CN111759857A - Application of GABRD methylation target in preparation of heroin relapse resistant medicine - Google Patents

Application of GABRD methylation target in preparation of heroin relapse resistant medicine Download PDF

Info

Publication number
CN111759857A
CN111759857A CN202010613914.0A CN202010613914A CN111759857A CN 111759857 A CN111759857 A CN 111759857A CN 202010613914 A CN202010613914 A CN 202010613914A CN 111759857 A CN111759857 A CN 111759857A
Authority
CN
China
Prior art keywords
heroin
gabrd
methylation
group
aza
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010613914.0A
Other languages
Chinese (zh)
Inventor
刘惠芬
洪青晓
徐文锦
刘婧
陈为升
朱华强
赖苗军
周文华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ningbo Kangning hospital (Ningbo Center for mental disease control and prevention, Ningbo Institute of microcirculation and anisodamine)
Original Assignee
Ningbo Institute of Microcirculation and Henbane
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ningbo Institute of Microcirculation and Henbane filed Critical Ningbo Institute of Microcirculation and Henbane
Priority to CN202010613914.0A priority Critical patent/CN111759857A/en
Priority to CN202111567963.6A priority patent/CN114214396A/en
Publication of CN111759857A publication Critical patent/CN111759857A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to an application of a GABRD methylation target spot in preparation of a heroin relapse resistant medicament, and compared with the prior art, the invention has the advantages that: the DNA methyltransferase inhibitor can reduce the methylation level of the GABRD gene and effectively reduce the heroin relapse behavior, which indicates that the methyltransferase inhibitor taking the GABRD methylation as a target point can be applied to the treatment of heroin addiction and relapse.

Description

Application of GABRD methylation target in preparation of heroin relapse resistant medicine
Technical Field
The invention relates to a GABRD methylation target, in particular to application of a methyltransferase inhibitor taking GABRD methylation as the target in preparing a heroin relapse resistant medicament.
Background
Opioid addiction, particularly heroin addiction, causes significant medical and economic hazards. According to investigation data of drugs and crime problem offices (UNODC) of the United nations, 10.96 thousands of drug breaking and acquiring crime cases all the year round in 2018 are shown in the world, 13.74 thousands of criminal suspects are caught, 67.9 tons of various drugs are paid, the heroin addicts still occupy a large proportion, and the heroin abuse situation is severe. Heroin long-term activation of opioid receptors allows compensatory adaptation of both opioid and non-opioid receptor systems, leading to addiction. The chronic use of heroin for a long period of time leads to strong physical and mental dependence, which leads to a strong craving for re-use, which is the main cause of a high relapse rate. The midbrain Ventral Tegmental Area (VTA) to nucleus accumbens (NAc) brain region dopaminergic system is the major pathway for drug reward that is currently recognized. NAc is an important nucleus in the reward circuit of the brain, the mesospiny neuron in the nucleus accumbens, and produces gamma-aminobutyric acid (GABA), a major central nervous system inhibitory neurotransmitter. The A-type GABA receptor subtype (GABRD) gene is proved to be related to diseases such as epilepsy and convulsion, and the methylation of the gene is found to be possibly involved in addiction and relapse of drugs such as cocaine. Therefore, the research on the heroin addiction intervention mechanism and the screening of drug treatment targets are beneficial to promoting the prevention and treatment of heroin addiction and relapse.
Disclosure of Invention
The invention aims to solve the technical problem of providing the application of a methyltransferase inhibitor taking GABRD methylation as a target point in preparing anti-heroin relapse medicines in view of the current technical situation.
The technical scheme adopted by the invention for solving the technical problems is as follows: the application of GABRD methylation as a target spot in preparing anti-heroin relapse drugs is characterized in that: the drug can reduce the methylation level of the target fragment of the GABRD gene.
Further, the methylation transferase inhibitor taking GABRD methylation as a target point is a compound I, and the structural formula of the methylation transferase inhibitor is shown as the following：
Figure RE-GDA0002659299350000021
Furthermore, the medicine is a preparation prepared by taking a methyltransferase inhibitor as a compound I as an active ingredient and adding pharmaceutically acceptable auxiliary materials or auxiliary ingredients.
Further, the drug is an injectable medicament.
Compared with the prior art, the invention has the advantages that: the DNA methyltransferase inhibitor can reduce the methylation level of the GABRD gene, can effectively reduce the relapse behavior of heroin, shows that the methyltransferase inhibitor can be applied to the treatment of heroin addiction, and develops a medicament for treating heroin addiction and relapse by taking the GABRD gene methylation as a target point.
Drawings
FIG. 1A is the record of effective nasal triggers and ineffective nasal triggers in the construction of Heroin model of the present invention (Heroin self-administered group Heroin; physiological saline passive administered group Control group);
FIG. 1B is a graph showing the number of injection needles recorded in the construction of the heroin model of the present invention (heroin self-administration group: heronelf-administration group; heroin passive administration group: Yoke heroin group; physiological saline passive administration group: Control group);
FIG. 2 is a diagram showing the GABRD candidate fragment and the position information of the to-be-detected site according to the present invention;
FIG. 3 shows the changes of methylation of the GABRD gene of the present invention in the Heroin self-administration group (Heroin self-administration group), the Heroin passive administration group (Yoke Heroin group) and the Control group (Control group);
FIG. 4 is a graph showing the results of significant reduction in methylation level of CG3 test site in the heroin self-administered group in the GABRD gene of the present invention;
FIG. 5 is a graph showing the results of significant reduction in methylation level of CG4 test site in the heroin self-administered group in the GABRD gene of the present invention;
FIG. 6 is a graph showing the results of significant reduction in methylation level of CG5 test site in the heroin self-administered group in the GABRD gene of the present invention;
FIG. 7 shows the expression of mRNA in the Heroin self-administration group (Heroin self-administration group), the Heroin passive administration group (Yoke Heroin group) and the Control group (Control group) by the GABRD of the present invention;
FIG. 8 shows the protein expression of the GABRD of the present invention in the Heroin self-administration group (Heroin self-administration group), the Heroin passive administration group (Yoke Heroin group) and the Control group (Control group);
FIG. 9 shows the results of methylation function validation of candidate fragments of the GABRD gene and fragments (Pro is pGL3-promoter plasmid, F-Luc is Firefly luciferase, R-Luc is Renilla luciferase, pGL3-promoter No-load control group, Pro-GABRD is GABRD insert group pGL3-promoter-GABRD, Me-Pro-GABRD is methylated GABRD insert group, pGL3-promoter-GABRD methylated group;
FIG. 10 is a graph showing the effect of peripherally injected methyltransferase inhibitor 5 ' AZA of the present invention on the resuscitative behavior of Heroin ignition after the extinction of Heroin self-administration in rats (Active: number of Active nasal triggers; Inactive: number of Inactive nasal triggers; Heroin: Heroin; SAL: normal saline; 5 ' AZA: 5-AZA-2 ' -deoxycytidine, 5-AZA-2-deoxycytidine);
FIG. 11 is a graph of the effect of peripherally injected methyltransferase inhibitor 5 ' AZA of the present invention on conditioned cue-induced relapse behavior after the self-administration of Heroin in rat bars has subsided (Active: number of effective nasal triggers; Inactive: number of ineffective nasal triggers; Heroin: Heroin; SAL: normal saline; 5 ' AZA: 5-AZA-2 ' -deoxycytidine, 5-AZA-2-deoxycytidine);
FIG. 12 is a graph showing the effect of microinjection of 5 ' AZA, a methyltransferase inhibitor, into the brain region of NAc according to the present invention on the resuscitative behavior of Heroin elicitation in rats (Active: number of Active nasal contacts; Inactive: number of Inactive nasal contacts; Her: Heroin, Heroin; Sal: physiological Saline, Saline; aCSF: vehicle agent; 5 ' AZA: 5-AZA-2 ' -deoxycytidine, 5-AZA-2-deoxycytidine);
FIG. 13 is a graph showing the effect of microinjection of methyltransferase inhibitor 5 ' AZA of the present invention on the methylation of the GABRD gene in the brain region of NAc (Her: Heroin, Heroin; Sal: Saline, Saline; aCSF: vehicle; 5 ' AZA: 5-AZA-2 ' -deoxycytidine, 5-AZA-2-deoxycytidine);
FIG. 14 is a graph of the effect of NAc brain region injection of the methyltransferase inhibitor 5 ' AZA of the present invention on GABRD protein expression (Her: Heroin, Heroin; Sal: Saline, Saline; aCSF: vehicle; 5 ' AZA: 5-AZA-2 ' -deoxycytidine, 5-AZA-2-deoxycytidine).
Detailed Description
The invention is described in further detail below with reference to the accompanying examples.
The purity of the heroin used in the embodiment of the invention is 98%, and the heroin purity is provided by a material evidence identification center of the ministry of public security.
Example 1 construction of a model for intravenous self-administration of heroin
Intravenous Self-Administration (Intravenous Drug Self-Administration) is one of the most classical animal models for studying Drug addiction, and the Intravenous Self-Administration model is a classical animal model reflecting the active Drug seeking and Administration behaviors of a user, and the Drug Administration motivation and the active compulsive Administration behaviors can be examined by using experimental animals.
The classical rat heroin self-administration model can well simulate the heroin ingestion behavior of a patient who takes drug clinically, the rat can generate self-administration to the heroin after training, and meanwhile, the continuously rising behavior reaction rate and the dosage to the heroin in the training process can reflect the compulsive drug seeking behavior of the drug-taking patient from the beginning of contacting with the heroin to the addiction of a large amount of heroin.
We used the following method to establish a model for rat self-administration: firstly, SD male rats are subjected to jugular vein cannulation operation, a section of PE tube is inserted into the right jugular vein and penetrates out of the body through the back, and the SD male rats are subjected to antibiosis and recovery for more than one week after the operation. Subsequently, adopt with external sound insulation light-proof self dosing cage, be equipped with in the cage that the nose touches the lamp and is used for writing down effective nose and touch with invalid nose, the syringe pump is connected to top cage lamp, forms nose and touches lamp, cage lamp and syringe pump integrated device. Before self-administration training, a syringe on a syringe pump is filled with 5mL of heroin solution, and after a rat is placed in a cage, a connecting pipe on the cage is connected with a back cannula of the rat. The training procedure is FR-1 intensive training, the procedure is started, a yellow signal lamp in an effective nose touch is lightened at the moment, after a rat touches the effective nose, the signal lamp is extinguished, a cage lamp is lightened, a needle of heroin is obtained along with the peristaltic sound of the injection pump, the cage lamp is continuously lightened for 5s every time, and the dosage of the heroin is as follows: 0.1mg/kg on days 1-2, 0.05mg/kg on days 3-6, and 0.025mg/kg on days 7-14. In the next 20s, the effective nasal contact is in the refractory period (Time out), namely, the rats touch the effective nasal contact only during the period to record data on a computer, but no heroin can be really obtained, the next cycle is carried out after the refractory period, while training 4h by using the heroin self-administered rats, the rats in the passive heroin administered group are also injected with the same amount of heroin, and the rats in the passive saline group are simultaneously injected with the same amount of saline as a normal control group. The self-administration training is carried out for 1 time and 4 hours every day, the effective nasal contact reaction rate and the injection amount are obviously increased for 14 continuous days, and the effective nasal contact number is not more than 10% after the last 3 days (see figure 1A). As can be seen from fig. 1B, after 14 days of self-administration training, the number of heroin injection needles of rats in the heroin self-administration group and the passive administration group is significantly higher than that in the normal saline group, and is maintained above 40 needles (indicating that a stable heroin self-administration model has been successfully established, which meets the requirements of subsequent experiments.
Example 2Illumina HiSeq sequencing
After stable establishment of the heroin self-administration model for 12h, rats were administered intraperitoneally with pentobarbital sodium and the brain area of NAc was sacrificed and isolated after deep anesthesia. A Heroin self-administration group (Heroin self-administration), a Heroin passive administration group (Yoke Heroin group) and a passive saline Control group (Control) were established (n is 3 in each group). The genome DNA of the tissue sample is extracted by a PerkinElmer full-automatic nucleic acid extractor (Shanghai Limited product of Perkin Elmer medical diagnosis), and the concentration of the obtained DNA is detected by a Qubit4.0 nucleic acid protein determinator. And (3) carrying out end repair and adding a sequencing linker after DNA fragmentation and purification, then carrying out Bisulfit treatment, carrying out library construction and quality inspection after amplification, and then carrying out Illumina HiSeq whole genome methylation sequencing on a computer. Finally, differential methylation sites and regions (DMR) are analyzed and screened, and the changes of methylation levels of each group are compared, so that DMR exists on the GABRD gene and is screened and found in chr 5: 172809066 and 172809129 regions were also located on the CpG52 island (see table I and fig. 2).
And the DMR sequence is:
CGGACAGCACCCGGGAGGCGGGAGAGAGGTCAGAGGGGTCCTCAGAACTGG AATAGCAGCACGCG；
table I: sequencing and detecting the DMR region information of the GABRD gene
Figure RE-GDA0002659299350000051
CGCCTGGCGACTCCAATCCCTCCCCAAAGCTCAGCGTTCAGCACCGAGGA CGGCGGACAGCACCCGGGAGGCGGGAGAGAGGTCAGAGGGGTCCTCAGAA CTGGAATAGCAGCACGCGCAAAGCAAAACTGGGTGGACCTAATGGGTGAA GACTCGGGGTTCTGGCAACTCGGAACTCTGCCCCACCGAGGGTGCCCGCC AAAGGACGAGTCCCTCCCGCCTCATATCGTCCCCGGCCCAGGAGCTGCTC ACCTGGCGCCATGGTGCGGCTGCGTGCACAGCAGAAGGAGCGGCAGCAGC AGCCAGCCCAGAACGTCCATGGCCTTGCGGGCTGTGCGCGGGACAGGTCC GGCTAGCCCCAGCGCAAGCAAAGTTGCTTCGCCTGCGGCCGCGCGGCGGC ACCAGAAGGGCGGGAGCGCGAAGGAGAGTGGAACGGGCGCGGGGGGAGGA CGGAACGTCGAGCCTGCCCCGCCCCGCCCCGCCCGGCGCTCCAGTCCCAC CCCCGCTCGCGCGCCCCACTGCACGCGGGAGGCTTCTGCGCACCGCATAG CACCGGGTGGTAGCTCCACCGCGCTCCCAGAGCCTCGCACACCGCG
Meanwhile, the nucleotide sequence can be correspondingly referred to SEQ ID NO.1 of the sequence table.
EXAMPLE 3 amplification of samples to detect changes in the DNA methylation level of the GABRD Gene
The rat heroin self-administration model was re-established as in example 1, and a heroin self-administration group (heroiself-administration), a heroin passive administration group (Yoke heroin group) and a passive saline Control group (Control) were established. Taking each group of NAc brain tissues, and extracting tissue DNA. DNA methylation level detection is carried out on 5 CpG sites in DMR of the CpG island region of the GABRD gene by adopting a bisulfite pyrosequencing technology. The basic principle of this technique: after a DNA sample is treated by bisulfite in the kit, a Polymerase Chain Reaction (PCR) is applied to amplify an upstream primer and a downstream primer by methylation specificity amplification, and then pyrophosphoric acid sequencing is carried out on an amplified product by a specificity sequencing primer, so that the methylation degree of each site is calculated. In the research, PyroMark Assay 2.0 software is adopted for primer Design, and PCR amplification primers and sequencing primers used for experiments are as follows:
(1) methylation specific Forward primer (Forward primer)
5’-Biotin-GTGGTTAAGGGTAAGAATGAAGAGA-3’，
(2) Methylation specific downstream primer (Reverse primer)
5’-Biotin-CCCATTAAATCCACCCAATTTTACTT-3’；
(3) Methylation specific Sequencing primer (Sequencing primer)
5’-CCACCCAATTTTACTTT-3’。
The specific steps of the amplification are as follows:
a. the genomic DNA of both the addicts and controls was Bisulfite converted using the Qiagen EpiTect bisufite Kit (Qiagen, # 59104).
b. And B, taking 10-20ng of the DNA sample transformed in the step A, adding the DNA sample into a Pyromark PCR Kit (Pyromark PCR Kit; Qiagen; #978703), adding the pair of GABRD gene CpG52 region methylation specific amplification primers, and carrying out PCR amplification under the conditions: firstly, denaturation at 95 ℃ for 3 min; then carrying out 40 cycles of reactions at 95 ℃ for 30s, 60 ℃ for 30s and 72 ℃ for 1 min; then the extension reaction was carried out at 72 ℃ for 7 min.
Figure RE-GDA0002659299350000061
c. Pyrosequencing detection, designing a program to be run in PyroMark Q48 software, importing the program into a U disk, and inserting the program into a USB interface of PyroMark Q48. And clicking the 'Sequence' displayed on the touch screen of the instrument, and loading the running program in the USB flash disk. Putting a cotton sliver absorbing waste liquid, and ensuring that the head and tail connection part is in the right left (9 o' clock) direction. And pushing a cover of the instrument open, opening the cover of each clip, selecting the clip to be poured, displaying a water drop icon on the selected clip, and selecting whether the current run is the last run. The reagents are added to each clip in sequence, depending on the volume of each reagent displayed on the touch screen. When the reagent is added into the card holder, please use the sample adding gun to adhere to the wall and add slowly, avoid generating bubbles. After adding the reagent, the lid of the clip is closed and locked. Clicking "Start" starts to test whether the cardholder functions properly, and a green arrow appears behind the passing cardholder. The loading disc is placed in the machine, care is taken to align the hole in the disc in a defined position, otherwise the machine will alarm. And screwing a fixing screw for fixing the sample loading disc. The beads were shaken and then applied to the loading disc using a continuous application gun fed with a random machine, 3. mu.l per well, 3 wells at a time. Mu.l of PCR product containing biotin label is added to the well of the loading disc, and if the amount of PCR product is less than 10. mu.l, 10. mu.l is supplemented with pure water to ensure that the magnetic beads are completely covered with the PCR product liquid. The Q48 program is run, clicking "Start". And when the operation is finished, the result can be automatically led into the USB flash disk, the USB flash disk is pulled out, the instrument is closed from the software, and then the instrument is closed. Finally, the methylation status of each site was analyzed using Pyro Q CpG software available from a pyrosequencer. Data from the results of the analysis obtained from the pyrosequencer (see FIG. 3 for example). The horizontal axis represents the order of dDNTP added, and the vertical axis represents the intensity of the fluorescence signal. Among these, blue was the best quality sequenced, yellow second, and red was the worst quality. However, if there is blue in one reaction, it is shown that the overall quality is not problematic, and the red and yellow results are normal. Analysis of the data using SPSS 16.0 found: significant correlation (R >0.5, P <0.01, see R values in the table of fig. 2) was found between the 5 sites tested (CpG1, CpG2, CpG3, CpG4 and CpG5), and thus the total methylation of CpG1-CpG5 was analyzed. The difference in methylation level of CpG52 region of GABRD gene between the passive group and the control group was found in the heroin-self-administered group, and as a result (see fig. 3, the methylation level of GABRD in the heroin-self-administered group was found to be significantly lower than that in the control group (P ═ 0.012) —, each site was compared and analyzed, and it was shown that the methylation level was significantly lower in all three sites CG3, CG4, and CG5 in the heroin-self-administered group relative to the control group (see fig. 4, 5, and 6).
Example 4 variation of mRNA expression levels of GABRD Gene in NAc brain region
The GBRD gene mRNA expression is detected by reverse transcription real-time quantitative PCR (RT-qPCR) of a Roche LightCycler 480 instrument. Extracting naloxone self-administered group, passive administered group and control group rat NAc brain tissue RNA, and using total RNA
Figure RE-GDA0002659299350000072
(Invitrogen; Thermo Fisher Scientific, Inc.) kit extraction. The total RNA was reverse transcribed to synthesize cDNA using the miScript IIRT kit (Qiagen gmbH). The qPCR primer nucleotide sequences are shown in table II, GAPDH gene as internal reference. The reaction system contained 5. mu.l of SYBR Green premix, 2. mu.l of primers (10. mu.M), 1.5. mu.l of lcDNA and 1.5. mu.l of water. The amplification conditions were: 95 ℃, 10min, 40 cycles: 95 ℃, 10S, 55 ℃, 15S and 72 ℃, 15S. Use 2-ΔΔCqMethods analysis RT-qPCR data was analyzed for relative changes in GABRD mRNA expression levels. The analysis of the results showed that the level of mRNA expression of the GABRD gene in the heroin-self-administered group was significantly increased as compared with the control group and the heroin-passively administered group, respectively (F)(3,24)＝9.065，P＝3.42E-4；F(2,24)10.238, P0.001, see fig. 7).
TABLE II qPCR primer sequence information
Figure RE-GDA0002659299350000071
Example 5 changes in protein expression levels of the GABRD Gene in the NAc brain region
Meanwhile, the expression level of GABRD protein in NAc brain region in the Heroin self-administration group (Heroin self-administration), the Heroin passive administration group (Yoke Heroin group) and the passive saline Control group (Control) was measured by Western Blot method. The detection method comprises the following steps: dissolve RIPA lysate (petun yunnan, P0013B) and mix well. An appropriate amount of lysate was taken, PMSF was added several minutes before use to give a PMSF final concentration of 1mM, 150 μ l of lysate was added to the tissue, homogenized using a homogenizer, and then repeatedly blown with a pipette to disrupt the tissue and lyse it sufficiently. Placing on ice for 30min, and vortexing every 10min to crack and fill tissueCentrifuging at 4 ℃ of 10000-; mixing the protein solution and loading buffer, placing in 100 deg.C water bath for 5min, centrifuging, placing on ice, and waiting for sample loading. SDS-PAGE separation gel is prepared, added into two gel-making glass plates and sealed by isopropanol. After the lower layer gel solidified, the isopropanol was poured off and ddH was used2And (4) after O washing, sucking dry and starting to prepare concentrated glue. Adding the concentrated glue into two glue-making glass plates, immediately inserting the comb without bubbles, and pulling out the comb after solidification. After a gel making groove is made, the gel making groove is placed on ice, and after the electrophoresis liquid is poured in, the sample loading is started, and 10-35 mu l of sample is loaded in each hole. The order of the samples was recorded and Runningbuffer (Tris 3.028g (25mM), Gly 14.413g (192mM), 10% SDS 10mL (0.1% SDS) was prepared in advance using ddH2And (4) metering the volume of O to 1000mL, and pre-cooling at 4 ℃. Transfer buffer (Tris 3.028 g) (25mM), Gly 14.413g (192mM), Methanol (Methanol)200mL with ddH2O is metered to 1000mL), and the solution is pre-cooled at 4 ℃. The upper layer glue is 60v for 30min, and the lower layer glue is 110v for 120 min. After electrophoresis, the gel needs to be rinsed in PBS for 2min, and then put into a membrane-transferring buffer solution for soaking and balancing. Soaking the sheared PVDF membrane in methanol for 2min, and then in ddH2Soaking in O for 2min, soaking in transferbuffer for 15min, placing the pad, membrane and gel, transferring from-to +. ice, 100v, 40min/70min, soaking in PBS for 3-5min, shearing, sealing with 5% defatted milk (0.75g milk powder +15mL PBS) at 37 deg.C for 1-2h, washing with 1 × PBS-T (1000mL 1 × PBS +1mL Tween-20) for 5-10min, incubating for three times, incubating for one antibody, internal reference (1: 5000), GABRD protein (diluted in 1: 1000), shaking at 4 deg.C, passing through refrigerator (5000), taking out the shaking table from refrigerator, washing membrane, 1 × PBST 5-10min, adding three times, adding 10000, preserving for 2min, preserving for 5min, and analyzing the difference of expression of protein by chemical light emission, and recording the difference of expression of the protein between the two times of the two antibodies (1:10000, 1 ×, and the difference of the expression of the protein between the two times of the two antibodies (fluorescence, development of the two proteins), and the fluorescence intensity of the two times of the two proteins (fluorescence, development and the two times of the three times of(2,3)21.942, P0.016) in multiple comparisons, indicating heroin as compared to control and passive heroin administration groups, respectivelyThe expression level of GABRD gene mRNA in the self-administration group is obviously increased (P ═ 0.016, P ═ 0.009, see FIG. 8).
Example 6 Dual luciferase reporter Gene experiments
The dual-luciferase reporter gene vector system contains two luciferase genes which can be expressed in the same cell at the same time, and comprises a firefly luciferase reporter gene and a Renilla luciferase reporter gene. The regulatory sequence of the target gene to be researched is cloned into an expression plasmid containing a reporter gene, then the recombinant plasmid is introduced into an appropriate cell line, and the induction effect of the target sequence on the gene expression is indirectly evaluated by measuring the expression level of the reporter gene.
In order to verify the biological function of a target sequence of the GABRD gene, test whether the target sequence has enhancer activity and detect the influence of sequence methylation on the activity, a dual-luciferase reporter gene experiment is carried out, 293T cell amplification culture is firstly carried out, and then a rat GABRD target DMR sequence is synthesized: CGGACAGCACCCGGGAGGCGGGAGAGAGGTCAGAGGGGTCCTCAGAACTGGAAT AGCAGCACGCG, the synthetic sequence was inserted into the PGL3-Promoter to construct a plasmid. The constructed product was methylated in vitro using the SssI kit (Thermo, EM 0821). Methylation identification is carried out by using an EpiJETDNA Methylation Analysis Kit, the Methylation effect is verified by electrophoresis, then plasmids which are successfully constructed and successfully methylated are transfected into 293T cells, and dual-luciferase reporter gene detection is carried out after 48h, and the two plasmids are grouped as follows: pGL3-promoter No-load control (Pro); GABRD insertion set pGL3-promoter-GABRD (Pro-GABRD); methylated GABRD insert set pGL3-promoter-GABRD methylation set (Me-Pro-GABRD). Before detection, the culture medium is discarded for rinsing, 100 mul of diluted 1 XPLB is added into each hole, and the cells are cracked by shaking for 15min at the normal temperature of a shaking table. The lysate was collected into a 1.5mL Ep tube, centrifuged at 10000g for 5min, and the supernatant was collected for use. Opening a multifunctional microplate reader (TECAN InfiniteM1000 Pro)), opening software, adding 10mL of the pre-mixed luciferase test reagent LAR II into a 15mL centrifuge tube, and putting the centrifuge tube into an A channel suction tube; 200. mu.l of 50X Stop&
Figure RE-GDA0002659299350000091
Substrate added to 10mL Stop&
Figure RE-GDA0002659299350000092
In Buffer, configured as Stop&Glo Reagent, and Stop&The Glo Reagent was added to a 15mL centrifuge tube, the B channel pipette was placed, the software was turned on, and the parameters were set. Adding 50 μ l of the supernatant into each well of a white opaque 96-well enzyme-labeled plate, placing into a multifunctional enzyme-labeled instrument, starting detection, adding 50 μ l of the mixed luciferase test reagent LARII into each well, measuring data after 2s, and adding 50 μ l of Stop into each well&Glo Reagent, standing for 2s, measuring data, and comparing the activation degrees of target reporter genes among different samples according to the obtained ratio; then analyzed using Graphpad prism (Graphpad Software, san Diego, Calif.) Software, statistically tested for One-way anova followed by SNK for differences between groups, and P<0.05 is the screening criterion for significant differences. As shown in fig. 9, compared with the Pro group, the fluorescence ratio of the Pro-GABRD group is significantly increased, and the fluorescence ratio of the methylation group Me-Pro-GABRD is significantly decreased, which suggests that the DMR sequence of the GABRD gene has a significant enhancer-like function, and the enhancer-like activity of the fragment is significantly inhibited after methylation. The results show that the target DMR sequence of GABRD acts as an enhancer, while the methylation of GABRD reduces its gene expression promoter function.
Example 75' Effect of AZA on the Retention conditioned cue-induced or heroin-induced relapse behavior in rat treated with heroin self-administration
The re-inhalation is the difficulty for clinically treating the heroin addiction, and after the heroin patient is detoxified and abstained, the heroin patient is induced by contacting with the related environment of the previous drug taking, the drug itself or the drive of the poison friends, so that the impulsion of taking the heroin is generated, and the re-inhalation of the heroin is finally caused. The rat relapse model can better reflect the behavior of relapse of heroin (re-addiction) caused by the fact that a patient in the heroin withdrawal period contacts the environment related to previous heroin ingestion or the heroin per se again.
(1) Effect of peripheral injection of 5' AZA on the Return to suckback behavior after Adenosine self-administered rats regressed
To evaluate whether 5' AZA has an intervention effect on the relapse behavior of heroin addicted rats, a conditioned cue or a heroin ignition induced rat relapse model is established respectively, and the relapse behavior is tested. First, rats were trained to undergo a 14 day regimen of Heroin self-administration training in self-administration operating cages using the FR1 procedure (4h/days), all experimental rats were trained to 9 days of Heroin or saline self-administration training, and then on day 10, the Heroin self-administered rats were randomly divided into a Heroin +5-Aza-dc administration group (Heroin/5 'Aza) and a Heroin + saline group (Heroin/SAL), the Heroin/5' Aza group rats were given 5 'Aza (5mg/kg, s.c.) half an hour before the daily regimen training, and the Heroin/SAL group rats were given saline half an hour before the daily regimen training instead of 5' Aza treatment for 8 consecutive days. Statistical analysis shows that peripheral injection of DNA methyltransferase inhibitor 5' AZA can significantly reduce the number of re-inhalation effective nasal-tactile responses (F) of heroin-induced ignition in self-administered rats(2,6)＝9.249，P<0.05, see fig. 10), whereas peripheral injection of 5' AZA tended to decrease the effective nasal contact number of the heroin-self-administered rats on conditioned cue-induced relapse, but was not statistically significant (F)(2,6)0.012, P0.915, see fig. 11). The results suggest that peripheral injection of 5' AZA can effectively inhibit the recovery of heroin foraging behavior.
(2) Effect of Central injection of 5' AZA on the Return to suckback behavior in heroin-dosed rats
To further evaluate whether the effect of 5' AZA on the relapse behavior of heroin self-dosed rats was centrally acting, we re-established a conditioned cue or heroin elicitation induced rat relapse model and performed a test of relapse behavior. First, all experimental rats were trained for 14 days of heroin or saline self-administration using the FR1 procedure (4h/days) and then regressed, starting on the 10 th day of the regression training, by bilaterally microinjecting 5 ' AZA (1 ug/side, 1mg/ml concentration) or aCSF in the NAc brain area half an hour prior to the training, for 14 days of regression, and the rats that were self-administered with heroin and saline were randomly divided into a heroin +5-AZA-dc administration group (Her/5 ' AZA), a heroin + saline + physiological saline group (Her/aCSF), a physiological saline +5-AZA-dc administration group (Sal/5 ' AZA) and a physiological saline + vehicle (Sal/aCSF). Statistical analysis showed that 5-Aza-dC (F (1,19) ═ 14.402, P ═ 0.001), Heroin (F (1,19) ═ 28.475, P ═ 5.46E-5) and interaction (Heroin and 5-Aza-dC) (F (1,19) ═ 16.367, P ═ 8.40E-4) all resulted in a change in the number of effective rhinobyes as the main effect, and multiple comparisons showed a significant decrease in the number of effective rhinobyes due to Heroin-induced re-inhalation in the Heroin/5' Aza group compared to the Heroin/aCSF group (P ═ 2.45E-5, see fig. 12). The results suggest that central injection of 5' AZA can effectively inhibit the recovery of the foraging behavior of heroin.
Example 8 Effect of Central injection of 5' AZA on DNA methylation and protein expression of the GABRD Gene in the brain region of NAc in rats that repopulated the regression of heroin self-administration
All rats in example 7 were sacrificed immediately after the relapse behavior test, and the NAc brain region was taken to extract DNA and protein, respectively, and the DNA was assayed for methylation level of the target fragment of the GABRD gene by the pyrosequencing method. The results showed a significant reduction in methylation levels of the fragments of interest of the Heroin/5' AZA group GABRD genes compared to the Heroin/aCSF group (results are shown in fig. 13: 44.71 ± 1.19, 32.68 ± 5.29, P ═ 0.038). Also the methylation level of the target fragment of the Sal/5' AZA group GABRD gene was significantly reduced compared to Sal/aCSF (36.99 + -1.17, 11.36 + -2.56, P-4.64E-4). Furthermore, there was a tendency for increased methylation in Heroin/SAL versus Control/SAL groups, but no statistical difference.
In addition, the protein expression level of the extracted protein is detected by WB, and the expression level of the Heroin/5' AZA group GABRD protein is found to be remarkably increased compared with the Heroin/aCSF group (the result is shown in figure 14: P ═ 0.018). At the same time, the methylation level of the target fragment of the Sal/5' AZA group GABRD gene was also significantly increased compared to Sal/aCSF (P0.010). The results suggest that central injection of 5 'AZA effectively inhibited the recovery of heroin's foraging behavior, likely acting in part by decreasing methylation of the GABRD gene to increase its protein expression level.
Sequence listing
<110> research institute of microcirculation and scopolia drugs in Ningbo city
Application of GABRD methylation target in preparation of heroin relapse resistant medicines
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>596
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
cgcctggcga ctccaatccc tccccaaagc tcagcgttca gcaccgagga cggcggacag 60
cacccgggag gcgggagaga ggtcagaggg gtcctcagaa ctggaatagc agcacgcgca 120
aagcaaaact gggtggacct aatgggtgaa gactcggggt tctggcaact cggaactctg 180
ccccaccgag ggtgcccgcc aaaggacgag tccctcccgc ctcatatcgt ccccggccca 240
ggagctgctc acctggcgcc atggtgcggc tgcgtgcaca gcagaaggag cggcagcagc 300
agccagccca gaacgtccat ggccttgcgg gctgtgcgcg ggacaggtcc ggctagcccc 360
agcgcaagca aagttgcttc gcctgcggcc gcgcggcggc accagaaggg cgggagcgcg 420
aaggagagtg gaacgggcgc ggggggagga cggaacgtcg agcctgcccc gccccgcccc 480
gcccggcgct ccagtcccac ccccgctcgc gcgccccact gcacgcggga ggcttctgcg 540
caccgcatag caccgggtgg tagctccacc gcgctcccag agcctcgcac accgcg 596

Claims (4)

1. The application of a methylation transferase inhibitor 5' AZA taking GABRD methylation as a target spot in preparing anti-heroin relapse medicines is characterized in that: the agent is to reduce the methylation level of a target fragment of the GABRD gene.
2. Use according to claim 1, characterized in that: the methylation transferase inhibitor taking GABRD methylation as target point is combinedCompound I, of the formula:
Figure FDA0002561388570000011
3. use according to claim 2, characterized in that: the drug is a preparation prepared by taking a methylation transferase inhibitor taking GABRD methylation as a target spot as an active ingredient and adding pharmaceutically acceptable auxiliary materials or auxiliary ingredients.
4. Use according to claim 3, characterized in that: the medicament is an injectable medicament.
CN202010613914.0A 2020-06-30 2020-06-30 Application of GABRD methylation target in preparation of heroin relapse resistant medicine Pending CN111759857A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202010613914.0A CN111759857A (en) 2020-06-30 2020-06-30 Application of GABRD methylation target in preparation of heroin relapse resistant medicine
CN202111567963.6A CN114214396A (en) 2020-06-30 2020-06-30 Application of GABRD methylation as heroin relapse resisting target

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010613914.0A CN111759857A (en) 2020-06-30 2020-06-30 Application of GABRD methylation target in preparation of heroin relapse resistant medicine

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN202111567963.6A Division CN114214396A (en) 2020-06-30 2020-06-30 Application of GABRD methylation as heroin relapse resisting target

Publications (1)

Publication Number Publication Date
CN111759857A true CN111759857A (en) 2020-10-13

Family

ID=72723292

Family Applications (2)

Application Number Title Priority Date Filing Date
CN202111567963.6A Pending CN114214396A (en) 2020-06-30 2020-06-30 Application of GABRD methylation as heroin relapse resisting target
CN202010613914.0A Pending CN111759857A (en) 2020-06-30 2020-06-30 Application of GABRD methylation target in preparation of heroin relapse resistant medicine

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN202111567963.6A Pending CN114214396A (en) 2020-06-30 2020-06-30 Application of GABRD methylation as heroin relapse resisting target

Country Status (1)

Country Link
CN (2) CN114214396A (en)

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3873698A (en) * 1973-10-10 1975-03-25 Addiction Research And Treatme Method of combatting morphine addiction and toxification
US20070014734A1 (en) * 2005-01-31 2007-01-18 O'donnell John P Glucuronidated nebivolol metabolites
CN101305997A (en) * 2008-07-01 2008-11-19 昆明亚灵生物科技有限公司 Medicament for treating nerve dysfunction after refraining opium type material
CN101396353A (en) * 2007-09-24 2009-04-01 袁才尉 Use of baclofen in withdrawal treatment of opium drug
WO2011011186A2 (en) * 2009-07-22 2011-01-27 The Board Of Trustees Of The University Of Illinois Hdac inhibitors and therapeutic methods using the same
CN104968347A (en) * 2012-10-04 2015-10-07 Ab科学有限公司 Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors
WO2016034079A1 (en) * 2014-09-04 2016-03-10 四川海思科制药有限公司 Use of gabaa receptor reinforcing agent in preparation of sedative and anesthetic medicament
EP3034620A1 (en) * 2014-12-17 2016-06-22 Diaxonhit Compositions and methods for diagnosing thyroid cancer
CN108289965A (en) * 2015-10-01 2018-07-17 戈勒尼股份有限公司 The targeted expression and its application method of chloride channel
CN110177544A (en) * 2016-11-29 2019-08-27 普尔泰克健康有限公司 For delivering the excretion body of therapeutic agent

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3873698A (en) * 1973-10-10 1975-03-25 Addiction Research And Treatme Method of combatting morphine addiction and toxification
US20070014734A1 (en) * 2005-01-31 2007-01-18 O'donnell John P Glucuronidated nebivolol metabolites
CN101396353A (en) * 2007-09-24 2009-04-01 袁才尉 Use of baclofen in withdrawal treatment of opium drug
CN101305997A (en) * 2008-07-01 2008-11-19 昆明亚灵生物科技有限公司 Medicament for treating nerve dysfunction after refraining opium type material
WO2011011186A2 (en) * 2009-07-22 2011-01-27 The Board Of Trustees Of The University Of Illinois Hdac inhibitors and therapeutic methods using the same
CN104968347A (en) * 2012-10-04 2015-10-07 Ab科学有限公司 Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors
WO2016034079A1 (en) * 2014-09-04 2016-03-10 四川海思科制药有限公司 Use of gabaa receptor reinforcing agent in preparation of sedative and anesthetic medicament
EP3034620A1 (en) * 2014-12-17 2016-06-22 Diaxonhit Compositions and methods for diagnosing thyroid cancer
CN108289965A (en) * 2015-10-01 2018-07-17 戈勒尼股份有限公司 The targeted expression and its application method of chloride channel
CN110177544A (en) * 2016-11-29 2019-08-27 普尔泰克健康有限公司 For delivering the excretion body of therapeutic agent

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
F. SORM AND J. VESEL: "Partial Reversal of Toxic Efects of 5-Azacytidine by 6-Azauridine in Normal Mice", 《BREVI COMUNIEAZIONI》 *
HAI-SHUI SHI ET AL: "Reconsolidation of a cocaine associated memory requires DNA methyltransferase activity in the basolateral amygdala", 《SCIENTIFIC REPORTS》 *
JIAN-JUN ZHANG ET AL: "Okadaic acid blocks the effects of 5-aza-2-deoxycytidine on consolidation, acquisition and retrieval of morphine-induced place preference in rats", 《NEUROPHARMACOLOGY》 *
JIN HAN ET AL: "Effect of 5-aza-2-deoxycytidine microinjecting into hippocampus and prelimbic cortex on acquisition and retrieval of cocaine-induced place preference in C57BL/6 mice", 《EUROPEAN JOURNAL OF PHARMACOLOGY》 *
QINGXIAO HONG ET AL: "Role of GABRD Gene Methylation in the Nucleus Accumbens in Heroin-Seeking Behavior in Rats", 《FRONTIERS IN PHARMACOLOGY》 *
师海波等主编: "《最新临床药物手册第4版---配合2015版药典》", 31 October 2016, 辽宁科学技术出版社 *
常城等: "地西他滨联合自体CIK细胞治疗2例高龄急性髓系白血病的疗效观察", 《中国实验血液学杂志》 *
张建永等: "国外针刺戒毒研究", 《西部中医药》 *
李生斌主编: "《中华民族基因组多态现象研究 成瘾基因组学》", 30 June 2016, 西安交通大学出版社 *

Also Published As

Publication number Publication date
CN114214396A (en) 2022-03-22

Similar Documents

Publication Publication Date Title
US10975373B2 (en) Micro-RNAS and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone-associated medical conditions
US10238681B2 (en) Micro-RNAs and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone-associated medical conditions
US10919929B2 (en) Glucocorticoid inhibitors for treatment of prostate cancer
Haghparast et al. Changes in phosphorylation of CREB, ERK, and c-fos induction in rat ventral tegmental area, hippocampus and prefrontal cortex after conditioned place preference induced by chemical stimulation of lateral hypothalamus
Zhao et al. Mu opioid receptors in the medial preoptic area govern social play behavior in adolescent male rats
Hurd et al. Molecular genetics and new medication strategies for opioid addiction
Li et al. Expression of miRNAs in Serum Exosomes versus Hippocampus in Methamphetamine‐Induced Rats and Intervention of Rhynchophylline
JP2022521997A (en) Use of circular RNA in the preparation of drugs to treat systemic lupus erythematosus
Wang et al. CNS tumor with BCOR internal tandem duplication: Clinicopathologic, molecular characteristics and prognosis factors
Brolin et al. Chronic administration of morphine using mini-osmotic pumps affects spatial memory in the male rat
CN111759857A (en) Application of GABRD methylation target in preparation of heroin relapse resistant medicine
Escelsior et al. Evidence of alterations of Beta-endorphin levels and Mu-opioid receptor gene expression in bipolar disorder
Kim et al. Transcriptional Activation, Deactivation and Rebound Patterns in Cortex, Hippocampus and Amygdala in Response to Ketamine Infusion in Rats
Zhao et al. METTL3‐mediated m6A modification of circPRKAR1B promotes Crohn's colitis by inducing pyroptosis via autophagy inhibition
Wang et al. Granulosa cell‐layer stiffening prevents escape of mural granulosa cells from the post‐ovulatory follicle
Odegaard In Utero and Postnatal Oxycodone Exposure: Implications for Intergenerational Effects
US10066269B2 (en) Methods for detecting and treating multiple myeloma
He et al. Transgenic increase in the β‐endorphin concentration in cerebrospinal fluid alleviates morphine‐primed relapse behavior through the μ opioid receptor in rats
Sweeney et al. Interleukin 11 therapy causes acute heart failure and its use in patients should be reconsidered
WO2018094325A1 (en) Therapeutic modulation of oncogenes by pharmacologic top2 targeting for cancer
CN113846151B (en) Method for diagnosing drug addiction, method for screening therapeutic agent for drug addiction, and pharmaceutical composition for preventing or treating drug addiction
Fouyssac Behavioural and cellular basis of the vulnerability to develop compulsive heroin seeking habits
Ghose et al. Adaptation to ARF6-depletion in KRAS-driven PDAC is abolished by targeting TLR2
Andraka Characterizing a Unique OPRM1 Expressing Neuronal Population in the Rat Nucleus Accumbens
Logan et al. Sex-specific Concordance of Striatal Transcriptional Signatures of Opioid Addiction in Human and Rodent Brains

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20211217

Address after: 315010 No. 42, northwest street, Haishu District, Ningbo City, Zhejiang Province

Applicant after: Ningbo Kangning hospital (Ningbo Center for mental disease control and prevention, Ningbo Institute of microcirculation and anisodamine)

Address before: 315010 No. 42, northwest street, Haishu District, Ningbo City, Zhejiang Province

Applicant before: Ningbo Institute of Microcirculation and Henbane

RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20201013