CN111748552A - Kit for detecting five infant diarrhea disease series viruses and application thereof - Google Patents

Kit for detecting five infant diarrhea disease series viruses and application thereof Download PDF

Info

Publication number
CN111748552A
CN111748552A CN202010542570.9A CN202010542570A CN111748552A CN 111748552 A CN111748552 A CN 111748552A CN 202010542570 A CN202010542570 A CN 202010542570A CN 111748552 A CN111748552 A CN 111748552A
Authority
CN
China
Prior art keywords
nucleotide sequence
sequence shown
seq
virus
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010542570.9A
Other languages
Chinese (zh)
Inventor
吴诗品
金宁一
李体远
李昌
杜寿文
田明尧
任琴
张星艳
王宇航
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Military Veterinary Research Institute Academy Of Military Medical Sciences
Shenzhen Peoples Hospital
Original Assignee
Military Veterinary Research Institute Academy Of Military Medical Sciences
Shenzhen Peoples Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Military Veterinary Research Institute Academy Of Military Medical Sciences, Shenzhen Peoples Hospital filed Critical Military Veterinary Research Institute Academy Of Military Medical Sciences
Publication of CN111748552A publication Critical patent/CN111748552A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the field of biological detection, in particular to a very fast detection kit for establishing and simultaneously detecting series viruses of infantile diarrhea, such as norovirus GI type and GI/GII type (NV GI, NV GI/GII), human astrovirus (HAstV), rotavirus group A (RV) and enteroadenovirus (EAdV) and application thereof. Compared with other fluorescent quantitative PCR, the established method can obtain results within half an hour, can achieve clinical rapid detection, is expected to realize real POCT, and has good application prospect.

Description

Kit for detecting five infant diarrhea disease series viruses and application thereof
Technical Field
The invention relates to the field of biological detection, in particular to a kit for detecting five infant diarrhea disease series viruses and application thereof.
Background
The infantile diarrhea is a common disease and a frequently encountered disease affecting the health of infants worldwide. Viral diarrhea is a major cause of acute severe diarrhea in infants and young children worldwide, and the disease is also a major disease of infant death in developing countries. The viruses causing infantile diarrhea mainly comprise norovirus, human astrovirus, rotavirus, enteroadenovirus and the like.
Norovirus, also known as Norwalk Viruses (NV), is a prototype representative of Norovirus (NV) of the genus Norovirus in the family human caliciviridae (humancinivirus, HuCV). It is a group of virus particles with similar forms and slightly different antigenicity. NV is a single-stranded positive-strand RNA virus, the diameter of the particle is about 26-35 nm, the particle is free of an envelope, the surface is rough and spherical, and the particle is in icosahedral symmetry. The lack of significant morphological features under electron microscopy, negative staining electron micrographs, NV, is a small, circular structure virus with a typical feathered outer edge, pitted surface. Isolated from the stool of patients with acute gastroenteritis, cannot be cultured in cells or tissues, and there is no suitable animal model. NV infectious diarrhea is diarrhea caused by norovirus, which is prevalent worldwide, and infections occur all year round, mainly in adults and school-age children, and are high in incidence in cold seasons. In all outbreaks of non-bacterial diarrhea in the united states each year, 60-90% are caused by NV. Similar results are seen in developed countries such as the Netherlands, British, Japan, Australia, etc. In China, the detection rate of NV is about 15% in diarrhea children under 5 years old, and serum antibody level survey shows that the infection of NV is very common in China. NV infectious diarrhea has the characteristics of acute onset, high transmission speed, wide range of involvement and the like, and is the main cause of outbreak of nonbacterial diarrhea. NV is highly infectious, mainly in intestinal transmission, and can be transmitted through polluted water sources, food, articles, air and the like, and often causes collective outbreaks in communities, schools, restaurants, hospitals, nursery centers, orphaned old homes, military troops and the like.
Human Astrovirus (HAstV) belongs to the genus of mammalian Astrovirus in the family of astroviridae, is a single positive strand RNA virus, and was isolated in 1975 from feces of diarrhea infants, and has a spherical shape with a diameter of 28-35nm, no envelope, a star-shaped surface structure under an electron microscope, and 5-6 angles. The virus is distributed worldwide, is spread through feces and mouth, is one of the important pathogens causing acute viral enteritis of infants, old people and people with low immune function, and the pathogenicity of the virus is increasingly emphasized. The disease is a self-healing disease, and when most patients have symptoms for 2 to 3 days, the symptoms are gradually relieved, but few symptoms are aggravated to cause dehydration.
Rotavirus (RV) is a double-stranded ribonucleic acid virus belonging to the reoviridae family, and is one of the major pathogens causing infantile diarrhea. The number of infant deaths worldwide due to rotavirus infection is about 900000 people each year, most of which occur in developing countries. In China, about 4000 million infants (including newborn infants) within 0-2 years old suffer from rotavirus infectious gastroenteritis every year, 1/4 which accounts for the number of infants is the most main pathogen causing severe diarrhea of infants. There are seven rotaviruses, which are numbered A, B, C, D, E, F and G in English letters. Among them, species a is the most common one, and this is caused in more than 90% of cases of human rotavirus infection. The infection route is a fecal-oral route, and mainly infects epithelial cells of the small intestine, thereby causing cell damage and causing diarrhea. The clinical manifestations are acute gastroenteritis and permeable diarrhea, the course of disease is generally 6-7 days, fever lasts for 1-2 days, vomiting lasts for 2-3 days, and diarrhea lasts for 5 days, and dehydration symptoms are serious.
Enterovirus (EAdV) is a double-stranded linear DNA virus with a length of about 36kb, a protein coat on the outer layer, and a nucleocapsid 20-sided stereo symmetry. EAdV is another important pathogen causing infantile diarrhea, which is transmitted mainly through the fecal-oral route and also through the respiratory tract, and mainly infects children under two years of age. EAdV infectious diarrhea is distributed globally, is sporadic throughout the year and has no obvious seasonality. India is relatively peak in months 2 and 3, but there is no apparent trend overall. In addition, there is no sex difference in the incidence of EAdV diarrhea at home and abroad. The clinical symptoms of the infection are mainly manifested by diarrhea, vomiting and fever, and some children with the symptoms of abdominal pain, respiratory tract and the like, the incubation period is 3-10 days, and the course of the disease is about 5-9 days. Watery diarrhea is usually seen after 1-2 days of vomiting, the watery diarrhea lasts for 1-2 weeks, lasts for 5-9 days on average, and can be prolonged to 3-4 weeks in a few, nearly half of patients are accompanied by low fever in 2-3 days at the initial stage of onset, and some patients are accompanied by upper respiratory tract infection such as rhinitis, pharyngitis, tracheitis and the like.
At present, clinical diagnosis of the virus infectious diarrhea of children mostly takes clinical symptoms and epidemiological data as bases, and laboratory diagnosis such as electron microscopy, antigen detection, virus isolation culture, serological detection, molecular biological detection of virus nucleic acid and the like is needed for accurate diagnosis. Among these methods, viral nucleic acid detection based on fluorescence quantification is most commonly used. The traditional fluorescent quantitative PCR method has the defects of high reagent price, long detection time, incapability of achieving the real point-of-care testing (POCT) and incapability of realizing the requirements of portability, mobility and on-site quick detection.
Disclosure of Invention
In view of the above, the invention provides a kit for detecting five infant diarrhea disease series viruses and application thereof, and particularly provides a method for quickly, efficiently, high-flux and high-sensitivity detecting NV GI/GI, NV GI, HastV, RV and EAdV and a detection kit.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a primer probe combination, which comprises one or more than two of the following combinations:
the combination is as follows:
(1) the upstream primer has a nucleotide sequence shown as SEQ ID No. 1; and
(2) the downstream primer has a nucleotide sequence shown as SEQ ID No. 2; and
(3) the first fluorescent probe has a nucleotide sequence shown as SEQ ID No. 3; and
(4) the second fluorescent probe has a nucleotide sequence shown as SEQ ID No. 4; or
(5) A nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (1), (2), (3) or (4), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (1), (2), (3) or (4);
(6) a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (1), (2), (3) or (4);
combining two:
(7) the upstream primer has a nucleotide sequence shown as SEQ ID No. 5; and
(8) the downstream primer has a nucleotide sequence shown as SEQ ID No. 6; and
(9) the fluorescent probe has a nucleotide sequence shown as SEQ ID No. 7; or
(10) A nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (7), (8) or (9), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (7), (8) or (9);
(11) a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (7), (8) or (9);
combining three components:
(12) the upstream primer has a nucleotide sequence shown as SEQ ID No. 8; and
(13) the downstream primer has a nucleotide sequence shown as SEQ ID No. 9; and
(14) the fluorescent probe has a nucleotide sequence shown as SEQ ID No. 10; or
(15) A nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (12), (13) or (14), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (12), (13) or (14);
(16) a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (12), (13) or (14);
and (4) combining:
(17) the upstream primer has a nucleotide sequence shown as SEQ ID No. 11; and
(18) the downstream primer has a nucleotide sequence shown as SEQ ID No. 12; and
(19) the fluorescent probe has a nucleotide sequence shown as SEQ ID No. 13; or
(20) A nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (17), (18) or (19), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (17), (18) or (19);
(21) a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (17), (18) or (19);
and (5) combining:
(22) the upstream primer has a nucleotide sequence shown as SEQ ID No. 14; and
(23) the downstream primer has a nucleotide sequence shown as SEQ ID No. 15; and
(24) the fluorescent probe has a nucleotide sequence shown as SEQ ID No. 16; or
(25) A nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (22), (23) or (24), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (22), (23) or (24);
(26) and a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (22), (23) or (24).
Specifically, the primer probe provided by the invention comprises the following components in combination:
norovirus G1:
a forward primer: gCTggATgCgCTTCCATgA (shown as SEQ ID No. 1)
Reverse primer: TCCTTAgACgCCATCATCATTTAC (shown as SEQ ID No. 2)
Fluorescent probe 1: FAM-TgCgATCTCCTgTCCACAATCCgAg-BHQ1 (shown as SEQ ID No. 3)
And (3) fluorescent probe 2: FAM-TgCgATCTCCTgTCCACAAACCAAg-BHQ1 (shown as SEQ ID No. 4)
Norovirus G2:
a forward primer: GGATGAGATTCTCAGAYCTSAGCAC (shown as SEQ ID No. 5)
Reverse primer: TCGACGCCATCTTCATTCAC (shown as SEQ ID No. 6)
A fluorescent probe: FAM-AGATTGCGATCGCCCTCCCA-BHQ1 (shown as SEQID No. 7)
Human astrovirus:
a forward primer: ggACTgCWAAGCAgCTTCgT (shown as SEQ ID No. 8)
Reverse primer: gCCATCRCCACTTCTTTggTC (shown as SEQ ID No. 9)
A fluorescent probe: FAM-TCACAgAAgAgCAACTCCATCgCATTTg-BHQ1 (shown as SEQ ID No. 10)
Human rotavirus group a:
a forward primer: AgTggTTgATgCTCAAgATggA (shown as SEQ ID No. 11)
Reverse primer: TCATTgTAATCATATTgAATACCCA (shown as SEQ ID No. 12)
A fluorescent probe: FAM-CAgCAACAACTgCAgCTTCAAAAgAAgWgT-BHQ1 (shown in SEQ ID No. 13)
Intestinal adenovirus:
a forward primer: TgTTYgAAgTTTCCgACgTYgT (shown in SEQ ID No. 14)
Reverse primer: SAggTAgACggCCTCGATGgA (shown as SEQ ID No. 15), wherein S is C or G;
a fluorescent probe: FAM-CgCATCCAGCCSCACC (shown as SEQ ID No. 16).
In some embodiments of the invention, more than one of said one or more substitutions, deletions or additions is 2, 3, 4, 5 or 6.
On the basis of the research, the invention also provides application of the primer probe combination in preparation of a reagent and/or a kit for virus detection.
In some embodiments of the invention, the virus is a virus that causes diarrhea in infants and young children.
In some embodiments of the invention, the virus causing infantile diarrhea is one or more of norovirus, human astrovirus, rotavirus and enteroadenovirus.
In some embodiments of the invention, the virus of the childhood diarrheal disease series is one or more of norovirus (NV GI/GI, NV GI), human astrovirus (HAstV), rotavirus group A (RV), and enteroadenovirus (EAdV).
In some embodiments of the invention, the amplification procedure for virus detection is:
Figure BDA0002539412410000061
the invention also provides a virus detection kit, which comprises the primer probe combination and common auxiliary agents.
In some embodiments of the invention, the virus is a virus that causes diarrhea in infants and young children.
In some embodiments of the invention, the virus causing infantile diarrhea is one or more of norovirus, human astrovirus, rotavirus and enteroadenovirus.
In some embodiments of the invention, the virus of the childhood diarrheal disease series is one or more of norovirus (NV GI/GI, NV GI), human astrovirus (HAstV), rotavirus group A (RV), and enteroadenovirus (EAdV).
The kit provided by the invention has very high sensitivity and specificity, and compared with other fluorescent quantitative PCR, the established method can obtain results within half an hour, can achieve clinical rapid detection, is expected to realize real POCT, and has good application prospect. The detection method provided by the invention selects the detection kit of different viruses provided by Meikang genes, utilizes the produced rapid fluorescence quantitative PCR instrument based on the microfluidic chip technology and having a unique rapid reaction system and an innovative temperature control module, and establishes a rapid detection technology platform capable of simultaneously detecting five infant diarrhea disease series viruses by selecting different combinations, optimizing reaction conditions, standardizing an experimental process and establishing a quality control standard.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.
FIG. 1 shows the results of specific detection of NV GI in example 2 of the present invention;
FIG. 2 shows the results of specific detection of NV GI/GII in example 2 of the present invention;
FIG. 3 shows the results of specific detection of HAstV in example 2 of the present invention;
FIG. 4 shows the results of the detection of the specificity of RV in example 2 of the present invention;
FIG. 5 shows the results of specific detection of EAdV type in example 2 of the present invention;
FIG. 6 shows the results of sensitivity measurements of NV GI, NV GI/GI, HAstV, RV and EAdV in example 3 of the present invention.
Detailed Description
The invention discloses a kit for detecting five series viruses of infantile diarrhea and application thereof, and a person skilled in the art can realize the detection by properly improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.
The invention also provides a rapid detection method of NV GI, NV GI/GI, HAstV, RV and EAdV, which comprises the following steps:
nucleic acid extraction (for Hs480 heating centrifuge)
1) Adding 50 mul of the sample into 5 mul of FastLyse L4, and shaking and mixing uniformly;
2) placing the uniformly mixed sample in an HS480 heating and centrifuging integrated machine, heating for 2min at 95 ℃, centrifuging for 2min at 5000rpm, and directly taking the supernatant as a template for RT-PCR amplification;
3) and the positive control and the negative control are processed synchronously with the sample to be detected.
Second, PCR reagent preparation
1) Preparing a PCR reaction solution: mix the PCR buffer1(68 μ l) and the PCR enzyme system (17 μ l) in advance (2 more than the actual number of reaction tubes to avoid the loss in the sample-adding process and the bubble generation during mixing);
2) subpackaging 5 μ l of the above mixed solution into PCR reaction tubes (15 tubes), respectively adding 2 μ l of corresponding primer probes, numbering and mixing well; (Note: ensure that the mix of the extreme PCR buffer1 and primer probe is well dissolved before use).
Third, sample adding
1) Respectively adding 3 mul of processed sample RNA, positive control and negative control into corresponding PCR reaction tubes;
2) and (3) vertically adding 8 mu l of final mixed solution into the PCR amplification chip, covering the chip cover, and moving to an amplification detection area. The suggested chip loading sequence is as follows:
TABLE 1
01 NV G Ⅰ(PC) 09 HAstV (sample to be tested RNA)
02 NV G Ⅰ(NC) 10 RV(PC)
03 NV GI (sample RNA to be tested) 11 RV(NC)
04 NV G Ⅰ/G Ⅱ(PC) 12 RV (sample RNA to be detected)
05 NV G Ⅰ/G Ⅱ(NC) 13 EAdV(PC)
06 NV GI/GII (sample RNA to be tested) 14 EAdV(NC)
07 HAstV(PC) 15 EAdV (sample RNA to be detected)
08 HAstV(NC) 16 Water (W)
Fourth, PCR amplification detection
1) And inserting the PCR amplification chip into a Mokobio UltraFast LabChip Real-time PCR V280 for amplification detection.
2) Setting circulation parameters:
TABLE 2
Figure BDA0002539412410000081
Figure BDA0002539412410000091
3) Selecting instrument detection channels: the fluorescence signal selected the FAM channel and the internal standard fluorescence signal selected the Cy5 channel.
Compared with other fluorescent quantitative PCR, the method established by the invention can obtain results within half an hour, can achieve clinical rapid detection, is expected to realize real POCT, and has good application prospect if being applied to clinical application.
The kit for detecting the five respiratory viruses and the raw materials and the reagents used in the application thereof provided by the invention can be purchased from the market.
The following examples are conducted according to the protocols described in the conventional experimental conditions, or according to the experimental conditions recommended by the manufacturer.
The invention is further illustrated by the following examples:
example 1 reproducibility test
And (3) repeatedly detecting the positive control of each virus diluted by 10 times as a sample to be detected for 3 times.
Nucleic acid extraction (for Hs480 heating centrifuge)
1) Adding 50 mul of the sample into 5 mul of FastLyse L4, and shaking and mixing uniformly;
2) placing the uniformly mixed sample in an HS480 heating and centrifuging integrated machine, heating for 2min at 95 ℃, and centrifuging for 2min at 5000 rpm;
3) after the centrifugation is finished, taking the supernatant as sample RNA, and numbering;
4) and the positive control and the negative control are processed synchronously with the sample to be detected.
Second, PCR reagent preparation
1) Preparing a PCR reaction solution: mix the PCR buffer1(68 μ l) and the PCR enzyme system (17 μ l) in advance (2 more than the actual number of reaction tubes to avoid the loss in the sample-adding process and the bubble generation during mixing);
2) subpackaging 5 μ l of the above mixed solution into PCR reaction tubes (15 tubes), respectively adding 2 μ l of corresponding primer probes, numbering and mixing well; (Note: ensure that the mix of the extreme PCR buffer1 and primer probe is well dissolved before use).
Third, sample adding
1) Respectively adding 3 mul of processed sample RNA, positive control and negative control (the positive control is plasmid bacteria or pseudovirus containing target gene segments of each virus, and the negative control is cell culture solution) into corresponding PCR reaction tubes;
2) and (3) vertically adding 8 mu l of final mixed solution into the PCR amplification chip, covering the chip cover, and moving to an amplification detection area. The suggested chip loading sequence is as follows:
TABLE 3
01 NV G Ⅰ(PC) 09 HAstV (sample to be tested)RNA)
02 NV G Ⅰ(NC) 10 RV(PC)
03 NV GI (sample RNA to be tested) 11 RV(NC)
04 NV G Ⅰ/G Ⅱ(PC) 12 RV (sample RNA to be detected)
05 NV G Ⅰ/G Ⅱ(NC) 13 EAdV(PC)
06 NV GI/GII (sample RNA to be tested) 14 EAdV(NC)
07 HAstV(PC) 15 EAdV (sample RNA to be detected)
08 HAstV(NC) 16 Water (W)
Fourth, PCR amplification detection
1) And inserting the PCR amplification chip into a Mokobio UltraFast LabChip Real-time PCR V280 for amplification detection.
2) Setting circulation parameters:
TABLE 4
Figure BDA0002539412410000101
3) Selecting instrument detection channels: the fluorescence signal selected the FAM channel and the internal standard fluorescence signal selected the Cy5 channel.
Five results
TABLE 5 statistical results of the repeatability test data
Figure BDA0002539412410000102
Figure BDA0002539412410000111
The total repetition detection is carried out for 3 times, and the result Ct value variation Coefficient (CV) is less than or equal to 5 percent and has better repeatability.
Example 2 specific detection
Each virus positive control was used as a sample to be tested for specific detection, and the detection method was the same as in example 1.
As a result: each virus positive control sample is positive only under the corresponding probe, the others are negative, the specificity is better, and the results are shown in figures 1-5.
Example 3 sensitive assay
Each virus positive control (concentration 1 × 10) in the kit was added5copies/ml) was diluted to 1 × 10 in a gradient4copies/ml、1×103copies/ml、1×102copies/ml and 1 × 101And (4) preparing copies/ml, and performing sensitivity detection by using the copies/ml as a sample to be detected and using a corresponding kit.
The concrete implementation steps are the same as those in example 1
As a result, the detection limits of NV GI, NV GI/GI, HAstV, RV and EAdV are not higher than 1 × 101copies/ml, results are shown in FIG. 6.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Applicant
<120> kit for detecting five infant diarrhea disease series viruses and application thereof
<160>16
<170>SIPOSequenceListing 1.0
<210>1
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gctggatgcg cttccatga 19
<210>2
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
tccttagacg ccatcatcat ttac 24
<210>3
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tgcgatctcc tgtccacaat ccgag 25
<210>4
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
tgcgatctcc tgtccacaaa ccaag 25
<210>5
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ggatgagatt ctcagaycts agcac 25
<210>6
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
tcgacgccat cttcattcac 20
<210>7
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
agattgcgat cgccctccca 20
<210>8
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
ggactgcwaa gcagcttcgt 20
<210>9
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
gccatcrcac ttctttggtc 20
<210>10
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
tcacagaaga gcaactccat cgcatttg 28
<210>11
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
agtggttgat gctcaagatg ga 22
<210>12
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
tcattgtaat catattgaat accca 25
<210>13
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
cagcaacaac tgcagcttca aaagaagwgt 30
<210>14
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
tgttygaagt tttcgacgty gt 22
<210>15
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
saggtagacg gcctcgatga 20
<210>16
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
cgcatccacc agccscacc 19

Claims (9)

1. A primer probe combination is characterized by comprising one or more than two of the following combinations:
the combination is as follows:
(1) the upstream primer has a nucleotide sequence shown as SEQ ID No. 1; and
(2) the downstream primer has a nucleotide sequence shown as SEQ ID No. 2; and
(3) the first fluorescent probe has a nucleotide sequence shown as SEQ ID No. 3; and
(4) the second fluorescent probe has a nucleotide sequence shown as SEQ ID No. 4; or
(5) A nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (1), (2), (3) or (4), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (1), (2), (3) or (4);
(6) a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (1), (2), (3) or (4);
combining two:
(7) the upstream primer has a nucleotide sequence shown as SEQ ID No. 5; and
(8) the downstream primer has a nucleotide sequence shown as SEQ ID No. 6; and
(9) the fluorescent probe has a nucleotide sequence shown as SEQ ID No. 7; or
(10) A nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (7), (8) or (9), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (7), (8) or (9);
(11) a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (7), (8) or (9);
combining three components:
(12) the upstream primer has a nucleotide sequence shown as SEQ ID No. 8; and
(13) the downstream primer has a nucleotide sequence shown as SEQ ID No. 9; and
(14) the fluorescent probe has a nucleotide sequence shown as SEQ ID No. 10; or
(15) A nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (12), (13) or (14), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (12), (13) or (14);
(16) a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (12), (13) or (14);
and (4) combining:
(17) the upstream primer has a nucleotide sequence shown as SEQ ID No. 11; and
(18) the downstream primer has a nucleotide sequence shown as SEQ ID No. 12; and
(19) the fluorescent probe has a nucleotide sequence shown as SEQ ID No. 13; or
(20) A nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (17), (18) or (19), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (17), (18) or (19);
(21) a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (17), (18) or (19);
and (5) combining:
(22) the upstream primer has a nucleotide sequence shown as SEQ ID No. 14; and
(23) the downstream primer has a nucleotide sequence shown as SEQ ID No. 15; and
(24) the fluorescent probe has a nucleotide sequence shown as SEQ ID No. 16; or
(25) A nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (22), (23) or (24), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (22), (23) or (24);
(26) and a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (22), (23) or (24).
2. The primer probe combination of claim 1, wherein a plurality of said one or more substitutions, deletions or additions is 2, 3, 4, 5 or 6.
3. Use of a primer probe combination according to claim 1 or 2 for the preparation of a reagent and/or a kit for the detection of a virus.
4. The use of claim 3, wherein the virus is a virus that causes diarrhea in infants and young children.
5. The use of claim 4, wherein the virus causing infantile diarrhea is one or more of norovirus, human astrovirus, rotavirus and enteroadenovirus.
6. The use according to any one of claims 3 to 5, wherein the amplification procedure for virus detection is:
Figure FDA0002539412400000031
7. a kit for virus detection, comprising the primer probe combination according to claim 1 or 2 and conventional auxiliary agents.
8. The kit of claim 7, wherein the virus is a virus that causes diarrhea in an infant.
9. The kit of claim 8, wherein the virus causing infantile diarrhea is one or more of norovirus, human astrovirus, rotavirus, and enteroadenovirus.
CN202010542570.9A 2019-12-24 2020-06-15 Kit for detecting five infant diarrhea disease series viruses and application thereof Pending CN111748552A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2019113435220 2019-12-24
CN201911343522 2019-12-24

Publications (1)

Publication Number Publication Date
CN111748552A true CN111748552A (en) 2020-10-09

Family

ID=72676154

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010542570.9A Pending CN111748552A (en) 2019-12-24 2020-06-15 Kit for detecting five infant diarrhea disease series viruses and application thereof

Country Status (1)

Country Link
CN (1) CN111748552A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1329523A1 (en) * 2000-09-29 2003-07-23 BML, Inc. Method of detecting norwalk-like virus (gii)
CN101671746A (en) * 2009-10-21 2010-03-17 中华人民共和国北京出入境检验检疫局 Kit and oligonucleotide sequences for detecting rotavirus A
CN106191316A (en) * 2016-07-27 2016-12-07 国家食品安全风险评估中心 Multiplex PCR detects seven kinds of diarrhea virus primer sets and test kit and detection method thereof
CN107058632A (en) * 2017-05-23 2017-08-18 安徽安龙基因医学检验所有限公司 A kind of multiplex PCR detects three kinds of diarrhea virus kits and its detection method
CN109593890A (en) * 2018-12-29 2019-04-09 深圳市刚竹医疗科技有限公司 Detect the nucleic acid compositions of diarrhea virus, the application method of kit and kit

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1329523A1 (en) * 2000-09-29 2003-07-23 BML, Inc. Method of detecting norwalk-like virus (gii)
CN101671746A (en) * 2009-10-21 2010-03-17 中华人民共和国北京出入境检验检疫局 Kit and oligonucleotide sequences for detecting rotavirus A
CN106191316A (en) * 2016-07-27 2016-12-07 国家食品安全风险评估中心 Multiplex PCR detects seven kinds of diarrhea virus primer sets and test kit and detection method thereof
CN107058632A (en) * 2017-05-23 2017-08-18 安徽安龙基因医学检验所有限公司 A kind of multiplex PCR detects three kinds of diarrhea virus kits and its detection method
CN109593890A (en) * 2018-12-29 2019-04-09 深圳市刚竹医疗科技有限公司 Detect the nucleic acid compositions of diarrhea virus, the application method of kit and kit

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
中国医学创新杂志社: "《实用临床诊疗-检验学》", 31 October 2013, 科学技术文献出版社 *
王永霞 等: "人星状病毒研究进展", 《病毒学报》 *

Similar Documents

Publication Publication Date Title
Chiappini et al. Viraemia is a common finding in immunocompetent children with rotavirus infection
Puppe et al. Evaluation of a multiplex reverse transcriptase PCR ELISA for the detection of nine respiratory tract pathogens
CN102277455B (en) Primer, probe and assay kit used for detecting porcine circovirus, porcine pseudorabies virus and porcine parvovirus
AK et al. Serological and epidemiological investigation of bluetongue, maedi-visna and caprine arthritis-encephalitis viruses in small ruminant in Kirikkale District in Turkey
Iyoha et al. Human rotavirus genotypes causing acute watery diarrhea among under-five children in Benin City, Nigeria
CN110257557A (en) A kind of multiple RT-PCR detection primer group of TGEV, PEDV, SADS-CoV and PDCoV
Tabasi et al. Human bocavirus infections among children less than two years old in Iran during fall and winter 2012–2013
CN110592278A (en) Multiplex RT-PCR kit for PRoV, PoSaV and PAStV
CN106119423A (en) The general PCR primer of detection Avianreovirus and detection kit thereof
CN103146846A (en) Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit
CN110257561B (en) Reagent for detecting deer epidemic hemorrhagic fever virus, detection method and application
CN110438264B (en) Method for detecting porcine epidemic diarrhea virus and B-type porcine enterovirus by using double real-time fluorescence quantitative RT-PCR
CN111748552A (en) Kit for detecting five infant diarrhea disease series viruses and application thereof
Kabue et al. Characterization of human rotavirus recovered from children with acute diarrhea in Kinshasa, Democratic Republic Of Congo
Subekti et al. Characterization of Norwalk‐like virus associated with gastroenteritis in Indonesia
Takami et al. Usefulness of nested PCR and sequence analysis in a nosocomial outbreak of neonatal enterovirus infection
KR101247981B1 (en) RT-PCR for differentiation of seven serotypes of foot-and-mouth disease virus
CN108950072A (en) A kind of Porcine epidemic diarrhea virus fluorescence LAMP primer group, kit and detection method
Listeš et al. First evidence of bluetongue virus serotype 16 in Croatia
CN114703179A (en) RT-RAA-LFD primer pair, probe, test strip, kit for detecting PDCoV and application thereof
CN114410845A (en) Locked nucleic acid modified one-step nested PCR (polymerase chain reaction) primer group and kit for detecting African swine fever virus
CN111748648A (en) Kit for detecting five infant hand-foot-and-mouth disease series viruses and application thereof
Wolf et al. Performance of direct immunofluorescence assay for the detection of human metapneumovirus under clinical laboratory settings
CN118389752B (en) Fluorescent quantitative PCR primer and method for detecting pangolin type A rotavirus
CN110408614A (en) The kit detected for five kinds of Respirovirus and its application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20201009

RJ01 Rejection of invention patent application after publication