1 can specifically and efficiently inhibit HTLV-1 Env-mediated cell-cell fusion. The experimental result shows that when the fusion system prepared by the invention is applied to the experiment, the inhibition multiple is up to 20 times, and high sensitivity is shown, so that the fusion system prepared by the invention can be well used for screening HTLV-1 virus entry inhibitors and other works.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> New countryside medical college

<120> pSRHS-Tat-EnvHTLV-1 plasmid, construction method, cell-cell fusion system and application

<160>10

<170>SIPOSequenceListing 1.0

<210>1

<211>3149

<212>DNA

<213>gp145

<400>1

gaattctgca acaactgctg tttatccatt tcagaattgg gtgtcgacat agcagaatag 60

gcgttactcg acagaggaga gcaagaaatg gagccagtag atcctagact agagccctgg 120

aagcatccag gaagtcagcc taaaactgct tgtaccaatt gctattgtaa aaagtgttgc 180

tttcattgcc aagtttgttt catgacaaaa gccttaggca tctcctatgg caggaagaag 240

cggagacagc gacgaagagc tcatcagaac agtcagactc atcaagcttc tctatcaaag 300

cagtaagtag tacatgtaat gcaacctata atagtagcaa tagtagcatt agtagtagca 360

ataataatag caatagttgt gtggtccata gtaatcatag aatataggaa aatattaaga 420

caaagaaaaa tagacaggtt aattgataga ctaatagaaa gagcagaaga cagtggcaat 480

gagagtgaag gagaagtatc agcacttatg gacagggcca agctgctgct gctgctgctg 540

ctgctgctgc tgccccaggc ccaggccgtg ggcaacctgt gggtgaccgt gtactacggc 600

gtgcccgtgt ggaagggcgc caccaccacc ctgttctgcg ccagcgacgc caaggcctac 660

gacaccgagg tgcacaacgt gtgggccacc cacgcctgcg tgcccgccga ccccaacccc 720

caggagatgg tgctggagaa cgtgaccgag aacttcaaca tgtggaagaa cgagatggtg 780

aaccagatgc aggaggacgt catcagcctg tgggaccaga gcctgaagcc ctgcgtgaag 840

ctgacccccc tgtgcgtgac cctggagtgc aggaacgtga gcagcaacag caacgacacc 900

taccacgaga cctaccacga gagcatgaag gagatgaaga actgcagctt caacgccacc 960

accgtggtga gggacaggaa gcagaccgtg tacgccctgt tctacaggct ggacatcgtg 1020

cccctgacca agaagaacta cagcgagaac agcagcgagt actacaggct gatcaactgc 1080

aacaccagcg ccatcaccca ggcctgcccc aaggtgacct tcgaccccat ccccatccac 1140

tactgcaccc ccgccggcta cgccatcctg aagtgcaacg acaagatctt caacggcacc 1200

ggcccctgcc acaacgtgag caccgtgcag tgcacccacg gcatcaagcc cgtggtgagc 1260

acccagctgc tgctgaacgg cagcctggcc gagggcgaga tcatcatcag gagcgagaac 1320

ctgaccaaca acgtgaaaac catcatcgtg cacctgaacc agagcgtgga gatcgtgtgc 1380

accaggcccg gcaacaacac caggaagagc atcaggatcg gccccggcca gaccttctac 1440

gccaccggcg acatcatcgg cgacatcagg caggcccact gcaacatcag cgaggacaag 1500

tggaacgaga ccctgcagag ggtgagcaag aagcttgccg agcacttcca gaacaagacc 1560

atcaagttcg ccagcagcag cggcggcgac ctggaggtga ccacccacag cttcaactgc 1620

aggggcgagt tcttctactg caacaccagc ggcctgttca acggcgccta cacccccaac 1680

ggcaccaaga gcaacagcag cagcatcatc accatcccct gcaggatcaa gcagatcatc 1740

aacatgtggc aggaggtggg cagggccatg tacgcccctc ccatcaaggg caacatcacc 1800

tgcaagagca acatcaccgg cctgctgctg gtgagggacg gcggcaccga gcccaacgac 1860

accgagacct tcaggcccgg cggcggcgac atgaggaaca actggaggag cgagctgtac 1920

aagtacaagg tggtggagat caagcccctg ggcgtggccc ccaccaccac caagaggagg 1980

gtggtggaga gggagaagag ggccgtgggc atcggcgccg tgttcctggg cttcctgggc 2040

gtggccggca gcaccatggg cgccgccagc atcaccctga ccgtgcaggc caggcagctg 2100

ctgagcggca tcgtgcagca gcagagcaac ctgctgaggg ccatcgaggc ccagcagcac 2160

ctgctgcagc tgaccgtgtg gggcatcaag cagctgcaga ccagggtgct ggccatcgag 2220

aggtacctga aggaccagca gctgctgggc atctggggct gcagcggcaa gctgatctgc 2280

accaccgccg tgccctggaa cagcagctgg agcaacaaga gccagaagga gatctgggac 2340

aacatgacct ggatgcagtg ggacaaggag atcagcaact acaccaacac cgtgtacagg 2400

ctgctggagg agagccagaa ccagcaggag aggaacgaga aggacctgct ggccctggac 2460

agctggaaga acctgtggag ctggttcgac atcaccaact gggtgtggta catcaagatc 2520

ttcatcatca tcgtgggcgg cctgatcggc ctgaggatca tcttcgccgt gctgagcatc 2580

gtgaacaggg tgaggcaggg ctactgatga ccattatcgt ttcagaccca cctcccaatc 2640

ccgaggggac ccgacaggcc cgaaggaata gaagaagaag gtggagagag agacagagac 2700

agatccattc gattagtgaa cggatcctta gcacttatct gggacgatct gcggagcctg 2760

tgcctcttca gctaccaccg cttgagagac ttactcttga ttgtaacgag gattgtggaa 2820

cttctgggac gcagggggtg ggaagccctc aaatattggt ggaatctcct acagtattgg 2880

agtcaggaac taaagaatag tgctgttaac ttgctcaatg ccacagccat agcagtagct 2940

gaggggacag atagggttat agaagtatta caagcagctt atagagctat tcgccacata 3000

cctagaagaa taagacaggg cttggaaagg attttgctat aagatgggtg gcaagtggtc 3060

aaaaagtagt gtgattggat ggcctgctgt aagggaaaga atgagacgag ctgagccagc 3120

agcagatggg gtgggagcag tatctcgag 3149

<210>2

<211>52

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

cgtgaacagg gtgaggcagg gctactgacc attatcgttt cagacccacc tc 52

<210>3

<211>52

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gaggtgggtc tgaaacgata atggtcagta gccctgcctc accctgttca cg 52

<210>4

<211>1467

<212>DNA

<213>ATK-1

<400>4

atgggaaagt ttttagccac cctcatcctc tttttccagt tctgcccttt aatctttggc 60

gactattccc cctcttgttg cacactgacc atcggcgtgt cctcctacca cagcaaacct 120

tgcaatcccg ctcagcccgt ttgttcttgg acactggatc tgctggcttt aagcgctgat 180

caagccttac agcctccttg ccccaattta gtgagctact cctcctacca tgccacctac 240

tctttatatt tatttcctca ctggaccaag aagcctaatc gtaacggagg aggatactac 300

agcgcctcct attccgaccc ttgttcttta aaatgtccct atctgggctg tcagtcttgg 360

acttgtccct acactggtgc cgtttccagc ccctactgga agttccagca cgacgtcaat 420

ttcacccaag aagtgtctcg tctgaacatc aatttacatt tctccaagtg cggcttccct 480

ttctctttac tggtggacgc ccccggatac gaccccatct ggtttttaaa cacagagcct 540

agccagctgc cccctaccgc tccccctctg ctccctcata gcaatttaga ccacatttta 600

gagccctcca tcccttggaa gagcaagtta ttaactttag tccagctgac tttacagagc 660

accaactaca cttgtattgt ctgcatcgac agagcctctt tatccacttg gcatgtgctg 720

tactccccta acgtgagcgt cccttccagc tcctccaccc ctttactgta tccctcttta 780

gctctccccg ctcctcattt aacactcccc ttcaactgga cccactgctt tgacccccag 840

attcaagcta ttgtgtcctc tccttgtcac aactccctca ttttaccccc cttctcttta 900

agccccgttc ctactttagg ctcccgttct cgtagggccg tgcccgttgc cgtgtggctg 960

gtgagcgctc tggctatggg cgctggagtg gccggaggaa tcactggttc tatgtcttta 1020

gccagcggca aatctttact gcacgaggtg gacaaggata tcagccagct gacccaagct 1080

atcgtgaaaa accataaaaa tttactcaag attgctcagt acgccgccca gaatcgtaga 1140

ggtttagatt tactgttctg ggagcaaggt ggactgtgca aggctctgca agaacagtgt 1200

cgtttcccca acatcaccaa cagccacgtg cccatcctcc aagaaagacc tcctttagaa 1260

aatcgtgtgc tgaccggctg gggactgaac tgggacctcg gactgagcca gtgggccaga 1320

gaggctttac agactggtat tactttagtg gctctgctgc tgctggtgat cctcgccggc 1380

ccttgtatcc tcagacagct gagacattta ccttctcgtg ttcgttaccc ccattattct 1440

ttaatcaagc ccgaaagcag cctctaa 1467

<210>5

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gagcagaaga cagtggcaat gggtaagttt ctcgccac 38

<210>6

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ggtctgaaac gataatggtc agaggctgct ttcgggcttg 40

<210>7

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ccattatcgt ttcagaccca cctcccaatc ccga 34

<210>8

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

tgccactgtc ttctgctctt tctattagtc tatc 34

<210>9

<211>30

<212>PRT

<213>P-400

<400>9

Cys Arg Phe Pro Asn Ile Thr Asn Ser His Val Pro Ile Leu Gln Glu

1 5 10 15

Arg Pro Pro Leu Glu Asn Arg Val Leu Thr Gly Trp Gly Leu

20 25 30

<210>10

<211>30

<212>PRT

<213>control petide

<400>10

Leu Ala Gly Pro Cys Ile Leu Arg Gln Leu Arg His Leu Pro Ser Arg

1 5 10 15

Val Arg Tyr Pro His Tyr Ser Leu Ile Lys Pro Glu Ser Ser

20 25 30

Claims (10)

1. Recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env_HTLV-1The method for constructing (1), characterized in that,the method comprises the following steps:

plasmid pSRHS-Tat-Env_HIV-1CRF07Mutating the first amino acid residue behind the corresponding gp145 fragment in HIV-1 Env into a stop codon to obtain a mutant; replacing gp145 fragment of HIV-1 Env gene of the mutant with HTLV-1 Env full-length fragment to obtain recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env_HTLV-1。

2. The recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env according to claim 1_HTLV-1The construction method of (2), characterized in that: and mutating the amino acid residue into a stop codon by using a rolling circle PCR technology, wherein the sequence of a point mutation primer related to the rolling circle PCR technology is shown in SEQ ID NO.2 and SEQ ID NO. 3.

3. A recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env according to claim 2_HTLV-1The construction method of (2), characterized in that: rolling circle PCR method point mutation reaction system:

the rolling circle PCR method point mutation reaction conditions are as follows:

4. the recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env according to claim 1_HTLV-1The construction method of (2), characterized in that: the sequence of the HTLV-1 Env fragment is shown in SEQ ID NO. 4.

5. The recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env according to claim 1_HTLV-1The construction method of (2), characterized in that: obtaining a recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env_HTLV-1Then transformed into Top10 competent cells.

6. A recombinant HTLV-1 Env expression plasmid pSRHS-Tat-Env according to any one of claims 1 to 5_HTLV-1The plasmid pSRHS-Tat-Env constructed by the construction method of (1)_HTLV-1。

7. The plasmid pSRHS-Tat-Env of claim 6_HTLV-1The application of the protein in an HTLV-1 Env mediated cell-cell fusion system.

8. The plasmid pSRHS-Tat-Env of claim 6_HTLV-1Use in screening and/or validation of entry inhibitors against HTLV-1 virus.

9. An HTLV-1 Env-mediated cell-cell fusion system comprising: effector COS-1, plasmid pSRHS-Tat-Env as defined in claim 6_HTLV-1And target cells TZM-bl.

10. Use of an HTLV-1 Env mediated cell-cell fusion system according to claim 9 for screening and/or validation of entry inhibitors against HTLV-1 virus.

Images