CN111763744B - Method for identifying sex of goby - Google Patents
Method for identifying sex of goby Download PDFInfo
- Publication number
- CN111763744B CN111763744B CN202010590772.0A CN202010590772A CN111763744B CN 111763744 B CN111763744 B CN 111763744B CN 202010590772 A CN202010590772 A CN 202010590772A CN 111763744 B CN111763744 B CN 111763744B
- Authority
- CN
- China
- Prior art keywords
- goby
- sex
- identifying
- primer
- male
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for identifying the sex of goby. The invention relates to a primer for identifying the sex of goby, which comprises the following specific steps: an upstream primer: 5 'CAGATGCCTCATAGTGGACG-doped 3', which is specifically shown as SEQ ID NO: 1; a downstream primer: 5 'GCTGCTGTTGTTGCTGCTGTG-3', which is specifically shown as SEQ ID NO: 2. The invention utilizes the identifying primer for identifying the sex of the goby, and the sex of the goby can be quickly and accurately identified according to the method. Compared with the traditional method for identifying the male and the female by using morphology, the method can solve the problem that the male and the female can not be identified due to the immature gonads or no obvious second sexual characteristics and the like by using a molecular biology level means; compared with the technology of identifying male and female by using a histological section method, the method provided by the invention can obviously increase the detection time efficiency and reduce the detection cost. The method is a great improvement and supplement to the current sex identification technology of goby fishes.
Description
The technical field is as follows:
the invention belongs to the technical field of fish sex identification, and particularly relates to a method for identifying the sex of goby fish.
The background art comprises the following steps:
gobies (Gobiidae) is one of the largest fish families, more than 2000 species are known at present, are widely distributed in various freshwater areas except for north and south poles in the world, and most of the gobies have the characteristics of small body size, strong fecundity and the like, and the strong fecundity can be one of important reasons for realizing the wide distribution in the world. At present, few reports about the sex determination mechanism research of goby fishes are reported, sex chromosomes are not found in the goby fishes, and sex determination key genes are not clear, so that great inconvenience is brought to the rapid sex identification of the goby fishes, and the sex identification of immature goby fishes is difficult to perform. The sex determination key gene is utilized to establish a rapid identification technology of the male sex of the goby, and the method has important value for researching reproduction, evolution, ecological adaptability strategies and the like of goby family fishes.
At present, sex identification of goby without secondary sex characteristics or not yet sexually mature is difficult to carry out based on the traditional morphological sex identification method, and the sex identification method based on pathological tissue sections has the problems of long period, high cost, inconvenient operation and the like.
The invention content is as follows:
the first purpose of the invention is to provide a primer for quickly and accurately identifying the sex of goby.
The invention relates to a primer for identifying the sex of goby, which comprises the following steps:
an upstream primer: 5 'CAGATGCCTCATAGTGGACG-doped 3', which is specifically shown as SEQ ID NO: 1;
a downstream primer: 5 'GCTGCTGTTGTTGCTGCTGTG-3', which is specifically shown as SEQ ID NO: 2.
The second purpose of the invention is to provide a method for identifying the sex of goby, which takes goby gonad cDNA as a template, takes the identifying primer for identifying the sex of goby as a primer for amplification, if a target segment can be amplified, the goby is male, and if the target segment cannot be amplified, the goby is female;
or taking goby gonad cDNA as a template, taking the identifying primer for identifying goby sex as a primer, and carrying out PCR amplification and fluorescence value acquisition by using a PCR reagent containing nucleic acid dyes such as SYBRgreen and the like, wherein if a delta Ct value can be detected, the goby sex is male, and otherwise, the goby sex is female.
Preferably, the goby is mullet goby.
The third purpose of the invention is to provide a kit for identifying the sex of the goby, which contains the primer for identifying the sex of the goby and a PCR reaction reagent or a PCR reagent containing nucleic acid dyes such as SYBR green and the like.
The sex of the goby can be quickly and accurately identified according to the method of the invention by using the identifying primer for identifying the sex of the goby. Compared with the traditional method for identifying the male and the female by using morphology, the method can solve the problem that the male and the female can not be identified due to immature gonads or no obvious second sexual characteristics and the like by using a molecular biology level means; compared with the technology of identifying male and female by using a histological section method, the method provided by the invention can obviously increase the detection time efficiency and reduce the detection cost. The method is a great improvement and supplement to the current sex identification technology of goby fishes.
Description of the drawings:
FIG. 1 is a sex determination electrophoretogram (1 to 3 are female fishes 9 months old, 4 to 6 are male fishes 9 months old, 7 to 9 are female fishes 12 months old, 10 to 12 are male fishes 12 months old, 13 to 15 are female fishes 24 months old, 16 to 18 are male fishes 24 months old);
FIG. 2 shows a sex determination electrophoretogram (P is a positive control, N is a negative control, C1 to C10 are closed groups, and W1 to W10 are wild groups).
The specific implementation mode is as follows:
in order to make the objects, technical solutions and advantageous technical effects of the present invention clearer, the present invention is further described in detail with reference to the following embodiments. It should be understood that the embodiments described in this specification are only for the purpose of illustrating the invention and are not to be construed as limiting the invention, and the parameters, proportions and the like of the embodiments may be suitably selected without materially affecting the results.
Example 1
1. Taking materials
And (3) breeding closed groups for laboratories by using mullet gobies, and taking 6 tails (half male and half female) of each of the experimental fishes at the ages of 6 months, 9 months, 12 months and 24 months respectively as negative (female) and positive (male) controls at different development stages. The sex of all the experimental fishes is determined by histological observation, and all the experimental fishes are raised in the same environment. And taking the gonads of each group of experimental fishes by using a dissecting mirror, and storing the gonads in liquid nitrogen for later use.
2. Total RNA extraction and reverse transcription
Total RNA of the gonads is extracted by a Trizol method, 24 samples are counted, the integrity of the RNA is detected by 1% agarose electrophoresis, and the concentration is detected by a NanoDROP 2000. And (3) respectively carrying out reverse transcription on the 24 samples by utilizing a reverse transcription kit, adjusting the concentration of each group of cDNA to be consistent by using RNase-free water, and storing the cDNA in a refrigerator at the temperature of-20 ℃ for later use.
3. Detection
(1) Fluorescent quantitative PCR amplification
And (3) performing PCR amplification and fluorescence value acquisition by using a specific identification primer, using the 18s gene as an internal reference gene, using the cDNA obtained in the previous step as a template, using a PCR reagent containing SYBR green nucleic acid dye according to the instructions of an ABI 7500 fluorescence quantitative PCR instrument. The PCR amplification procedure was: pre-denaturation at 95 ℃ for 30s;95 ℃ for 5s,60 ℃ for 34s;25 cycles.
The invention obtains a pair of specific identifying primers for identifying the sex of the goby through screening, wherein the sequences of the specific identifying primers are as follows:
the upstream primer of the specific identification primer: 5 'CAGATGCCTCATAGTGGACG-doped 3', which is specifically shown as SEQ ID NO: 1;
downstream primer of the specific identification primer: 5 'GCTGCTGTTGTTGCTGCTGTG-3', which is specifically shown as SEQ ID NO: 2;
the primer sequence of the internal reference 18s gene is as follows:
internal reference 18s upstream primer: 5' CAAGACGGACGAAAGCGAAA-;
internal reference 18s downstream primer: 5 'and GTTGGCATCGTTATGGTCGG and 3', which are specifically shown as SEQ ID NO. 4.
(2) General PCR amplification
PCR amplification was performed using the cDNA obtained in step 2 as a template using specific identifying primers (SEQ ID NO:1 and SEQ ID NO: 2). The PCR amplification procedure was: pre-denaturation at 95 ℃ for 30s;95 ℃ for 5s,60 ℃ for 30s,72 ℃ for 20s;28 cycles, and finally extension at 72 ℃ for 4min.
4. Data processing
(1) Calculation of relative expression amount
The relative expression amount of the target gene in each concentration group was calculated by the Δ Ct method, and the data are shown in table 1.
TABLE 1 Gene expression level
Remarking: "/" indicates no amplification.
(2) Electrophoretic detection of common PCR products
The products of the general PCR amplification were detected by agarose electrophoresis, the electrophoresis pattern of which is shown in FIG. 1.
5. Determination of results
(1) Δ Ct values were detected in all positive control samples (males) and not in the negative controls (females); the detection result is consistent with the result of the sex determined in advance.
(2) The specific identification primer detects a 165bp specific band in a positive control sample (male) and does not amplify in a negative control sample (female); the detection result is consistent with the result of the sex judged in advance.
Example 2
1. Taking materials
The samples to be detected of striped mullet gobies are respectively a closed group F19 generation propagated in a laboratory and a wild group caught in Shenzhen region, and 10 tails of the samples respectively; fresh gonad tissue of each fish is taken, wherein one half of the gonad tissue is stored in liquid nitrogen, and the other half of the gonad tissue is stored in 4% paraformaldehyde. Taking the same concentrations of striped mullet testis and ovary cDNA as positive and negative control groups respectively.
2. Histological confirmation of the sex of the sample to be examined
And performing histological observation on part of gonad tissues of the sample to be detected by using a paraffin section and HE (high intensity intrinsic) dyeing method, and performing sex confirmation on the sample to be detected according to the gonad histological characteristics.
3. Total RNA extraction and reverse transcription
Total RNA of a sample to be detected is extracted by a Trizol method, 20 samples are counted, the integrity of the RNA is detected by 1% agarose electrophoresis, and the concentration is detected by NanoDROP 2000. The 20 samples are respectively reverse transcribed by utilizing a reverse transcription kit, the concentration of cDNA of each sample is adjusted to be consistent with that of a positive control group and a negative control group by using water without RNA enzyme, and then the samples are stored in a refrigerator at the temperature of-20 ℃ for later use.
4. Detection of
(1) Fluorescent quantitative PCR amplification
And (3) performing PCR amplification and fluorescence value acquisition by using a specific identification primer, using the 18s gene as an internal reference gene, using the cDNA obtained in the previous step as a template, using a PCR reagent containing SYBR green nucleic acid dye according to the ABI 7500 fluorescence quantitative PCR instrument instruction. The PCR amplification procedure was: pre-denaturation at 95 ℃ for 30s;95 ℃ for 5s,60 ℃ for 34s;25 cycles.
The invention obtains a pair of specific identifying primers for identifying the sex of the goby through screening, wherein the sequences of the specific identifying primers are as follows:
the upstream primer of the specific identification primer: 5 'CAGATGCCTCATAGTGGACG-doped 3', which is specifically shown as SEQ ID NO: 1;
downstream primer of the specific identification primer: 5 'GCTGCTGTTGTTGCTGCTGTG-3', which is specifically shown as SEQ ID NO: 2;
the primer sequence of the internal reference 18s gene is as follows:
internal reference 18s upstream primer: 5' CAAGACGGACGAAAGCGAAA-;
internal reference 18s downstream primer: 5 'and 5' are specifically shown as SEQ ID NO. 4.
(2) General PCR amplification
PCR amplification is carried out by using specific identification primers (SEQ ID NO:1 and SEQ ID NO: 2) and cDNA of a sample to be detected and a control group as templates. The PCR amplification procedure was: pre-denaturation at 95 ℃ for 30s;95 ℃ for 5s,60 ℃ for 30s,72 ℃ for 20s;28 cycles, and finally extension at 72 ℃ for 4min.
5. Data processing
(1) Calculation of relative expression amount
The relative expression of the target gene in each concentration group was calculated by the Δ Ct method, and the data are shown in table 2.
TABLE 2 Gene expression level
Remarking: "/" indicates no amplification; p is a positive control, and N is a negative control.
(2) Electrophoretic detection of common PCR products
The products of the general PCR amplification were detected by agarose electrophoresis, the electrophoresis pattern of which is shown in FIG. 2.
6. Determination of results
(1) When the delta Ct value is detected in the sample to be detected and the male control group and the female control group has no delta Ct value, the sample to be detected is indicated to be male; and when no delta Ct value exists in the detected sample and the female control group and a delta Ct value exists in the male control group, the fact that the sample to be detected is female is prompted. The detection result of the method is consistent with the histological identification result, which shows that the method is suitable for sex identification of mullet gobies.
(2) Detecting the PCR amplification product by using agarose electrophoresis, wherein when 165bp specific strips are detected in the sample to be detected and the male control group, and the female control group does not have the 165bp specific strip, the sample to be detected is indicated to be male; no 165bp specific band exists in the sample to be detected and the female control group, and the male control group detects the 165bp specific band, which indicates that the sample to be detected is female. The detection result of the method is consistent with the histological identification result, which shows that the method is suitable for sex identification of mullet gobies.
Appropriate variations and modifications of the embodiments described above will occur to those skilled in the art, in light of the above disclosure and teachings. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and variations of the present invention should fall within the scope of the claims of the present invention. Furthermore, although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.
Claims (1)
1. A method for identifying sex of goby is characterized in that goby gonad cDNA is taken as a template, and a primer for identifying sex of goby is taken as a primer for amplification, wherein the goby is male if a 165bp target fragment can be amplified, and is female if the target fragment cannot be amplified;
or taking goby gonad cDNA as a template, taking a distinguishing primer for distinguishing goby sex as a primer, and carrying out PCR amplification and fluorescence value acquisition by using a fluorescent quantitative PCR reagent containing SYBR green nucleic acid dye, wherein if a delta Ct value can be detected, the goby gonad cDNA is male, otherwise, the goby gonad cDNA is female;
the goby is striped mullet goby;
the identifying primer for identifying the sex of the goby is as follows:
an upstream primer: 5 'CAGATGCCTCATAGTGATGGACG-3';
a downstream primer: 5 'GCTGCTGTTGTTGCTGCTGTG-3'.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010590772.0A CN111763744B (en) | 2020-06-24 | 2020-06-24 | Method for identifying sex of goby |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010590772.0A CN111763744B (en) | 2020-06-24 | 2020-06-24 | Method for identifying sex of goby |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111763744A CN111763744A (en) | 2020-10-13 |
| CN111763744B true CN111763744B (en) | 2023-01-31 |
Family
ID=72721973
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010590772.0A Active CN111763744B (en) | 2020-06-24 | 2020-06-24 | Method for identifying sex of goby |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111763744B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104206324A (en) * | 2014-08-07 | 2014-12-17 | 广东省实验动物监测所 | Gonad development and breeding method for mugilogobius chulae or ctenogobius gymnauchen |
| CN109247270A (en) * | 2018-08-07 | 2019-01-22 | 广东省实验动物监测所 | A kind of method of quick screening small test fish building pancreas fatty infiltration model |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845479A (en) * | 2009-03-24 | 2010-09-29 | 中国水产科学研究院东海水产研究所 | Method for identifying quality of ova of Acanthogobius ommaturus |
| CN107326077B (en) * | 2017-07-14 | 2020-02-21 | 集美大学 | Molecular marker for identifying genetic sex of spotted maigre and application thereof |
| US20200323180A1 (en) * | 2017-12-15 | 2020-10-15 | Acd Pharmaceuticals As | Methods for the production of sterile fish and other egg-producing aquatic animals and compounds for use in the methods |
-
2020
- 2020-06-24 CN CN202010590772.0A patent/CN111763744B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104206324A (en) * | 2014-08-07 | 2014-12-17 | 广东省实验动物监测所 | Gonad development and breeding method for mugilogobius chulae or ctenogobius gymnauchen |
| CN109247270A (en) * | 2018-08-07 | 2019-01-22 | 广东省实验动物监测所 | A kind of method of quick screening small test fish building pancreas fatty infiltration model |
Non-Patent Citations (1)
| Title |
|---|
| 诸氏鲻虾虎鱼染色体组型分析;陈小曲等;《热带海洋学报》;20131115;第32卷(第06期);第88-95页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111763744A (en) | 2020-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113913539B (en) | Molecular marker related to chicken skin yellowness character and application thereof | |
| CN106591429B (en) | Method for screening sex reversal genetic control sites of cynoglossus semilaevis, kit and application | |
| CN111471756A (en) | Specific DNA fragment SSM1 for sturgeon gender identification and application | |
| CN114657264B (en) | Clarias fuscus sex-specific molecular marker primer and application thereof | |
| CN113637765B (en) | Molecular marker for identifying genetic sex of micropterus salmoides and application thereof | |
| CN116356037A (en) | Molecular marker related to chicken feed utilization rate and application thereof | |
| CN108588235B (en) | Genetic marker related to velvet production and velvet layer height of meridian-ridge black goats and application of genetic marker | |
| CN111763744B (en) | Method for identifying sex of goby | |
| CN113151430A (en) | Penaeus chinensis female specific primer and application thereof | |
| CN112680532A (en) | Polymorphic microsatellite molecular marker, primers and application of lipped fringetail | |
| CN111286547A (en) | Tilapia and microsatellite identification primer and method for genetic diversity of Tilapia | |
| CN114959056B (en) | SSR (simple sequence repeat) marker for identifying female procambarus clarkia and application thereof | |
| CN106119384A (en) | A kind of Aeromonas hydrophila method for nucleic acid analysis and the application in legal medical expert detects | |
| CN110607376A (en) | Patinopecten yessoensis living body sex identification method based on DNA molecular marker | |
| CN115181803A (en) | Taqman probe qPCR detection primer group for detecting chaulmoogra and application | |
| CN113481303A (en) | Method for auxiliary detection of growth traits of cattle ACTR3 gene CNV marker and application thereof | |
| CN113637766A (en) | InDel molecular marker related to genetic sex identification of micropterus salmoides and application thereof | |
| CN113528676A (en) | Method for identifying physiological sex of fish in early development stage by using 5SrRNA | |
| CN109112194B (en) | Application of cynoglossus semilaevis sex label piR-mmu-72274 | |
| CN113278707A (en) | Round-mouth copperfish mitochondrial genome control region amplification primer and application thereof | |
| CN105838788A (en) | Real-time fluorescence PCR specific detection system and applications of Micromesistius poutassou | |
| CN115232868B (en) | PCR primer, kit and method for emu sex identification | |
| CN110951892A (en) | SSR primer pair group, kit, identification method and application for identification of several sturgeon species | |
| CN110982823B (en) | Paralichthys olivaceus oocyte specific gene figla and application thereof | |
| CN116804225B (en) | Ji Shi tilapia sex chromosome specific molecular marker, detection primer, kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |