CN111741766A

CN111741766A - Methods and compositions for inducing an immune response against Hepatitis B Virus (HBV)

Info

Publication number: CN111741766A
Application number: CN201880089584.0A
Authority: CN
Inventors: D·博登; H·霍顿; J-M·E·F·M·尼芙斯; S·罗伊; J·H·H·V·屈斯泰; R·C·察恩; M·卡拉; D·德普特尔
Original assignee: Bavarian Nordic AS; Janssen Sciences Ireland ULC
Current assignee: Bavarian Nordic AS; Janssen Sciences Ireland ULC
Priority date: 2017-12-19
Filing date: 2018-12-18
Publication date: 2020-10-02
Also published as: EP3727446A1; MX2020006471A; KR20200100745A; MA51312A; BR112020012273A2; AU2018389786A1; IL275423A; WO2019123250A1; CA3086325A1; SG11202005710YA; JP2021506300A

Abstract

Modified Vaccinia Ankara (MVA) vectors and adenoviral vectors encoding HBV antigens are provided herein. Also provided herein are methods of enhancing an immune response in a human subject by using MVA encoding HBV antigens and an adenoviral vector in a prime/boost regimen to enhance an immune response in a human subject.

Description

Methods and compositions for inducing an immune response against Hepatitis B Virus (HBV)

Cross Reference to Related Applications

This application claims priority from international patent application No. PCT/IB2017/058148 filed on 19.12.2017 and U.S. provisional patent application No. 62/607,439 filed on 19.12.2017, the disclosures of which are incorporated herein by reference in their entireties.

Reference to electronically submitted sequence Listing

The present application contains a sequence listing in ASCII format submitted electronically via EFS-Web with a file name of "688097-. The sequence listing submitted by EFS-Web is part of the specification and is incorporated herein by reference in its entirety.

Technical Field

The present invention relates to biotechnology. More specifically, the present invention relates to methods and compositions for enhancing an immune response to Hepatitis B Virus (HBV) in a subject in need thereof.

Background

Hepatitis B Virus (HBV) is a small hepadnavirus of 3.2-kb, which encodes 4 open reading frames and 7 proteins. About 20 million people are infected with HBV, and about 2.4 million people have chronic hepatitis b infection (chronic HBV) characterized by persistent appearance of viral and subviral particles in the blood for more than 6 months (1). Persistent HBV infection chronically stimulates HBV-specific T cell receptors via viral peptides and circulating antigens, resulting in T cell depletion of circulating and intrahepatic HBV-specific CD4+ and CD8+ T cells. As a result, T cell pluripotency (i.e., reduced levels of IL-2, Tumor Necrosis Factor (TNF) - α, IFN- γ, and lack of proliferation) is reduced.

Safe and effective prophylactic vaccines against HBV infection have been available since the 80's of the 20 th century and are the main means of hepatitis b prevention (3). The world health organization recommends vaccination of all infants and of all children and adolescents (under 18 years) and some people at risk in countries with low or moderate prevalence of hepatitis b. The worldwide infection rate is significantly reduced due to vaccination. However, prophylactic vaccines are not able to cure existing HBV infections.

Chronic HBV is currently treated with IFN- α and nucleoside or nucleotide analogs, but cannot be cured ultimately due to the continued emergence of intracellular viral replication intermediates of infected hepatocytes called covalently closed circular DNA (cccdna), which plays an important role as a template for viral RNA and the new virions that result therefrom. It is believed that the induced virus-specific T and B cell responses can effectively eliminate hepatocytes with cccDNA. Current therapies targeting HBV polymerase inhibit viremia, but have limited effect on the associated production of cccDNA and circulating antigens located in the nucleus. The most severe form of cure may be the elimination of HBV cccDNA from the organism, which was not observed as a result of natural occurrence, nor of any therapeutic intervention. However, loss of HBV surface antigen (HBsAg) is clinically plausibly equivalent to cure, since disease recurrence occurs only in the case of severe immunosuppression, which in turn can be prevented by prophylactic treatment. Thus, at least from a clinical point of view, loss of HBsAg is associated with the most stringent form of immune reconstitution for HBV.

For example, immunomodulatory with pegylated interferon (pegIFN) - α has proven to be better than nucleoside or nucleotide therapy for sustained non-therapeutic (off-therapeutic) responses with limited course of therapy. In addition to direct antiviral effects, IFN- α was reported to exhibit epigenetic inhibition of cccDNA in cell culture and humanized mice, which resulted in a reduction in virion fertility and transcripts (4). However, this therapy still has side effects and low overall response, in part because IFN- α has only a poor regulatory impact on HBV-specific T cells. In particular, cure rates are low (< 10%) and toxicity is high. Similarly, the direct acting HBV antiviral agents, i.e. the HBV polymerase inhibitors entecavir (entecavir) and tenofovir (tenofovir), are effective as monotherapies in inducing viral suppression, and have a high genetic barrier to the emergence of drug-resistant mutants and the continued prevention of the progression of liver disease. However, it is rare to achieve cure of chronic hepatitis b as defined by HBsAg loss or seroconversion (seroconversion) by such HBV polymerase inhibitors. Thus, these antiviral agents theoretically need to be administered indefinitely to prevent recurrence of liver disease, similar to antiretroviral therapy of Human Immunodeficiency Virus (HIV).

Therapeutic vaccination has the potential to eliminate HBV from chronically infected patients (5). Many strategies have been investigated, but the success of therapeutic vaccination has not been demonstrated to date.

Disclosure of Invention

Thus, the medical need for the treatment of Hepatitis B Virus (HBV), particularly chronic HBV, for limited well-tolerated treatments with high cure rates has not yet been met. The present application satisfies this need. The present application provides Modified Vaccinia virus Ankara (Modified Vaccinia Ankara, MVA) vectors. The MVA vector of the present application comprises a non-naturally occurring nucleic acid molecule comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4. The HBV polymerase antigens of the MVA vector may, for example, be capable of inducing an immune response in a mammal against at least two HBV genotypes. Preferably, the HBV polymerase antigen is capable of inducing a T cell response in a mammal against at least HBV genotypes B, C and D. More preferably, the HBV polymerase antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D. In one embodiment of the present application, the HBV polymerase antigen comprises the amino acid sequence of SEQ ID NO. 4. In one embodiment of the present application, the first polynucleotide sequence is at least 90% identical to SEQ ID NO. 3. In one embodiment of the present application, the first polynucleotide sequence comprises the polynucleotide sequence of SEQ ID NO. 3.

In one embodiment of the present application, the MVA vector may further comprise a polynucleotide sequence encoding a signal sequence operably linked to an HBV polymerase antigen. The signal sequence may for example comprise the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11. Preferably, the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

In one embodiment of the present application, the MVA vector further comprises a second polynucleotide sequence encoding a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2. In one embodiment of the present application, the second polynucleotide sequence is at least 90% identical to SEQ ID NO. 1. In one embodiment of the present application, the second polynucleotide sequence comprises the polynucleotide sequence of SEQ ID NO. 1.

The present application also provides a composition comprising the MVA vector of the present application and a pharmaceutically acceptable carrier.

The present application also provides methods of enhancing an immune response in a human subject in need thereof. The method comprises (a) administering to the human subject a first composition comprising an immunologically effective amount of an adenoviral vector comprising a non-naturally occurring nucleic acid molecule comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4; and (b) administering to the human subject a second composition comprising an immunologically effective amount of the MVA vector of the present application; to obtain an enhanced immune response against the HBV antigen in said human subject. In one embodiment of the present application, the HBV polymerase antigen does not have reverse transcriptase activity and RNase H activity. In one embodiment of the present application, the first composition is for eliciting an immune response in a subject in need thereof and the second composition is for boosting an immune response in a subject in need thereof. In one embodiment of the present application, step (b) is performed 1-12 weeks after step (a). In one embodiment of the present application, step (b) is performed 2-12 weeks after step (a). In one embodiment of the present application, step (b) is performed at least 1 week after step (a). In one embodiment of the present application, step (b) is performed at least 2 weeks after step (a).

In one embodiment of the present application, the HBV polymerase antigen of the first composition is capable of inducing an immune response in a human subject against at least two HBV genotypes; preferably, the HBV polymerase antigen is capable of inducing a T cell response in a human subject against at least HBV genotypes B, C and D; more preferably, the HBV polymerase antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D.

In one embodiment of the present application, the HBV polymerase antigen of the first composition comprises the amino acid sequence of SEQ ID NO. 4. The first polynucleotide sequence of the first composition may, for example, be at least 90% identical to SEQ ID No. 19. In one embodiment of the present application, the first polynucleotide sequence of the first composition comprises the polynucleotide sequence of SEQ ID NO. 19.

In one embodiment of the present application, the nucleic acid molecule of the adenoviral vector in the first composition further comprises a second polynucleotide sequence encoding a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID NO. 2. The second polynucleotide sequence of the first composition can be, e.g., at least 90% identical to seq id No. 17. In one embodiment of the present application, the second polynucleotide sequence of the first composition comprises the polynucleotide sequence of SEQ ID NO. 17.

In one embodiment of the present application, the first and second polynucleotide sequences of the first composition encode a fusion protein comprising a truncated HBV core antigen operably linked to an HBV polymerase antigen. The fusion protein of the first composition may, for example, comprise a truncated HBV core antigen operably linked to an HBV polymerase antigen via a linker. The linker of the first composition may for example comprise (AlaGly)_nWherein n is an integer of 2 to 5. Preferably, the linker is encoded by a polynucleotide sequence comprising SEQ ID NO. 14. In one embodiment of the present application, the fusion protein of the first composition comprises the amino acid sequence of SEQ ID NO 12.

In one embodiment of the present application, the enhanced immune response comprises an enhanced antibody response against HBV antigens in a human subject. The enhanced immune response may, for example, comprise an enhanced CD8+ T cell response to HBV antigen in a human subject. The enhanced immune response may, for example, comprise a CD4+ T cell response against HBV antigen in a human subject.

In one embodiment of the present application, the adenoviral vector is a rAd26 or rAd35 vector.

In one embodiment of the present application, there is provided a method of enhancing an immune response in a human subject, the method comprising: (a) administering to the human subject a first composition comprising an immunologically effective amount of a first plasmid comprising a first non-naturally occurring nucleic acid molecule comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID No. 4 and a second plasmid comprising a second non-naturally occurring nucleic acid molecule comprising a second polynucleotide sequence encoding a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2; and (b) administering to the human subject a second composition comprising an immunologically effective amount of the MVA vector of the present application; to obtain an enhanced immune response against the HBV antigen in said human subject. In one embodiment of the present application, the HBV polymerase antigen of the first composition does not have reverse transcriptase activity and RNase H activity. In one embodiment of the present application, the first composition is used to elicit an immune response and the second composition is used to boost an immune response. In one embodiment of the present application, step (b) is performed 1-12 weeks after step (a). In one embodiment of the present application, step (b) is performed 2-12 weeks after step (a). In one embodiment of the present application, step (b) is performed at least 1 week after step (a). In one embodiment of the present application, step (b) is performed at least 2 weeks after step (a).

In one embodiment of the present application, the HBV polymerase antigen of the first composition is capable of inducing an immune response in a human subject against at least two HBV genotypes; preferably, the HBV polymerase antigen is capable of inducing a T cell response in a human subject against at least HBV genotypes B, C and D; and more preferably, the HBV polymerase antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D.

In one embodiment of the present application, the HBV polymerase antigen of the first composition comprises the amino acid sequence of SEQ ID NO. 4. In one embodiment of the present application, the first polynucleotide sequence of the first composition is at least 90% identical to SEQ id No. 20. The first polynucleotide sequence of the first composition may, for example, comprise SEQ ID NO: 20.

In one embodiment of the present application, the nucleic acid molecule of the first plasmid of the first composition further comprises a polynucleotide sequence encoding a signal sequence of an HBV polymerase antigen operably linked to the first composition. The signal sequence may for example comprise the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11; preferably, the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

In one embodiment of the present application, the second polynucleotide sequence of the first composition is at least 90% identical to SEQ ID NO. 18. The second polynucleotide sequence of the first composition may, for example, comprise the polynucleotide sequence of SEQ ID NO. 18.

In one embodiment of the application, the first and second polynucleotide sequences of the first composition further comprise a promoter sequence, optionally one or more additional regulatory sequences; preferably, the promoter sequence comprises the polynucleotide sequence of SEQ ID NO. 7 and the additional regulatory sequence is selected from the enhancer sequence of SEQ ID NO. 8 or SEQ ID NO. 15 and the polyadenylation signal sequence of SEQ ID NO. 16.

In one embodiment of the present application, the enhanced immune response comprises an enhanced antibody response against HBV antigens in a human subject. The enhanced immune response may, for example, comprise an enhanced CD8+ T cell response to HBV antigen in a human subject. The enhanced immune response may, for example, comprise an enhanced CD4+ T cell response to HBV antigen in a human subject.

Other aspects, features and advantages of the present invention will become more fully apparent from the following disclosure, including the detailed description of the invention and the preferred embodiments thereof, and the appended claims.

Drawings

The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the particular embodiments shown in the drawings. In the drawings:

FIGS. 1A-1B show the genome and viral life cycle of hepatitis B virus; FIG. 1A is a schematic representation of the Hepatitis B Virus (HBV) genome; in natural (native) viruses, the polymerase protein (Pol) contains the coding sequence for the envelope protein in different open reading frames; the envelope proteins (pre-S1, pre-S2 and S) are in the same open reading frame; fig. 1B shows the viral life cycle of HBV.

Fig. 2A-2C show schematic diagrams of expression cassettes for adenovirus and MVA vectors of embodiments of the present application; FIG. 2A shows an expression cassette for a truncated HBV core antigen comprising the CMV promoter, intron (fragment derived from the human ApoAI gene-295-523 base pairs of GenBank accession number X01038, with the ApoAI second intron), a human immunoglobulin secretion signal, followed by the coding sequence for the truncated HBV core antigen and the SV40 polyadenylation signal; FIG. 2B shows an expression cassette of a fusion protein of a truncated HBV core antigen operably linked to an HBV polymerase antigen, which is identical to the expression cassette of the truncated HBV core antigen except for the HBV antigen; figure 2C shows an expression cassette comprising an HBV core antigen operably linked to a pr13.5 long promoter and an expression cassette comprising an HBV polymerase antigen operably linked to a PrHyb promoter.

FIG. 3 shows a graph of ELISPOT responses of F1 mice immunized with different combinations of HBV adenovirus vectors and HBV MVA; the HBV core or pool of polymerase peptides (pool) used to stimulate splenocytes isolated from each vaccinated group of animals is shown in black (core) and grey (pol). Pol1 and Pol2 responses were summed. The X-axis shows the adenovirus vector dose in the presence or absence of MVA boost; the number of responding T cells, indicated on the y-axis, is expressed as Spot Forming Cells (SFC)/10⁶And (4) spleen cells.

FIG. 4 shows a graph of Intracellular Cytokine Staining (ICS) responses of F1 mice immunized with different combinations of HBV adenoviral vectors and HBV MVA; HBV cores or polymerase peptide pools used to stimulate splenocytes isolated from each vaccinated group of animals are shown in black (core) and grey (pol); aggregating Pol1 and Pol2 responses; the X-axis shows the adenovirus vector dose in the presence or absence of MVA boost. The percentage of CD8(+) T cells positive for IFN γ is shown on the y-axis.

Figure 5 shows a graph of ICS responses of F1 mice immunized with different combinations of HBV adenovirus vectors and HBV MVA vectors; HBV cores or polymerase peptide pools used to stimulate splenocytes isolated from each vaccinated group of animals are shown in black (core) and grey (pol); aggregating Pol1 and Pol2 responses; the X-axis shows the adenovirus vector dose in the presence or absence of MVA boost; the percentage of CD4(+) T cells positive for IFN γ is shown on the y-axis.

FIG. 6 shows a graph of ELISPOT responses of NHPs immunized with different combinations of HBV adenovirus vectors and HBV MVA vectors; HBV core or pool of polymerase peptides used to stimulate PBMCs isolated from each vaccinated group of animals are indicated as boxes (core), circles (pol1) and triangles (pol 2); the X-axis shows different experimental groups and time points. The number of responding T cells, indicated on the y-axis, is expressed as Spot Forming Cells (SFC)/10⁶(ii) individual splenocytes; data with background subtracted (medium + DMSO stimulation) are shown.

FIGS. 7A, 7B and 7C are graphs showing ICS response of NHPs immunized with different combinations of HBV adenovirus vectors and HBV MVA vectors; HBV core or pool of polymerase peptides used to stimulate PBMCs isolated from each vaccinated group of animals are indicated as boxes (core), circles (pol1) and triangles (pol 2); the X-axis shows different experimental groups and time points; the percentage of CD4(+) and CD8(+) T cells positive for IFN γ is identified on the y-axis, showing data with background subtracted (media + DMSO stimulation).

Detailed Description

Various publications, articles and patents are cited or described in the background and throughout the specification, which are incorporated herein by reference in their entirety. The discussion of documents, acts, materials, devices, articles and the like which has been included in the present specification is intended to provide a context for the present invention. Such discussion is not an admission that any or all of these matters form part of the prior art with respect to any invention disclosed or claimed.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Otherwise, certain terms used herein have the meanings set forth in the specification. All patents, published patent applications, and publications cited herein are incorporated by reference as if fully set forth herein.

It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

Unless otherwise indicated, any numerical value, such as the concentrations or concentration ranges set forth herein, are to be understood as being modified in all instances by the term "about". Accordingly, a numerical value typically includes ± 10% of the stated value. For example, a concentration of 1mg/mL includes 0.9mg/mL to 1.1 mg/mL. Similarly, a concentration range of 1mg/mL to 10mg/mL includes 0.9mg/mL to 11 mg/mL. As used herein, unless the context clearly dictates otherwise, the use of a range of values explicitly includes all possible subranges as well as all individual values falling within the range, including integers and fractions of values within such range.

The term "at least" preceding a series of elements is to be understood as referring to each element in the series, unless otherwise indicated. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. Such equivalents are also encompassed within the scope of the present invention.

Throughout this specification and the claims which follow, unless the context clearly requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. The term "comprising" may be replaced by the term "comprising" or "including" as used herein, or by the term "having" as used herein when used herein.

As used herein, "consisting of …" excludes any element, step, or ingredient not specified. As used herein, "consisting essentially of … does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claims. Any of the foregoing terms "comprising," "including," and "having," when used at any time in the context of aspects or embodiments of the present application, may be replaced with the terms "consisting of …" or "consisting essentially of …" to vary the scope of the invention.

As used herein, the conjunction "and/or" between a plurality of listed elements should be understood to encompass both individual and combined options. For example, when two elements are connected by "and/or," a first option refers to the applicability of the first element without a second element. The second option refers to applicability of the second element without the first element. The third option means that the first element and the second element apply together. Any of these options should be understood to fall within its meaning and thus satisfy the requirements of the term "and/or" as used herein. The concurrent applicability of more than one of the various options should also be understood to fall within its meaning and thus satisfy the requirements of the term "and/or".

As used herein, "subject" means any animal, preferably a mammal, most preferably a human, that is to be or has been subjected to treatment according to the methods of embodiments of the present application. The term "mammal" as used herein encompasses any mammal. Examples of mammals include, but are not limited to, cows, horses, sheep, pigs, cats, dogs, mice, rats, rabbits, guinea pigs, non-human primates (NHPs) such as monkeys or apes, humans, and the like, more preferably humans.

The terms "adjuvant" and "immunostimulant" are used interchangeably herein and are defined as one or more substances that cause stimulation of the immune system. In this context, adjuvants are used to enhance the immune response to the adenoviral and/or MVA vectors of the present application.

It will also be understood that when referring to dimensions or characteristics of components of the preferred invention, the terms "about", "generally", "substantially" and the like are used herein to indicate that the dimensions/characteristics are not strictly bound by or parameters, nor do they exclude minor variations therefrom that are functionally identical or similar, as would be understood by one of ordinary skill in the art. At the very least, such recitation of numerical parameters includes the use of numerical parameters that do not alter the minimum numerical value, using art-recognized mathematical and industrial rules (e.g., rounding, measurement or other systematic errors, manufacturing tolerances, etc.).

The term "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences (e.g., HBV antigen polypeptides and polynucleotides encoding them), refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as determined using one of the following sequence comparison algorithms or by visual inspection.

For sequence comparison, typically one sequence acts as a reference sequence, which is compared to the test sequence. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the specified program parameters.

Optimal alignments for sequence comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, adv.Appl.Math.2:482 (1981); homology alignment algorithm of Needleman & Wunsch, J.mol.biol.48:443 (1970); similarity search methods of Pearson & Lipman, Proc.Nat' l.Acad.Sci.USA 85:2444 (1988); computerized implementation of these algorithms (GAP, BESTFIT, FASTA and TFASTA, Wisconsin Genetics Software Package, Genetics Computer Group,575Science Dr., Madison, Wis.), or by visual inspection (see generally, Current Protocols in Molecular Biology, F.M. Ausubelet et al, eds., Current Protocols, a joint vehicle better Green Greene publishing associates, Inc. and John Wiley & Sons, Inc. (1995Supplement) (Ausubel)).

Examples of algorithms suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms described in Altschul et al (1990) J.Mol.biol.215: 403-. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high-scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence (query sequence) that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits (hit) serve as seeds for initiating searches to find longer HSPs containing them. Word hits are then extended in both directions along each sequence until the cumulative alignment score can be increased.

Cumulative scores were calculated for nucleotide sequences using the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Stopping the extension of word hits in all directions when: the cumulative ratio score is reduced by an amount X from its maximum realized value; the cumulative score becomes zero or less due to accumulation of one or more negative-scoring residue alignments; or to the end of either sequence. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses default values: word length (W) is 11, expected (E) is 10, M-5, N-4 and a comparison of the two chains. For amino acid sequences, the BLASTP program uses default values: word length (W) is 3, expectation (E) is 10 and BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).

In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. nat' l. Acad. Sci. USA 90: 5873-. One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P (N)), which provides an indication of the probability by which a match of two nucleotide or amino acid sequences occurs by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

As described below, a further indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross-reactive with the polypeptide encoded by the second nucleic acid. Thus, a polypeptide is typically substantially identical to a second polypeptide, e.g., where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions, as described below.

As used herein, the term "enhance" when used with respect to an immune response, e.g., a CD4+ T cell response, an antibody response, or a CD8+ T cell response, refers to an enhanced immune response in a subject administered a prime-boost combination of MVA and adenoviral vectors of the invention relative to the corresponding immune response observed from a subject administered the MVA vectors or adenoviruses of the present application alone.

As used herein, the term "CD 4+ or CD8+ T cell response" refers to a T cell immune response characterized by a high proportion of immunogen-specific CD4+ T cells or CD8+ T cells in the total responding T cell population observed after vaccination. The total immunogen specific T cell response can be determined by IFN- γ ELISPOT assay. Immunogen-specific CD4+ or CD8+ T cell immune responses can be determined by ICS assays.

As used herein, the term "enhanced antibody response" refers to an enhanced antibody response in a subject administered a prime-boost composition of MVA and adenovirus vectors of the present application relative to the corresponding immune response observed from a subject administered the MVA vectors or adenoviruses of the present invention alone.

The term "adjuvant" is defined as one or more substances that cause stimulation of the immune system. In this context, adjuvants are used to enhance the immune response to the plasmid, adenovirus and/or MVA vectors of the present application.

As used herein, the term "antigenic gene product or fragment thereof" or "antigenic protein" may include bacterial, viral, parasitic or fungal proteins or fragments thereof. The antigenic protein or antigenic gene product is capable of eliciting a protective immune response in a host, e.g., inducing an immune response against a disease or infection (e.g., a bacterial, viral, parasitic, or fungal disease or infection), and/or generating immunity against a disease or infection in a subject (i.e., vaccination), which protects a subject from a disease or infection.

To assist the reader of this application, the specification is divided into paragraphs or sections, or directed to various embodiments of this application. These distinctions are not to be understood as separating the content of a paragraph, section or embodiment from other paragraphs, sections or embodiments. Rather, those skilled in the art will appreciate that the description has broad application and encompasses all combinations of sections, paragraphs and sentences that may be considered. The discussion of any embodiment is meant to be exemplary only, and not intended to limit the scope of the disclosure, including the claims, to these examples. For example, while embodiments of the HBV vectors of the present application described herein (e.g., plasmid DNA or viral vectors) may comprise specific components, including but not limited to certain promoter sequences, enhancer or regulatory sequences, signal peptides, coding sequences for HBV antigens, polyadenylation signal sequences, etc., arranged in a particular order, it will be understood by those skilled in the art that the concepts disclosed herein may be equally applied to other components arranged in other orders that may be used in the HBV vectors of the present application. The present application contemplates the use of any available components in any combination having any sequence that can be used in the HBV vectors of the present application, whether or not a particular combination is explicitly described.

Hepatitis B Virus (HBV)

As used herein, "hepatitis B virus" or "HBV" refers to a virus of the hepadnaviridae family. HBV is a small (e.g. 3.2kb) hepadnavirus, which encodes 4 open reading frames and 7 proteins. See fig. 1A. The 7 proteins encoded by HBV include small (S), medium (M) and large (L) surface antigen (HBsAg) or envelope (Env) proteins, pre-Core proteins, viral polymerase (Pol) and HBx proteins. HBV expresses three surface antigens or envelope proteins L, M and S, where S is minimal and L is maximal. The extra (extra) domains in the M and L proteins were named Pre-S2 and Pre-S1, respectively. The core protein is a subunit of the viral nucleocapsid. Pol is required for the synthesis of viral DNA (reverse transcriptase, RNaseH and primers), which occurs in the nucleocapsid located in the cytoplasm of infected hepatocytes. PreCore is a core protein with an N-terminal signal peptide and is proteolytically processed at its N and C termini before being secreted from infected cells, the so-called hepatitis b e-antigen (HBeAg). HBx protein is required for efficient transcription of covalently closed circular dna (cccdna). HBx is not a viral structural protein. All viral proteins of HBV have their own mRNA, except for the core and polymerase which share the mRNA. With the exception of the protein pre-Core, HBV viral proteins are not subjected to post-translational proteolytic processing.

HBV virions contain a single copy of the viral envelope, the nucleocapsid, and a partially double-stranded DNA genome. The nucleocapsid comprises 120 dimers of the core protein and is covered by a capsid membrane that is embedded S, M and the envelope or surface antigen protein of the L virus. Upon entry into the cell, the virus uncoats and the relaxed circular dna (rcdna) comprising the capsid migrates with the covalently bound viral polymerase into the nucleus. In that process, phosphorylation of the core protein causes a structural change, exposing a nuclear localization signal, allowing the capsid to interact with a so-called import protein (import). These import proteins mediate the binding of the core protein to the nuclear pore complex, after which the capsid disintegrates and the polymerase/rcDNA complex is released into the nucleus. In the nucleus, rcDNA becomes deproteinized (polymerase removed) and is converted by host DNA repair mechanisms into the covalently closed circular DNA (cccdna) genome, from which overlapping transcripts encode HBeAg, HBsAg, core protein, viral polymerase and HBx protein. The core protein, viral polymerase and pregenomic rna (pgRNA) associate and self-assemble in the cytoplasm into capsid particles comprising immature pgRNA, which in turn are converted into mature rcDNA-capsids and function as consensus intermediates, which are enveloped and secreted as infectious viral particles, or transported back into the nucleus to replenish and maintain a stable cccDNA pool (pool). See fig. 1B.

To date, HBV is classified into 4 serotypes (adr, adw, ayr, ayw) based on the epitopes present on the envelope protein, and 8 genotypes (A, B, C, D, E, F, G and H) based on the sequence of the viral genome. HBV genotypes are distributed in different geographical regions. For example, the most prevalent genotypes in asia are genotypes B and C. Genotype D predominates in africa, the middle east and india, whereas genotype a is widely distributed in northern europe, sub-saharan africa and west africa.

HBV antigens

As used herein, the terms "HBV antigen", "antigenic polypeptide of HBV", "HBV antigenic polypeptide", "HBV antigenic protein", "HBV immunogenic polypeptide" and "HBV immunogen" all refer to a polypeptide that is capable of inducing an immune response, e.g., a humoral and/or cell-mediated response, against HBV in a subject. The HBV antigen may be a polypeptide, fragment or epitope thereof, or a combination of HBV polypeptides, portions or derivatives thereof. HBV antigens are capable of eliciting a protective immune response in a host, e.g., inducing an immune response against a viral disease or infection, and/or generating immunity against a viral disease or infection in a subject (i.e., vaccination), which protects a subject from a viral disease or infection. For example, an HBV antigen may comprise a polypeptide from any HBV protein or immunogenic fragment thereof, such as HBeAg, pre-core protein, HBsAg (S, M or L protein), core protein, viral polymerase or HBx protein derived from any HBV genotype (e.g. genotype A, B, C, D, E, F, G and/or H, or a combination thereof).

(1) HBV core antigen

As used herein, each of the terms "HBV core antigen", "HBcAg" and "core antigen" refers to an HBV antigen that is capable of inducing an immune response, e.g., a humoral and/or cell-mediated response, against HBV core protein in a subject. The terms "core", "core polypeptide" and "core protein" each refer to the HBV viral core protein. The full-length core antigen is typically 183 amino acids in length and includes an assembly domain (amino acids 1-149) and a nucleic acid binding domain (amino acids 150-183). The 34-residue nucleic acid binding domain is essential for encapsidation of the pregenomic RNA. This domain also serves as the nuclear input signal. It contains 17 arginine residues and is highly basic, consistent with its function. HBV core protein is dimeric in solution, and the dimers self-assemble into icosahedral capsids. Each dimer of the core protein has 4 α -helical bundles flanked by α -helical domains at both ends. Truncated HBV core proteins lacking the nucleic acid binding domain can also form capsids.

In one embodiment of the present application, the HBV antigen is a truncated HBV core antigen. As used herein, "truncated HBV core antigen" refers to an HBV antigen that does not comprise the full length of the HBV core protein, but is capable of inducing an immune response in a subject against HBV core protein. For example, HBV core antigen may be modified to delete one or more amino acids of the highly positively charged (arginine-rich) C-terminal nucleic acid binding domain of the core antigen, which domain typically comprises 17 arginine (R) residues. In some embodiments of the present application, the HBV core antigen is a truncated HBV core protein. The truncated HBV core antigen of the present application is preferably a C-terminal truncated HBV core protein (which does not comprise HBV core nuclear import signal) and/or a truncated HBV core protein (from which the C-terminal HBV core nuclear import signal has been deleted). In one embodiment of the present application, the truncated HBV core antigen comprises a deletion in the C-terminal nucleic acid binding domain, e.g. a deletion of 1-34 amino acid residues of the C-terminal nucleic acid binding domain, e.g. 1,2, 3, 4,5, 6,7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 or 34 amino acid residues, preferably all 34 amino acid residues are deleted. In a preferred embodiment, the truncated HBV core antigen comprises a deletion in the C-terminal nucleic acid binding domain, preferably all 34 amino acid residues.

According to embodiments of the present application, the HBV core antigen may be a consensus sequence derived from multiple HBV genotypes (e.g. genotypes A, B, C, D, E, F, G and H). As used herein, "consensus sequence" refers to an artificial amino acid sequence that is aligned based on the amino acid sequences of homologous proteins, e.g., as determined by alignment of the amino acid sequences of homologous proteins (e.g., using Clustal Omega). It may be a calculated ordering (order) of the most frequent amino acid residues found at each position of the sequence alignment based on the sequence of HBV antigens (e.g., core, pol, etc.) of at least 100 natural HBV isolates. The consensus sequence may be non-naturally occurring and may differ from the native viral sequence. The consensus sequence can be designed by aligning multiple HBV antigen sequences from different sources using multiple sequence alignment tools and selecting the most frequent amino acid at the variable alignment positions. Preferably, the consensus sequence of HBV antigens is derived from HBV genotypes B, C and D. The term "consensus antigen" refers to an antigen having a consensus sequence.

The truncated HBV core antigen of an embodiment of the present application lacks nucleic acid binding function and is capable of inducing an immune response in a mammal against at least two HBV genotypes. Preferably, the truncated HBV core antigen is capable of inducing a T cell response in a mammal against at least HBV genotypes B, C and D. More preferably, the truncated HBV core antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D.

In a preferred embodiment of the present application, the HBV core antigen is a consensus antigen, preferably a consensus antigen derived from HBV genotypes B, C and D, more preferably a truncated consensus antigen derived from HBV genotypes B, C and D. Exemplary truncated HBV core consensus antigens of the present application consist of an amino acid sequence that is at least 90% identical to SEQ ID No. 2, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID No. 2. SEQ ID NO 2 is the core consensus antigen derived from HBV genotypes B, C and D. SEQ ID NO 2 contains a 34-amino acid C-terminal deletion of the highly positively charged (arginine-rich) nucleic acid binding domain of the native core antigen.

In a specific embodiment of the present application, the HBV core antigen is a truncated HBV antigen consisting of the amino acid sequence of SEQ ID NO. 2.

(2) HBV polymerase antigens

As used herein, the term "HBV polymerase antigen", "HBV Pol antigen" or "HBV Pol antigen" refers to an HBV antigen which is capable of inducing an immune response, e.g. a humoral and/or cell-mediated response, against HBV polymerase in a subject. The terms "polymerase", "polymerase polypeptide", "Pol" and "Pol" each refer to HBV viral DNA polymerase. The HBV viral DNA polymerase has 4 domains, including, from N-terminus to C-terminus, a Terminal Protein (TP) domain, which serves as a primer for minus strand DNA synthesis; a spacer, which is not critical for polymerase function; a Reverse Transcriptase (RT) domain for transcription; and an RNase H domain.

In one embodiment of the present application, the HBV antigen comprises HBV Pol antigen, or any immunogenic fragment or combination thereof. The HBV Pol antigens may contain further modifications to improve the immunogenicity of the antigen, for example by introducing mutations into the active sites of the polymerase and/or RNase domains to reduce or substantially eliminate certain enzymatic activities.

Preferably, the HBV Pol antigen of the present application does not have reverse transcriptase activity and RNase H activity and may be capable of inducing an immune response in a mammal against at least two HBV genotypes. Preferably, the HBV Pol antigen is capable of inducing a T cell response in a mammal against at least HBV genotypes B, C and D. More preferably, the HBV Pol antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D.

Thus, in some embodiments of the present application, the HBV Pol antigen is an inactivated Pol antigen. In one embodiment of the present application, the inactivated HBV Pol antigen comprises one or more amino acid mutations in the active site of the polymerase domain. In another embodiment, the inactivated HBV Pol antigen comprises one or more amino acid mutations in the active site of the RNaseH domain. In a preferred embodiment, the inactivated HBV pol antigen comprises one or more amino acid mutations in the active sites of the polymerase domain and the RNaseH domain. For example, the "YXDD" motif in the polymerase domain of the HBV pol antigen necessary for nucleotide/metal ion binding may be mutated, e.g., to replace one or more aspartic acid residues (D) with asparagine residues (N), to eliminate or reduce the metal coordination function, thereby reducing or substantially eliminating reverse transcriptase function. Mutation instead of, or in addition to, the "YXDD" motif²⁺The "DEDD" in the RNaseH domain of the HBV pol antigen required for coordination may also be mutated, for example, to replace one or more aspartic acid residues (D) with asparagine residues (N) and/or to replace glutamic acid residues (E) with glutamine (Q), thereby reducing or substantially eliminating RNaseH function. In one embodiment, the HBV pol antibodyThe antigen was modified by: (1) mutating an aspartic acid residue (D) to an asparagine residue (N) in the "YXDD" motif of the polymerase domain; and (2) mutating the first aspartic acid residue (D) to an asparagine residue (N) and the first glutamic acid residue (E) to a glutamine residue (N) in the "ded" motif of the RNaseH domain, thereby reducing or substantially eliminating the reverse transcriptase and RNaseH functions of the pol antigen.

In a preferred embodiment of the present application, the HBV pol antigen is a consensus antigen, preferably a consensus antigen derived from HBV genotypes B, C and D, more preferably an inactivated consensus antigen derived from HBV genotypes B, C and D. An exemplary HBV pol consensus antigen of the present application comprises an amino acid sequence that is at least 90% identical to SEQ ID No. 4, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID No. 4, preferably at least 98% identical to SEQ ID No. 4, e.g., at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID No. 4. SEQ ID NO 4 is a consensus antigen derived from HBV genotypes B, C and D, comprising 4 mutations in the active sites of the polymerase and RNaseH domains. Specifically, the 4 mutations include mutation of the aspartic acid residue (D) to the asparagine residue (N) in the "YXDD" motif of the polymerase domain, and mutation of the first aspartic acid residue (D) to the asparagine residue (N) and mutation of the glutamic acid residue (E) to the glutamine residue (Q) in the "ded" motif of the RNaseH domain.

In a specific embodiment of the present application, the HBV pol antigen comprises the amino acid sequence of SEQ ID NO. 4. In other embodiments of the present application, the HBV pol antigen consists of the amino acid sequence of SEQ ID NO 4.

(3) Fusion of HBV core antigen and HBV polymerase antigen

As used herein, the term "fusion protein" or "fusion" refers to a single polypeptide chain having at least two polypeptide domains that are not normally present in a single native polypeptide.

In one embodiment of the present application, the HBV antigen comprises a fusion protein comprising a truncated HBV core antigen operably linked to a HBVpol antigen, or a HBV pol antigen operably linked to a truncated HBV core antigen, preferably linked by a linker.

As used herein, the term "linker" refers to a compound or moiety that acts as a molecular bridge to operably link two different molecules, wherein one portion of the linker is operably linked to a first molecule, and wherein another portion of the linker is operably linked to a second molecule. For example, in a fusion protein comprising a first polypeptide and a second heterologous polypeptide, the linker serves primarily as a spacer between the first and second polypeptides. In one embodiment, the linker is composed of amino acids linked by peptide bonds, preferably 1-20 amino acids linked by peptide bonds, wherein said amino acids are selected from the 20 naturally occurring amino acids. In one embodiment, the 1-20 amino acids are selected from glycine, alanine, proline, asparagine, glutamine, and lysine. Preferably, the linker is composed of the majority of sterically unhindered amino acids, such as glycine and alanine. Exemplary linkers are polyglycines, in particular (Gly)₅、(Gly)₈(ii) a Poly (Gly-Ala) and polyalanine. An exemplary suitable linker shown in the examples below is (AlaGly)_nWherein n is an integer of 2 to 5.

Preferably, the fusion protein of the present application is capable of inducing an immune response in a mammal against HBV core and HBV Pol of at least two HBV genotypes. Preferably, the fusion protein is capable of inducing a T cell response in a mammal against at least HBV genotypes B, C and D. More preferably, the fusion protein is capable of inducing a CD8T cell response against at least HBV genotypes A, B, C and D in a human subject.

In one embodiment of the application, the fusion protein comprises a truncated HBV core antigen having an amino acid sequence that is at least 90% identical to SEQ ID NO 2, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO 2, a linker, and an HBV pol antigen having an amino acid sequence that is at least 90% identical to SEQ ID NO 4, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical.

In a preferred embodiment of the present application, the fusion protein comprises a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID NO:2, a linker comprising (AlaGly)_nWherein n is an integer of 2 to 5, said HBV Pol antigen having an amino acid sequence of SEQ ID NO 4. More preferably, the fusion protein of an embodiment of the present application comprises the amino acid sequence of SEQ ID NO 12.

In one embodiment of the present application, the fusion protein further comprises a signal sequence. Preferably, the signal sequence has the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11. More preferably, the fusion protein comprises the amino acid sequence of SEQ ID NO 13.

Polynucleotides and vectors

In another general aspect, the present application provides a non-naturally occurring nucleic acid molecule encoding an HBV antigen of an embodiment of the application, and a vector comprising the non-naturally occurring nucleic acid. The non-naturally occurring nucleic acid molecule can comprise any polynucleotide sequence encoding an HBV antigen of the present application, which can be prepared according to the present disclosure using methods known in the art. Preferably, the polynucleotide encodes at least one of an HBV core antigen and an HBV polymerase antigen of the present application. Polynucleotides may be in the form of RNA or in the form of DNA, which may be obtained by recombinant techniques (e.g., cloning) or prepared synthetically (e.g., chemical synthesis). The DNA may be single-stranded or double-stranded, or may contain portions of both double-stranded and single-stranded sequences. The DNA may, for example, comprise genomic DNA, cDNA, or a combination thereof. The polynucleotide may also be a DNA/RNA hybrid. The polynucleotides and vectors of the present application may be used for recombinant protein production, protein expression in host cells, or production of viral particles. Preferably, the polynucleotide is DNA.

In one embodiment of the present application, the non-naturally occurring nucleic acid molecule comprises a polynucleotide encoding a truncated HBV core antigen consisting of an amino acid sequence at least 90% identical to SEQ ID No. 2, e.g. at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID No. 2, preferably at least 98%, 99% or 100% identical to SEQ ID No. 2. In a specific embodiment of the present application, the non-naturally occurring nucleic acid molecule encodes a truncated HBV core antigen comprising the amino acid sequence of SEQ ID NO. 2.

Examples of polynucleotide sequences encoding a truncated HBV antigen of the present application include, but are not limited to, polynucleotide sequences that are at least 90% identical to SEQ ID No. 1, e.g. at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID No. 1, preferably at least 98%, 99% or 100% identical to SEQ ID No. 1, said truncated HBV core antigen comprising the amino acid sequence of SEQ ID No. 2. In a specific embodiment of the present application, the non-naturally occurring nucleic acid molecule encoding a truncated HBV core antigen comprises the polynucleotide sequence of SEQ ID NO. 1, 17 or 18.

In one embodiment of the application, the non-naturally occurring nucleic acid molecule encodes an HBV polymerase antigen comprising an amino acid sequence which is at least 90% identical to SEQ ID No. 4, e.g. at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID No. 4, preferably 4100% identical to SEQ ID NO. In a specific embodiment of the present application, the non-naturally occurring nucleic acid molecule encodes an HBV polymerase antigen comprising the amino acid sequence of SEQ ID NO. 4.

Examples of polynucleotide sequences encoding HBV Pol antigens of the present application include, but are not limited to, polynucleotide sequences which are at least 90% identical to SEQ ID No. 3, e.g. at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID No. 3, preferably at least 98%, 99% or 100% identical to SEQ ID No. 4, said HBV Pol antigens comprising the amino acid sequence of SEQ ID No. 4. In a specific embodiment of the present application, the non-naturally occurring nucleic acid molecule encoding the pol antigen of HBV comprises the polynucleotide sequence of SEQ ID NO. 3, 19 or 20.

In another embodiment of the present application, the non-naturally occurring nucleic acid molecule encodes a fusion protein comprising a truncated HBV core antigen operably linked to an HBV Pol antigen, or an HBV Pol antigen operably linked to a truncated HBV core antigen. In a specific embodiment, the non-naturally occurring nucleic acid molecule of the present application encodes a truncated HBV core antigen consisting of an amino acid sequence at least 90% identical to SEQ ID No. 2, e.g. at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID No. 2, a linker and an HBV polymerase antigen, preferably 2100% identical to SEQ ID NO; the HBV polymerase antigen comprises an amino acid sequence which is at least 90% identical to SEQ ID No. 4, e.g. at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID No. 4, preferably at least 98%, 99% or 100% identical to SEQ ID No. 4. In a specific embodiment of the present application, the non-naturally occurring nucleic acid molecule encodes a fusion protein comprising a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID NO. 2, a linker and an HBV Pol antigen; the linker comprises (AlaGly) n, wherein n is an integer from 2 to 5; the HBV Pol antigen comprises the amino acid sequence of SEQ ID NO. 4. In a specific embodiment of the present application, the non-naturally occurring nucleic acid molecule encodes a fusion protein comprising the amino acid sequence of SEQ ID NO 12.

Examples of polynucleotide sequences encoding fusion proteins of the present application include, but are not limited to, polynucleotide sequences that are operably linked to a linker coding sequence that is at least 90% identical to SEQ ID NO. 1, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO. 1, preferably at least 98%, 99%, or 100% identical to SEQ ID NO. 1, the linker coding sequence being at least 90% identical to SEQ ID NO. 14, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, (SEQ ID NO. 1), 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical, preferably at least 98%, 99% or 100% identical to SEQ ID No. 14, said linker coding sequence being further operably linked to a polynucleotide sequence which is at least 90% identical to SEQ ID No. 3, e.g. at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID No. 3, preferably at least 98%, 99% or 100% identical. In a specific embodiment of the present application, the non-naturally occurring nucleic acid molecule encodes a fusion protein comprising SEQ ID NO. 1 operably linked to SEQ ID NO. 14, which is further operably linked to SEQ ID NO. 3.

In another general aspect, the present application relates to a vector comprising an isolated polynucleotide encoding an HBV antigen. As used herein, a "vector" is a nucleic acid molecule used to bring genetic material into other cells where it can be replicated and/or expressed. Any vector known to those skilled in the art may be used in light of this disclosure. Examples of vectors include, but are not limited to, plasmids, viral vectors (phage, animal and plant viruses), cosmids, and artificial chromosomes (e.g., YACs). Preferably, the vector is a DNA plasmid. The vector may be a DNA vector or an RNA vector. One skilled in the art, in light of this disclosure, can construct the vectors of the present application by standard recombinant techniques.

According to embodiments of the present application, the vector may be an expression vector. As used herein, the term "expression vector" refers to any type of genetic construct comprising a nucleic acid encoding an RNA that is capable of being transcribed. Expression vectors include, but are not limited to, vectors for recombinant protein expression, such as DNA plasmids or viral vectors, and vectors for delivering nucleic acids into a subject for expression in a tissue of the subject, such as DNA plasmids or viral vectors. It will be appreciated by those skilled in the art that the design of an expression vector may depend on such factors: selection of the host cell to be transformed, the level of expression of the desired protein, etc.

The vectors of the embodiments of the present application may contain various regulatory sequences. As used herein, the term "regulatory sequence" refers to any sequence that allows, contributes to, or modulates the functional regulation of a nucleic acid molecule, including the replication, multiplication, transcription, splicing, translation, stability, and/or transport to a host cell or organism of a nucleic acid or one of its derivatives (i.e., mRNA). In the context of the present disclosure, the term encompasses promoters, enhancers, and other expression control elements (such as polyadenylation signals and elements that affect mRNA stability).

In some embodiments of the present application, the vector is a non-viral vector. Examples of non-viral vectorsIncluding but not limited to DNA plasmids, bacterial artificial chromosomes, yeast artificial chromosomes, bacteriophages and the like. Preferably, the non-viral vector is a DNA plasmid. "DNA plasmid" is used interchangeably with "DNA plasmid vector", "plasmid DNA", or "plasmid DNA vector" and refers to a double-stranded, and usually circular, DNA sequence capable of autonomous replication in a suitable host cell. The DNA plasmid used to express the encoded polynucleotide typically contains an origin of replication, a multiple cloning site, and a selectable marker, which may be, for example, an antibiotic resistance gene. Examples of DNA plasmids suitable for use in the present application include, but are not limited to, commercially available expression vectors for well known expression systems, including prokaryotic and eukaryotic systems, such as pSE420(Invitrogen, San Diego, Calif), which can be used to prepare and/or express proteins in Escherichia coli; pYES2(Invitrogen, Thermo Fisher scientific), which may be used for preparation and/or expression in a Saccharomyces cerevisiae strain of yeast;

a complete baculovirus expression system (Thermo Fisher Scientific) which can be used for preparation and/or expression in insect cells; PcdDNA^TMOr pcDNA3^TM(Life Technologies, Thermo Fisher scientific) that can be used for high levels of constitutive protein expression in mammalian cells; and pVAX or pVAX-1(Life Technologies, Thermo Fisher Scientific), which can be used for high-level transient expression of proteins of interest in most mammalian cells. The backbone of any commercially available DNA plasmid can be modified to optimize protein expression in a host cell, for example, to reverse the orientation of certain elements (e.g., the origin of replication and/or the antibiotic resistance cassette), to replace promoters endogenous to the plasmid (e.g., promoters in the antibiotic resistance cassette), and/or to replace polynucleotide sequences encoding transcribed proteins (e.g., coding sequences for antibiotic resistance genes) by using conventional techniques and readily available starting materials. (see, e.g., Sambrook et al, Molecular Cloning a Laboratory Manual, Second Ed. Cold spring Harbor Press (1989)).

In a preferred embodiment of the present application, DNPlasmid a is an expression vector suitable for protein expression in mammalian host cells. Expression vectors suitable for protein expression in mammalian host cells include, but are not limited to, pcDNA^TM、pcDNA3^TMpVAX, pVAX-1, ADVAX, NTC8454 and the like. Preferably, the expression vector is based on pVAX-1, which may be further modified to optimize protein expression in mammalian cells. pVAX-1 is a plasmid commonly used in DNA vaccines and comprises a strong human cytomegalovirus immediate early (CMV-IE) promoter followed by a bovine growth hormone (bGH) -derived polyadenylation sequence (pA). pVAX-1 also contains a pUC origin of replication and a kanamycin resistance gene driven by a small prokaryotic promoter, which allows the propagation of bacterial plasmids.

In one embodiment of the present application, the vector is a viral vector. Typically, the viral vector is a genetically engineered virus with modified viral DNA or RNA that is already non-infectious, but still contains a viral promoter and a transgene, allowing translation of the transgene by the viral promoter. Because viral vectors often lack infectious sequences, they require helper viruses or packaging lines for large-scale transfection. Examples of viral vectors suitable for use in the present application include, but are not limited to, adenoviral vectors, Modified Vaccinia Ankara (MVA) vectors, adeno-associated viral vectors, poxvirus vectors, enteroviral vectors, venezuelan equine encephalitis viral vectors, Semliki Forest Virus (Semliki Forest Virus) vectors, tobacco mosaic viral vectors, lentivirus (lentivirus) vectors, and the like.

According to embodiments of the present application, a vector, such as a DNA plasmid or viral vector, may comprise any regulatory elements to establish the general function of the vector, including but not limited to replication and expression of HBV antigens encoded by the polynucleotide sequences of the vector. Regulatory elements include, but are not limited to, promoters, enhancers, polyadenylation signals, translation stop codons, ribosome binding elements, transcription terminators, selectable markers, origins of replication, and the like. The vector may comprise one or more expression cassettes. An "expression cassette" is a portion of a vector that directs the cellular machinery to produce RNA and proteins. The expression cassette typically comprises 3 components: a promoter sequence, an open reading frame, and a 3' -untranslated region (UTR) optionally comprising a polyadenylation signal. An Open Reading Frame (ORF) is a reading frame that contains the coding sequence for a protein of interest (e.g., an HBV antigen), from a start codon to a stop codon. The regulatory elements of the expression cassette may be operably linked to a polynucleotide sequence encoding an HBV antigen of interest. As used herein, the term "operably linked" is used in its broadest reasonable context and means that polynucleotide elements are linked in a functional relationship. A polynucleotide is "operably linked" when it is placed in a functional relationship with another polynucleotide. For example, a promoter is operably linked to a coding sequence if it affects the transcription of the coding sequence.

In some embodiments, the vector comprises a promoter sequence, preferably in an expression cassette, to control expression of the HBV antigen of interest. The term "promoter" is used in its conventional sense and refers to a nucleotide sequence that initiates transcription of an operably linked nucleotide sequence. Promoters are located in the vicinity of the same strand of the nucleotide sequence that they transcribe. Promoters may be constitutive, inducible or repressible. Promoters may be naturally occurring or synthetic. Sources from which the promoter may be derived include viruses, bacteria, fungi, plants, insects, and animals. The promoter may be a homologous promoter (i.e., derived from the same genetic source as the vector) or a heterologous promoter (i.e., derived from a different vector or genetic source). For example, if the vector to be used is a DNA plasmid, the promoter may be endogenous to the plasmid (homologous), or derived from another source (heterologous). Preferably, the promoter is located upstream of the polynucleotide encoding the HBV antigen in the expression cassette.

Examples of promoters suitable for use herein include, but are not limited to, promoters from simian virus 40(SV40), Mouse Mammary Tumor Virus (MMTV) promoter, Human Immunodeficiency Virus (HIV) promoters, such as the Bovine Immunodeficiency Virus (BIV) Long Terminal Repeat (LTR) promoter, Moloney (Moloney) virus promoter, Avian Leukemia Virus (ALV) promoter, Cytomegalovirus (CMV) promoters, such as the CMV immediate early promoter (CMV-IE), Epstein Barr Virus (EBV) promoter, or Rous Sarcoma Virus (RSV) promoter. Other promoters suitable for use in the present application include, but are not limited to, the RSV promoter, the retroviral LTR, the adenoviral major late promoter, and various poxvirus promoters, including, but not limited to, the following vaccinia virus or MVA-derived and FPV-derived promoters: a 30K promoter, an I3 promoter, a PrS promoter, PrHyb, a PrS5E promoter, pr7.5k, a pr13.5 long promoter, a 40K promoter, a MVA-40K promoter, a FPV 40K promoter, a 30K promoter, a PrSynIIm promoter, a PrLE1 promoter, and a PR1238 promoter. Additional promoters are also described in WO 2010/060632, WO 2010/102822, WO 2013/189611, WO 2014/063832 and WO2017/021776, which are incorporated herein by reference in their entirety.

The promoter may also be a promoter from a human gene, such as human actin, human myosin, human hemoglobin, human muscle creatine or human metallothionein. The promoter may also be a tissue-specific promoter, such as a muscle-or skin-specific promoter, natural or synthetic.

In a preferred embodiment of the present application, the promoter is a strong eukaryotic promoter, preferably the cytomegalovirus immediate early promoter (CMV-IE) promoter. The nucleotide sequence of an exemplary CMV-IE promoter is shown in SEQ ID NO 7.

In another preferred embodiment of the present application, the promoter is a poxvirus promoter, preferably a promoter selected from PrMVA13.5 long and/or PrHyb. The nucleotide sequences of the exemplary Pr13.5 long promoter and PrHyb promoter are shown in SEQ ID NOS: 25 and 26, respectively.

In some embodiments, the vector comprises additional polynucleotide sequences that stabilize the expressed transcript, enhance nuclear export of the RNA transcript, and/or improve transcription-translation coupling. Examples of such sequences include polyadenylation signals and enhancer sequences. The polyadenylation signal is usually located downstream of the coding sequence for the protein of interest (e.g., the HBV antigen) in the expression cassette of the vector. Enhancer sequences are regulatory DNA sequences which, when bound by a transcription factor, enhance transcription of the relevant gene. The enhancer sequence is preferably located upstream of the polynucleotide sequence encoding the HBV antigen in the expression cassette of the vector, but downstream of the promoter sequence.

Any polyadenylation signal known to those of skill in the art may be used in light of this disclosure. For example, the polyadenylation signal may be the SV40 polyadenylation signal (as shown in SEQ ID NO:16), the LTR polyadenylation signal, the bovine growth hormone (bGH) polyadenylation signal, the human growth hormone (hGH) polyadenylation signal, or the human β -globin polyadenylation signal. In a preferred embodiment of the present application, the polyadenylation signal is the bovine growth hormone (bGH) polyadenylation signal. The nucleotide sequence of an exemplary bGH polyadenylation signal is shown in SEQ ID NO 9.

Any enhancer sequence known to those of skill in the art may be used in light of this disclosure. For example, the enhancer sequence may be human actin, human myosin, human hemoglobin, human muscle creatine, or a viral enhancer (e.g., from CMV, HA, RSV, or EBV). Examples of specific enhancers include, but are not limited to, Woodchuck (Woodchuck) HBV post-transcriptional regulatory element (WPRE), intron/exon sequences derived from human apolipoprotein a1 precursor, the untranslated R-U5 domain of the Long Terminal Repeat (LTR) of human T cell leukemia virus type 1 (HTLV-1), splicing enhancers, synthetic rabbit β -globin introns, or any combination thereof. In a preferred embodiment of the present application, the enhancer sequence is a composite sequence of the untranslated R-U5 domain of the HTLV-1LTR, the rabbit β -globin intron, and the three constitutive elements of the splicing enhancer, which is referred to herein as the "triple enhancer sequence". The nucleotide sequence of an exemplary triple enhancer sequence is shown in SEQ ID NO 8. Another exemplary enhancer sequence is the ApoAI gene fragment shown in SEQ ID NO. 15.

In some embodiments, the vector comprises a polynucleotide sequence encoding a signal peptide sequence. Preferably, the polynucleotide sequence encoding the signal peptide sequence is located upstream of the polynucleotide sequence encoding the HBV antigen. Signal peptides generally direct the localization of proteins, promote secretion of proteins from cells in which they are produced, and/or improve antigen expression and cross-presentation to antigen presenting cells. The signal peptide, when expressed from the vector, may be present at the N-terminus of the HBV antigen, but is cleaved by a signal peptidase, e.g. when secreted from the cell. Proteins that cleave the expression of the signal peptide are commonly referred to as "mature proteins". Any signal peptide known in the art may be used in accordance with the present disclosure. For example, the signal peptide may be a cystatin S signal peptide; immunoglobulin (Ig) secretion signals, such as Ig heavy chain gamma signal peptide SPIgG or Ig heavy chain signal peptide SPIgE.

In a preferred embodiment of the present application, the signal peptide sequence is the cystatin S signal peptide. Exemplary nucleic acid and amino acid sequences of the cystatin S signal peptide are shown in SEQ ID NO 5 and 6, respectively. Exemplary nucleic acid and amino acid sequences of immunoglobulin secretion signals are shown in SEQ ID NOS: 10 and 27 and SEQ ID NO:11, respectively.

Vectors such as DNA plasmids may also contain bacterial origins of replication and antibiotic resistance expression cassettes for selection and maintenance of the plasmids in bacterial cells such as e. The bacterial origin of replication and the antibiotic resistance cassette may be in the same orientation or in the opposite (reverse) orientation of the expression cassette encoding the HBV antigen in the vector. The Origin of Replication (ORI) is the sequence that initiates replication, which allows the plasmid to replicate and survive in the cell. Examples of ORIs suitable for use in the present application include, but are not limited to, ColE1, pMB1, pUC, pSC101, R6K, and 15A, preferably pUC. An exemplary nucleotide sequence of pUC ORI is shown in SEQ ID NO: 21.

Expression cassettes for selection and maintenance in bacterial cells typically comprise a promoter sequence operably linked to an antibiotic resistance gene. Preferably, the promoter sequence operably linked to the antibiotic resistance gene is different from the promoter sequence operably linked to the polynucleotide sequence encoding the protein of interest (e.g., HBV antigen). The antibiotic resistance gene may be codon optimized and the sequence composition of the antibiotic resistance gene is typically adjusted to the codon usage of bacteria such as e. Any antibiotic resistance gene known to those of skill in the art may be used in light of this disclosure, including but not limited to the kanamycin resistance gene (Kan)^r) Ampicillin resistance gene (Amp)^r) And tetracycline resistance gene (Tet)^r) And genes that confer resistance to chloramphenicol, bleomycin (bleomycin), spectinomycin (spectinomycin), carbenicillin, and the like.

In another specific embodiment of the present application, the vector is a viral vector, preferably an adenoviral vector, comprising an expression cassette comprising a polynucleotide encoding at least one HBV antigen selected from the group consisting of HBV pol antigen comprising an amino acid sequence at least 98% identical to SEQ ID No. 4, such as at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID No. 4 and a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2; an upstream sequence operably linked to a polynucleotide encoding an HBV antigen comprising, from the 5 'end to the 3' end, a promoter sequence (preferably the CMV-IE promoter sequence of SEQ ID NO:7), an enhancer sequence (preferably the triple enhancer sequence of SEQ ID NO:8 or the ApoA1 enhancer sequence of SEQ ID NO:15) and a polynucleotide sequence encoding a signal peptide sequence (preferably a cystatin S signal having the amino acid sequence of SEQ ID NO:6 or an immunoglobulin secretion signal having the amino acid sequence of SEQ ID NO: 11); and a downstream sequence, operably linked to a polynucleotide encoding an HBV antigen, comprising a polyadenylation signal (preferably the SV40 polyadenylation signal of SEQ ID NO:16 or the bGH polyadenylation signal of SEQ ID NO: 9).

In another specific embodiment of the present application, the vector is a viral vector, preferably a MVA vector, comprising an expression cassette comprising a polynucleotide encoding at least one HBV antigen selected from the group consisting of HBV pol antigen comprising an amino acid sequence at least 98% identical to SEQ ID No. 4, such as at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID No. 4 and a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2; an upstream sequence operably linked to a polynucleotide encoding an HBV antigen comprising, from 5 'to 3', a promoter sequence (preferably the PrMVA13.5 long promoter sequence of SEQ ID NO:25 or the PrHyb promoter sequence of SEQ ID NO:26) and a polynucleotide sequence encoding a signal peptide sequence (preferably a cystatin S signal having the amino acid sequence of SEQ ID NO:6 or an immunoglobulin secretion signal having the amino acid sequence of SEQ ID NO: 11); and a downstream sequence operably linked to the polynucleotide encoding the HBV antigen comprising a polyadenylation signal or early termination signal, wherein the early termination signal has the nucleotide sequence of SEQ ID No. 28 or wherein the polyadenylation signal is selected from the SV40 polyadenylation signal having the polynucleotide sequence of SEQ ID No. 16 or the bGH polyadenylation signal having the polynucleotide sequence of SEQ ID No. 9, preferably the downstream sequence operably linked to the polynucleotide encoding the HBV antigen is the early termination signal having the nucleotide sequence of SEQ ID No. 28.

In one embodiment of the present application, a vector, such as a viral vector, encodes an HBV Pol antigen having the amino acid sequence of SEQ ID NO. 4. Preferably, the vector comprises a coding sequence for an HBV Pol antigen which is at least 90% identical to the polynucleotide sequence of SEQ ID NO. 3, e.g. 390%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID NO. 3100%.

In one embodiment of the present application, a vector, such as a viral vector, encodes a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID NO. 2. Preferably, the vector comprises a coding sequence for a truncated HBV core antigen which is at least 90% identical to the polynucleotide sequence of SEQ ID NO. 1, e.g. 190%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID NO. 1, preferably 1100% identical to SEQ ID NO.

In a further embodiment of the present application, the vector, such as a viral vector, encodes a fusion protein comprising the HBV Pol antigen with the amino acid sequence of SEQ ID NO. 4 and the truncated HBV core antigen consisting of the amino acid sequence of SEQ ID NO. 2. Preferably, the vector comprises a coding sequence for a fusion protein comprising a coding sequence for a truncated HBV core antigen operably linked to a coding sequence for a HBV Pol antigen, said coding sequence for a truncated HBV core antigen being at least 90% identical to SEQ ID NO 1, such as 190%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID NO 198%, 99% or 100% identical to SEQ ID NO 3, said coding sequence for a HBV Pol antigen being at least 90% identical to SEQ ID NO 3, such as 390%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, (SEQ ID NO), 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical, preferably 398%, 99% or 100% identical to SEQ ID NO. Preferably, the coding sequence of the truncated HBV core antigen is operably linked to the coding sequence of the HBV Pol antigen by a coding sequence of a linker, which is at least 90% identical to SEQ ID NO. 14, e.g. 1490%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to SEQ ID NO. 1498%, 99% or 100%. In a specific embodiment of the present application, the vector comprises a coding sequence for a fusion protein having SEQ ID NO:1 operably linked to SEQ ID NO:14, SEQ ID NO:14 further operably linked to SEQ ID NO: 3.

The polynucleotides and expression vectors encoding HBV antigens of the present application can be prepared according to the present disclosure by any method known in the art. For example, polynucleotides encoding HBV antigens can be introduced or "cloned" into expression vectors using standard molecular biology techniques, such as Polymerase Chain Reaction (PCR) and the like, which are well known to those skilled in the art.

Adenoviral vectors

In one aspect, the present application provides a recombinant adenovirus comprising a heterologous nucleotide sequence encoding an antigenic HBV core antigen. In another aspect, the present application provides an adenovirus comprising a heterologous nucleotide sequence encoding an antigenic HBV pol antigen. In another aspect, the present application provides a recombinant adenoviral vector comprising a first heterologous nucleotide sequence encoding an antigenic HBV core antigen; and a second heterologous nucleotide sequence encoding an antigenic HBV pol antigen. In another aspect, the present application provides a recombinant adenovirus comprising a heterologous nucleotide sequence encoding an antigenic HBV core-HBV pol fusion protein.

The adenovirus of the present application belongs to the family of adenoviruses (adenoviruses), and is preferably an adenovirus belonging to the genus mammalian adenovirus (Mastadenoviridae). It may be a human adenovirus, but may also be an adenovirus that infects other species, including but not limited to bovine adenoviruses (e.g., bovine adenovirus 3, BAdV3), canine adenoviruses (e.g., CAdV2), porcine adenoviruses (e.g., PAdV3 or 5), simian adenoviruses (which include simian adenoviruses and simian adenoviruses, such as chimpanzee adenoviruses or gorilla adenoviruses). Preferably, the adenovirus is a human adenovirus (HAdV or AdHu; in this application, if reference is made to Ad without specifying the species, this refers to a human adenovirus, for example the abbreviation "Ad 5" refers to the same as HAdV5, which is human adenovirus serotype 5), or a simian adenovirus, such as a chimpanzee adenovirus or a gorilla adenovirus (ChAd, AdCh or SAdV).

Most advanced research has been conducted using human adenoviruses, and according to certain aspects of the present application, human adenoviruses are preferred. In certain preferred embodiments, the recombinant adenoviruses of the present application are based on human adenoviruses. In preferred embodiments, the recombinant adenovirus is based on human adenovirus serotype 5, 11, 26, 34, 35, 48, 49, or 50. According to a particularly preferred embodiment of the present application, the adenovirus is a human adenovirus of one of serotypes 26 or 35.

The advantage of these serotypes is a lower seroprevalence and/or a lower pre-existing neutralizing antibody titer in the human population. The preparation of rAd26 vectors is described, for example, in WO2007/104792 and Abbink et al, (2007) Virol 81(9):4654-63, both of which are incorporated herein by reference in their entirety. Exemplary genomic sequences of Ad26 can be found in GenBank accession numbers EF153474 and WO2007/104792 (see, e.g., SEQ ID NO: 1). Preparation of rAd35 vectors is described, for example, in U.S. Pat. Nos. 7,270,811, WO00/70071 and Vogels et al, (2003) J Virol 77(15):8263-71, which are incorporated herein by reference in their entirety. Exemplary genomic sequences of Ad35 can be found in GenBank accession numbers AC _000019 and WO00/70071 (see, e.g., FIG. 6).

Simian adenoviruses generally have a lower seroprevalence and/or lower pre-existing neutralizing antibody titers in the human population and a great deal of work has been reported with chimpanzee adenovirus vectors (e.g., US 6083716; WO 2005/071093; WO 2010/086189; WO 2010085984; Farina et al,2001, J Virol 75: 11603-13; Cohen et al,2002, J Gen Virol 83: 151-55; Kobinger et al,2006, Virology 346: 394-401; Tatsis et al, 2007, Molecular Therapy 15: 608-17; see also reviews by Bangari and Mittal, 2006, Vaccine24: 849-62; and reviews by Lasaro and Ertl, 2009, Mol Therapy 17: 1333-39). Thus, in other preferred embodiments, the recombinant adenoviruses of the present application are based on simian adenoviruses, e.g., chimpanzee adenoviruses. In one embodiment of the present application, the recombinant adenovirus is based on: 1. 3, 7, 8, 21, 22, 23, 24, 25, 26, 27.1, 28.1, 29, 30, 31.1, 32, 33, 34, 35.1, 36, 37.2, 39, 40.1, 41.1, 42.1, 43, 44, 45, 46, 48, 49, 50 or SA7P simian adenovirus.

Adenovirus vectors rAd26 and rAd35

In a preferred embodiment of the present application, the adenoviral vector comprises capsid proteins from two rare serotypes Ad26 and Ad 35. In typical embodiments, the vector is a rAd26 or rAd35 virus.

Thus, vectors that may be used in the present application comprise Ad26 or Ad35 capsid proteins (e.g., fiber, penton or hexon proteins). One skilled in the art will appreciate that the use of intact Ad26 or Ad35 capsid proteins in the vectors of the present application is not required. Thus, chimeric capsid proteins comprising at least a portion of an Ad26 or Ad35 capsid protein may be used in the vectors of the present application. The vectors of the present application may also comprise capsid proteins, wherein the fiber, penton and hexon proteins are each derived from a different serotype, provided that at least one capsid protein is derived from Ad26 or Ad 35. In a preferred embodiment, the fiber, penton and hexon proteins are each derived from Ad26 or each from Ad 35.

It will be appreciated by those skilled in the art that elements derived from multiple serotypes may be combined in a single recombinant adenoviral vector. Thus, chimeric adenoviruses can be prepared that combine desirable properties from different serotypes. Thus, in some embodiments, the chimeric adenoviruses of the present application can combine the non-preexisting immunity of Ad26 and Ad35 serotypes with characteristics such as: temperature stability, assembly, anchoring, yield, redirected or improved infection, stability of DNA in target cells, and the like.

In one embodiment of the present application, the recombinant adenoviral vector for use in the present application is derived primarily or entirely from Ad35 or Ad26 (i.e., the vector is rAd35 or rAd 26). In some embodiments, the adenovirus is replication-defective, e.g., in that it comprises a deletion in the E1 region of the genome. For adenoviruses derived from Ad26 or Ad35 of the present application, the E4-orf6 coding sequence of the adenovirus is typically exchanged for E4-orf6 of an adenovirus of human subgroup C (e.g., Ad 5). This allows propagation of such adenoviruses in well-known complementary cell lines expressing the E1 gene of Ad5, such as 293 cells, PER. C6 cells, etc. (see, e.g., Havenga et al,2006, J Gen Virol 87: 2135-43; WO 03/104467). In one embodiment of the application, the adenovirus is a human adenovirus of serotype 35, having a deletion in the E1 region cloned with the nucleic acid encoding the antigen and having the E4orf6 region of Ad 5. In one embodiment of the application, the adenovirus is a human adenovirus of serotype 26, having a deletion in the E1 region cloned with the nucleic acid encoding the antigen and having the E4orf6 region of Ad 5. For Ad35 adenoviruses, the 3 'end of the E1B55K open reading frame in the adenovirus is generally retained, for example 166bp directly upstream of the pIX open reading frame or a fragment comprising it, for example a 243bp fragment directly upstream of the pIX start codon, and is tagged at the 5' end with the Bsu36I restriction enzyme site, since this increases the stability of the adenovirus, since the promoter of the pIX gene is located in part in this region (see, for example, Havenga et al,2006, supra; WO 2004/001032).

The preparation of recombinant adenoviral vectors is well known in the art. The preparation of rAd26 vectors is described, for example, in WO2007/104792 and Abbink et al, (2007) Virol 81(9): 4654-63. Exemplary genomic sequences of Ad26 can be found in GenBank accession No. EF153474 and SEQ ID NO 1 of WO 2007/104792. Preparation of rAd35 vectors is described, for example, in U.S. Pat. No. 7,270,811 and Vogels et al, (2003) J Virol 77(15): 8263-71. An exemplary genomic sequence of Ad35 can be found in GenBank accession number AC — 000019.

In one embodiment of the present application, vectors for use in the present application include those described in WO2012/082918, the disclosure of which is incorporated herein by reference in its entirety.

Typically, vectors for use in the present application are prepared using nucleic acids comprising a complete recombinant adenoviral genome (e.g., a plasmid, cosmid, or baculovirus vector). Thus, the present application also provides isolated nucleic acid molecules encoding the adenoviral vectors of the application. The nucleic acid molecules of the present application may be in the form of RNA or DNA obtained by cloning or prepared synthetically. The DNA may be double-stranded or single-stranded.

The adenoviral vectors used in the present application are typically replication-defective. In these embodiments, the virus is made replication-defective by deleting or extinguishing regions critical to virus replication, such as the E1 region. The region may be substantially deleted or inactivated by, for example, insertion of the gene of interest (typically linked to a promoter). In some embodiments, the vectors of the present application may contain deletions in other regions (e.g., the E2, E3, or E4 regions) or contain insertions of heterologous genes linked to a promoter. For E2-and/or E4-mutated adenoviruses, recombinant adenoviruses are generally produced using E2-and/or E4-complementing cell lines. The mutations in the E3 region of adenovirus need not be complemented by the cell line, since E3 is not required for replication.

Packaging cell lines are commonly used to prepare sufficient quantities of the adenoviral vectors of the present application. A packaging cell is a cell that contains a gene that has been deleted or inactivated in a replication-defective vector, thereby allowing the virus to replicate in the cell. Suitable cell lines include, for example, per.c6, 911, 293 and E1 a 549.

As described above, a variety of Hepatitis B Virus (HBV) antigens (e.g., HBV core and HBV polymerase antigens) may be expressed in the vector. If desired, the heterologous gene encoding the HBV antigen can be codon optimized to ensure proper expression in the host being treated (e.g., human). Codon optimization is a technique widely used in the art. Typically, heterologous genes are cloned into the E1 and/or E3 regions of the adenovirus gene.

The heterologous hepatitis b virus gene may be under the control (i.e., operably linked) of an adenovirus-derived promoter (e.g., a major late promoter), or may be under the control of a heterologous promoter. Examples of suitable heterologous promoters include the CMV promoter and the RSV promoter. Preferably, the promoter is located upstream of the heterologous gene of interest in the expression cassette.

MVA vectors

The MVA vectors for use in the present application use attenuated viruses derived from modified vaccinia virus ankara. The MVA vector expresses a variety of HBV antigens (e.g., HBV core and HBV polymerase antigens). In one aspect, the present application provides a recombinant MVA vector comprising a heterologous nucleotide sequence encoding an antigenic HBV core antigen. In another aspect, the present application provides a recombinant MVA vector comprising a heterologous nucleotide sequence encoding an antigenic HBVpol antigen. In one aspect, the present application provides a recombinant MVA vector comprising a first heterologous nucleotide sequence encoding an antigenic HBV core antigen and a second heterologous nucleotide sequence encoding an antigenic HBV pol antigen. In another aspect, the present application provides a recombinant MVA vector comprising a heterologous nucleotide sequence encoding an antigenic HBV core-HBV pol fusion protein.

Modified vaccinia virus ankara (MVA)

Artificial attenuated modified vaccinia virus Ankara ("MVA") was generated by 516 serial passages of the Ankara (Ankara) strain of vaccinia virus (CVA) in chicken embryo fibroblasts (see review Mayr, a., et al. Due to these long passages, the genome of the resulting MVA virus has a deletion of about 31 kbases of its genomic sequence and is therefore described as highly host cell restricted for replication in avian cells (Meyer, h.et al, j.gen.virol.72,1031-1038 (1991)). The resulting MVA was shown to be significantly non-toxic in various animal models compared to the starting material with full replication capacity (Mayr, A. & Danner, K., Dev.biol.Stand.41:225-34 (1978)).

MVA viruses used in the practice of the present application may include, but are not limited to, MVA-572 (deposited as ECACC V94012707, 1/27, 1994); MVA-575 (12.7.2000 as deposited at ECACC V00120707), MVA-I721(Suter et al, cited in Vaccine 2009) and ACAM3000 (3.27.2003 as deposited at

PTA-5095 deposit).

More preferably, MVA as used according to the present application comprises MVA-BN and derivatives of MVA-BN. MVA-BN has been described in PCT International publication WO 02/042480. A "derivative" of MVA-BN refers to a virus that exhibits substantially the same replication characteristics as MVA-BN, but exhibits differences in one or more portions of its genome, as described herein.

MVA-BN and its derivatives are replication incompetent (replication in complement), indicating the inability to reproduce replication in vivo and in vitro. More specifically, in vitro, MVA-BN or a derivative thereof has been described as capable of reproductive replication in Chicken Embryo Fibroblasts (CEF), but not in the following cell lines: human keratinocyte cell line HaCat (Boukamp et al (1988), J.Cell biol.106:761-771), human osteosarcoma cell line 143B (ECACC accession number 91112502), human embryonic kidney cell line 293(ECACC accession number 85120602) and human cervical adenocarcinoma cell line HeLa (ATCC accession number CCL-2). Furthermore, in the Hela and HaCaT cell lines, MVA-BN or a derivative thereof has a virus amplification rate at least 2-fold lower, more preferably 3-fold lower than MVA-575. The testing and determination of these properties of MVA-BN and its derivatives is described in WO02/42480 (U.S. patent application No. 2003/0206926) and WO 03/048184 (U.S. patent application No. 2006/0159699).

As mentioned in the preceding paragraphs, the terms "incapable of reproductive replication" or "replication incompetence" in an in vitro human cell line are described, for example, in WO02/42480, which also teaches how to obtain MVA with the desired properties described above. The term applies to viruses that have an in vitro viral amplification rate of less than 1 at 4 days post infection using the assay described in WO02/42480 or U.S. patent No. 6,761,893.

As described in the preceding paragraphs, the term "failure to reproduce" refers to a virus that has a viral amplification rate of less than 1 in human cell lines in vitro at day 4 post-infection. The assays described in WO02/42480 or U.S. patent No. 6,761,893 can be used to determine the rate of viral amplification.

As described in the preceding paragraphs, the amplification or replication of a virus in an in vitro human cell line is generally expressed as the ratio of the virus produced from the infected cell (output) to the amount of virus initially used to infect the cell (input), referred to as the "amplification rate". The amplification rate "1" defines an amplification state in which the amount of virus produced from the infected cells is the same as that originally used for the infected cells, which means that the infected cells are allowed to infect and propagate the virus. In contrast, an amplification rate of less than 1, i.e., a decrease in output compared to the input level, indicates a lack of reproductive replication and therefore a reduction in virus.

Advantages of MVA-based vaccines include their safety profile and the availability of large-scale vaccine production. Preclinical testing has shown that MVA-BN exhibits superior attenuation and potency compared to other MVA strains (WO 02/42480). Another property of the MVA-BN strain is that it is able to induce substantially the same level of immunity in a vaccinia virus prime/vaccinia virus boost regimen as compared to a DNA prime/vaccinia virus boost regimen.

Recombinant MVA-BN viruses, the most preferred embodiments herein, are considered safe because they are replication-defective in mammalian cells with a clear and well-recognized lack of toxicity. Furthermore, in addition to its efficacy, the feasibility of industrial scale manufacturing is also beneficial. In addition, MVA-based vaccines can deliver a variety of heterologous antigens and allow for the induction of both humoral and cellular immunity.

The MVA vectors for use in the present application may be prepared using methods known in the art, such as those described in WO/2002/042480 and WO/2002/24224, the relevant disclosures of which are incorporated herein by reference.

In a preferred embodiment of the present application, the MVA vector comprises a nucleic acid encoding one or more antigenic proteins selected from the group consisting of: HBV core antigen, HBV pol antigen and HBV core-HBV pol fusion antigen.

The HBV antigenic proteins may be inserted into one or more intergenic regions (IGR) of MVA. In one embodiment of the present application, the IGR is selected from the group consisting of IGR07/08, IGR44/45, IGR 64/65, IGR 88/89, IGR 136/137, and IGR 148/149. In one embodiment of the application, 5, 4, 3 or 2 or less IGRs of the recombinant MVA comprise a heterologous nucleotide sequence encoding an HBV core antigen and/or an antigenic determinant of an HBV pol antigen. The heterologous nucleotide sequence may, additionally or alternatively, be inserted into one or more naturally occurring deletion sites, in particular into the main deletion site I, II, III, IV, V or VI of the MVA genome. In one embodiment of the present application, 5, 4, 3 or 2 or less of the naturally occurring deletion sites of the recombinant MVA comprise a heterologous nucleotide sequence encoding an HBV core antigen and/or an antigenic determinant of an HBV pol antigen.

The number of insertion sites for MVA comprising a heterologous nucleotide sequence encoding an antigenic determinant of an HBV protein may be 1,2, 3, 4,5, 6,7 or more. In one embodiment of the application, the heterologous nucleotide sequence is inserted into 4, 3, 2, or fewer insertion sites. Preferably, 2 insertion sites are used. In one embodiment of the present application, 3 insertion sites are used. Preferably, the recombinant MVA comprises at least 2, 3, 4,5, 6 or 7 genes inserted into 2 or 3 insertion sites.

The recombinant MVA viruses provided herein can be generated using conventional methods known in the art. Methods for obtaining recombinant poxviruses or for inserting exogenous coding sequences into the poxvirus genome are well known to those skilled in the art. For example, methods for standard Molecular biology techniques such as DNA Cloning, DNA and RNA isolation, Western blot analysis, RT-PCR and PCR amplification techniques are described in Molecular Cloning, A Laboratory Manual (2nd Ed.) (J.Sambrook et al, Cold spring Harbor Laboratory Press (1989)), and techniques for processing and manipulating viruses are described in virology methods Manual (B.W.J.Main et al, (eds.), Academic Press (1996)). Similarly, The techniques and expertise for The processing, manipulation and genetic engineering of MVA are described in Molecular Virology: A Practical Approach (A.J. Davison & R.M.Elliott (Eds.), The Practical Approach Series, IRLPress at Oxford University Press, Oxford, UK (1993) (see, e.g., Chapter 9: Expression of genes by viruses vectors) and Current Protocols in Molecular Biology (John Wiley & Son, Inc. (1998) (see, e.g., Chapter 16, Section IV: Expression of proteins in cells using viruses)).

Various recombinant MVA disclosed herein can be generated using different methods. The DNA sequence to be inserted into the virus may be placed in an e.coli (e.coli) plasmid construct into which DNA homologous to a portion of the DNA of MVA has been inserted. The DNA sequence to be inserted can be linked to a promoter, respectively. The promoter-gene junction can be placed in a plasmid construct such that the promoter-gene junction has DNA at both ends that is homologous to DNA sequences flanking the region of the MVA DNA containing the nonessential locus. The resulting plasmid construct can be amplified by propagation in E.coli and isolated. The isolated plasmid comprising the DNA gene sequence to be inserted can be transfected into a cell culture, for example of Chicken Embryo Fibroblasts (CEF), which is simultaneously infected with MVA. Recombination between the homologous MVA DNA in the plasmid and in the viral genome, respectively, can produce MVA modified by the presence of the foreign DNA sequence.

According to a preferred embodiment, cells of a suitable cell culture, such as CEF cells, may be infected with a poxvirus. The infected cells can then be transfected with a first plasmid vector comprising an exogenous or heterologous gene or genes, preferably under the transcriptional control of a poxvirus expression control element. As disclosed above, the plasmid vector further comprises sequences capable of directing the insertion of exogenous sequences into selected portions of the poxvirus genome. Optionally, the plasmid vector further contains a cassette comprising a marker and/or selection gene operably linked to the poxvirus promoter.

Suitable markers or selection genes are, for example, genes which code for green fluorescent protein, beta-galactosidase (beta-galactosidase), neomycin-phosphoribosyltransferase (neomycin-phosphoribosyltransferase) or other markers. The use of a selection cassette or a marker cassette simplifies the identification and isolation of the recombinant poxvirus produced. However, recombinant poxviruses can also be identified by PCR techniques. Subsequently, further cells may be infected with the recombinant poxvirus obtained as described above and transfected with a second vector comprising a second exogenous or heterologous gene or genes. In this case, the gene should be introduced at a different insertion site in the poxvirus genome and the second vector will also differ in the poxvirus homologous sequence which directs the integration of the second foreign gene or genes into the poxvirus genome. When homologous recombination occurs, recombinant viruses comprising two or more foreign or heterologous genes can be isolated. For introducing additional foreign genes into the recombinant virus, the infection and transfection steps can be repeated by using the recombinant virus isolated in the previous infection step, and by using other vectors containing other foreign genes or genes for transfection.

Alternatively, the infection and transfection steps described above are interchangeable, i.e., suitable cells can be transfected first with a plasmid vector containing the foreign gene and then infected with the poxvirus. As a further alternative, it is also possible to introduce foreign genes into different viruses individually, co-infect cells with all the obtained recombinant viruses, and screen recombinants (recombiants) containing all the foreign genes. A third alternative is to join the DNA genome and the foreign sequence in vitro and reconstitute the recombinant vaccinia virus DNA genome using a helper virus. A fourth alternative is homologous recombination between a vaccinia virus genome (e.g., MVA) cloned as a Bacterial Artificial Chromosome (BAC) and a linear exogenous sequence flanked by DNA sequences homologous to the sequences flanking the desired site of integration into the vaccinia virus genome in e.

Heterologous HBV genes (e.g., HBV core antigen, HBV pol antigen, and/or HBV core-HBV-pol fusion protein) may be under the control of (i.e., operably linked to) one or more poxvirus promoters. In one embodiment of the present application, the poxvirus promoter is a pr7.5 promoter, a hybrid early/late promoter or PrS promoter, a PrS5E promoter, a synthetic or natural early or late promoter, or a vaccinia virus ATI promoter.

Compositions, immunogenic combinations and vaccines

The present application also relates to compositions, immunogenic combinations, more specifically kits and vaccines comprising one or more HBV antigens, polynucleotides encoding one or more HBV antigens and/or vectors of the present application. Any of the HBV antigens, polynucleotides (including RNA and DNA) and/or vectors of the present application described herein can be used in the compositions, immunogenic combinations or kits and vaccines of the present application.

In a general aspect, the present application provides a composition comprising an isolated or non-naturally occurring nucleic acid molecule (DNA or RNA) encoding a truncated HBV core antigen consisting of an amino acid sequence at least 90% identical to SEQ ID No. 2 or an HBV polymerase antigen comprising an amino acid sequence at least 90% identical to SEQ ID No. 4; a vector comprising the isolated or non-naturally occurring nucleic acid molecule; and/or an isolated or non-naturally occurring polypeptide encoded by said isolated or non-naturally occurring nucleic acid molecule.

In one embodiment of the present application, the composition comprises an isolated or non-naturally occurring nucleic acid molecule (DNA or RNA) encoding a truncated HBV core antigen consisting of an amino acid sequence at least 90% identical to SEQ ID NO 2, preferably 2100% identical to SEQ ID NO.

In one embodiment of the application, the composition comprises an isolated or non-naturally occurring nucleic acid molecule (DNA or RNA) encoding an HBV Pol antigen comprising an amino acid sequence at least 90% identical to SEQ ID No. 4, preferably 4100% identical to SEQ ID NO.

In one embodiment of the present application, the composition comprises an isolated or non-naturally occurring nucleic acid molecule (DNA or RNA) comprising a polynucleotide sequence encoding a truncated HBV core antigen; and an isolated or non-naturally occurring nucleic acid molecule (DNA or RNA) comprising a polynucleotide sequence encoding an HBV Pol antigen, said truncated HBV core antigen consisting of an amino acid sequence at least 90% identical to SEQ ID NO. 2, preferably 2100% identical to SEQ ID NO, said HBV Pol antigen comprising an amino acid sequence at least 90% identical to SEQ ID NO. 4, preferably 4100% identical to SEQ ID NO. The coding sequences for the truncated HBV core antigen and the HBVpol antigen may be present in the same isolated or non-naturally occurring nucleic acid molecule (DNA or RNA) or in two different isolated or non-naturally occurring nucleic acid molecules (DNA or RNA).

In one embodiment of the present application, the composition comprises a viral vector comprising a polynucleotide encoding a truncated HBV core antigen consisting of an amino acid sequence at least 90% identical to SEQ ID No. 2, preferably 2100% identical to SEQ ID NO.

In one embodiment of the present application, the composition comprises a viral vector comprising a polynucleotide encoding an HBV pol antigen comprising an amino acid sequence at least 90% identical to SEQ ID No. 4, preferably 4100% identical to SEQ ID NO.

In one embodiment of the present application, the composition comprises a viral vector comprising a polynucleotide encoding a truncated HBV core antigen consisting of an amino acid sequence at least 90% identical to SEQ ID No. 2, preferably 2100% identical to SEQ ID NO; and a viral vector comprising a polynucleotide encoding an HBV pol antigen comprising an amino acid sequence at least 90% identical to SEQ ID No. 4, preferably 4100% identical to SEQ ID NO. The vector comprising the coding sequence for the truncated HBV core antigen and the vector comprising the coding sequence for the HBV pol antigen may be the same vector or two different vectors.

In one embodiment of the present application, the composition comprises a viral vector comprising a polynucleotide encoding a fusion protein comprising a truncated HBV core antigen operably linked to an HBV Pol antigen or vice versa, said truncated HBV core antigen consisting of an amino acid sequence at least 90% identical to SEQ ID NO 2, preferably 2100% identical to SEQ ID NO, said HBV Pol antigen comprising an amino acid sequence at least 90% identical to SEQ ID NO 4, preferably 4100% identical to SEQ ID NO. Preferably, the fusion protein further comprises a linker operably linking the truncated HBV core antigen to the HBV Pol antigen or vice versa. Preferably, the linker has (AlaGly)_nWherein n is an integer of 2 to 5.

In one embodiment of the present application, the composition comprises an isolated or non-naturally occurring truncated HBV core antigen consisting of an amino acid sequence which is at least 90% identical to SEQ ID No. 2, preferably 2100% identical to SEQ ID NO.

In one embodiment of the present application, the composition comprises an isolated or non-naturally occurring HBV Pol antigen comprising an amino acid sequence which is at least 90% identical to SEQ ID No. 4, preferably 4100%.

In one embodiment of the present application, the composition comprises an isolated or non-naturally occurring truncated HBV core antigen consisting of an amino acid sequence which is at least 90% identical to SEQ ID No. 2, preferably 2100% identical to SEQ ID NO, and an isolated or non-naturally occurring HBV Pol antigen comprising an amino acid sequence which is at least 90% identical to SEQ ID No. 4, preferably 4100% identical to SEQ ID NO.

In one embodiment of the application, the composition comprises an isolated or non-naturally occurring fusion protein comprising a truncated HBV core antigen operably linked to an HBV Pol antigen or vice versa, said truncated HBV core antigen consisting of an amino acid sequence at least 90% identical to SEQ ID NO 2, preferably 2100% identical to SEQ ID NO, said HBV Pol antigen comprising an amino acid sequence at least 90% identical to SEQ ID NO 4, preferably 4100% identical to SEQ ID NO. Preferably, the fusion protein further comprises a linker operably linking the truncated HBV core antigen to the HBV Pol antigen or vice versa. Preferably, the linker has (AlaGly)_nWherein n is an integer of 2 to 5.

In another general aspect, the present application also relates to an immunogenic combination or kit comprising a polynucleotide expressing a truncated HBV core antigen and an HBV pol antigen of embodiments of the present application. Any of the polynucleotides and/or vectors described herein encoding the HBV core and pol antigens of the present application may be used in the immunogenic combinations or kits of the present application.

According to embodiments of the present application, the polynucleotides in a vaccine combination or kit may be linked or isolated such that HBV antigens expressed from such polynucleotides are fused together or produced as separate proteins, whether expressed from the same or different polynucleotides. In one embodiment, the first and second polynucleotides are present in separate viral vectors, used in combination in the same or separate compositions, such that the expressed proteins are also separate proteins, but used in combination. In another embodiment, the HBV antigens encoded by the first and second polynucleotides may be expressed from the same viral vector, thereby producing an HBV core-pol fusion antigen. Optionally, the core and pol antigens may be joined or fused together by a short linker. Alternatively, the HBV antigens encoded by the first and second polynucleotides may be expressed independently from a single vector using a ribosomal slip site (also known as a cis-hydrolase site) between the core and pol antigen encoding sequences. This strategy results in a bicistronic expression vector in which separate core and pol antigens are generated from a single mRNA transcript. The core and pol antigens produced from such bicistronic expression vectors may have additional N or C terminal residues depending on the ordering of the coding sequences on the mRNA transcript. Examples of ribosome slip sites that can be used for this purpose include, but are not limited to, the FA2 slip site from Foot and Mouth Disease Virus (FMDV). Another possibility is that the HBV antigens encoded by the first and second polynucleotides may be expressed independently from two separate vectors, one encoding the HBV core antigen and the other encoding the HBV pol antigen.

In a preferred embodiment, the first and second polynucleotides are present in separate viral vectors. Preferably, the separate carriers are present in the same composition.

In a specific embodiment of the present application, the immunogenic combination or kit comprises a first vector, preferably a DNA plasmid or a viral vector, comprising a polynucleotide encoding a truncated HBV core antigen consisting of an amino acid sequence at least 90% identical to SEQ ID NO 2, preferably 2100% identical to SEQ ID NO, and a second vector, preferably a DNA plasmid or a viral vector, comprising a polynucleotide encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4, preferably 4100% identical to SEQ ID NO.

In a specific embodiment of the present application, the first vector is a first DNA plasmid and the second vector is a second DNA plasmid. The first and second DNA plasmids each comprise an origin of replication, preferably pUC ORI of SEQ ID NO 21, and an antibiotic resistance cassette, preferably comprising a codon optimized Kan^r(kanamycin resistance) gene having a polynucleotide sequence which is at least 90% identical to SEQ ID NO:22, preferably under the control of a bla promoter, for example the bla promoter as shown in SEQ ID NO: 24. The first and second DNA plasmids each independently further comprise at least one of a promoter sequence, an enhancer sequence and a polynucleotide sequence encoding a signal peptide sequenceOne, operably linked to the first polynucleotide sequence or the second polynucleotide sequence. Preferably, the first and second DNA plasmids each comprise an upstream sequence operably linked to the first polynucleotide or the second polynucleotide, wherein the upstream sequence comprises, from 5 'to 3', the promoter sequence of SEQ ID NO. 7, the enhancer sequence of SEQ ID NO. 8 and a polynucleotide sequence encoding a signal peptide sequence having the amino acid sequence of SEQ ID NO. 6. The first and second DNA plasmids may each further comprise a polyadenylation signal located downstream of the coding sequence of the HBV antigen, for example the bGH polyadenylation signal of SEQ ID NO 9.

In a specific embodiment of the present application, the first vector is a first viral vector and the second vector is a second viral vector. Preferably, the first and second viral vectors are each an adenoviral vector, more preferably an Ad26 or Ad35 vector, comprising an expression cassette comprising a polynucleotide encoding an HBV pol antigen or a truncated HBV core antigen of the present application; an upstream sequence operably linked to a polynucleotide encoding an HBV antigen comprising, from the 5 'end to the 3' end, a promoter sequence (preferably the CMV promoter sequence of SEQ ID NO:7), an enhancer sequence (preferably the ApoAI gene fragment sequence of SEQ ID NO:15 or the triple enhancer sequence of SEQ ID NO: 8) and a polynucleotide sequence encoding a signal peptide sequence (preferably a cystatin S signal having the amino acid sequence of SEQ ID NO:6 or an immunoglobulin secretion signal having the amino acid sequence of SEQ ID NO: 11); and a downstream sequence, operably linked to a polynucleotide encoding an HBV antigen, comprising a polyadenylation signal (preferably the SV40 polyadenylation signal of SEQ ID NO: 16).

In a specific embodiment of the present application, the first vector is a first viral vector and the second vector is a second viral vector. Preferably, the first and second viral vectors are each MVA vectors comprising an expression cassette comprising a polynucleotide encoding an HBV pol antigen or a truncated HBV core antigen of the present application; an upstream sequence operably linked to a polynucleotide encoding an HBV antigen comprising, from 5 'to 3', a promoter sequence (preferably the PrMVA13.5 long promoter sequence of SEQ ID NO:25 or the PrHyb promoter sequence of SEQ ID NO:26) and a polynucleotide sequence encoding a signal peptide sequence (preferably a cystatin S signal having the amino acid sequence of SEQ ID NO:6 or an immunoglobulin secretion signal having the amino acid sequence of SEQ ID NO: 11); and a downstream sequence operably linked to the polynucleotide encoding the HBV antigen, comprising a polyadenylation signal or early termination signal (wherein the early termination signal has the nucleotide sequence of SEQ ID NO:28, or wherein the polyadenylation signal is selected from the SV40 polyadenylation signal having the polynucleotide sequence of SEQ ID NO:16 or the bGH polyadenylation signal having the polynucleotide sequence of SEQ ID NO: 9), preferably the downstream sequence operably linked to the polynucleotide encoding the HBV antigen is an early termination signal having the nucleotide sequence of SEQ ID NO: 28.

In one embodiment of the present application, there is provided a vaccine combination comprising (a) a first composition comprising an immunologically effective amount of an adenoviral vector comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4, wherein the HBV polymerase antigen does not have reverse transcriptase activity and RNase H activity; and (b) a second composition comprising an immunologically effective amount of a modified vaccinia virus ankara (MVA) vector comprising a second polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4, wherein the HBV polymerase antigen does not have reverse transcriptase activity and RNase H activity; wherein the first composition is administered to a human subject for eliciting an immune response and the second composition is administered to the human subject one or more times for boosting the immune response.

In one embodiment of the present application, there is provided a vaccine composition comprising (a) a first composition comprising an immunologically effective amount of a modified vaccinia virus ankara (MVA) vector comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO:4, wherein the HBV polymerase antigen does not have reverse transcriptase activity and RNase H activity; and (b) a second composition comprising an immunologically effective amount of an adenoviral vector comprising a second polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4, wherein the HBV polymerase antigen does not have reverse transcriptase activity and RNase H activity; wherein the first composition is administered to a human subject for eliciting an immune response and the second composition is administered to the human subject one or more times for boosting the immune response.

In those embodiments of the present application where the immunogenic combination comprises a first viral vector and a second viral vector, the amount of each of said first vector and said second vector is not particularly limited. For example, the first and second viral vectors may be present in a ratio of 10:1 to 1:10 by weight, such as a ratio of 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, or 1:10 by weight. Preferably, the first viral vector and the second viral vector are present in a ratio of 1:1 by weight.

The compositions and immunogenic combinations of the present application may comprise additional polynucleotides or vectors encoding additional HBV antigens and/or additional HBV antigens or immunogenic fragments thereof. However, in particular embodiments, the compositions and immunogenic combinations of the present application do not comprise certain antigens.

In a specific embodiment, the composition or immunogenic combination or kit of the present application does not comprise HBsAg or a polynucleotide sequence encoding HBsAg.

In another specific embodiment, the composition or immunogenic combination or kit of the present application does not comprise a HBVL protein or a polynucleotide sequence encoding a HBV L protein.

In another specific embodiment of the present application, the composition or immunogenic combination of the present application does not comprise HBV envelope proteins or polynucleotide sequences encoding HBV envelope proteins.

The compositions and immunogenic combinations of the present application may further comprise a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are non-toxic and do not interfere with the efficacy of the active ingredient. Pharmaceutically acceptable carriers may include one or more excipients such as binders, disintegrants, swelling agents, suspending agents, emulsifiers, wetting agents, lubricants, flavoring agents, sweeteners, preservatives, dyes, solubilizers, and coating agents. The exact nature of the carrier or other material may depend on the route of administration, e.g., intramuscular, intradermal, subcutaneous, oral, intravenous, cutaneous, intramucosal (e.g., intestinal), intranasal, or intraperitoneal routes. For liquid injectable preparations, such as suspensions and solutions, suitable carriers and additives include water, glycols, oils, alcohols, preservatives, colorants, and the like. For solid oral formulations such as powders, capsules, caplets, soft capsules and tablets, suitable carriers and additives include starches, sugars, diluents, granulating agents, lubricants, binders, disintegrating agents and the like. For nasal spray/inhalation mixtures, the aqueous solutions/suspensions may contain water, glycols, oils, emollients, stabilizers, humectants, preservatives, fragrances, flavoring agents, and the like as suitable carriers and additives.

The compositions and immunogenic combinations of the present application can be formulated in any form suitable for administration to a subject to facilitate administration and improve efficacy, including but not limited to oral (enteral) administration and parenteral injection. Parenteral injection includes intravenous injection or infusion, subcutaneous injection, intradermal injection and intramuscular injection. The compositions of the present application may also be formulated for other routes of administration, including transmucosal, ocular, rectal, long-acting implant, sublingual (under the tongue), circulation around the portal vein from the oral mucosa, inhalation, or intranasal administration.

In a preferred embodiment of the present application, the composition and immunogenic combination of the present application are formulated for parenteral injection, preferably subcutaneous, intradermal or intramuscular injection, more preferably intramuscular injection.

According to embodiments of the present application, compositions and immunogenic combinations for administration typically comprise a buffered solution in a pharmaceutically acceptable carrier, e.g., an aqueous carrier, e.g., buffered saline or the like, such as Phosphate Buffered Saline (PBS). The compositions and immunogenic combinations may also comprise pharmaceutically acceptable substances as required to approximate physiological conditions, such as pH adjusting agents and buffers. In a typical embodiment, a composition or immunogenic combination of the present application comprising plasmid DNA may comprise Phosphate Buffered Saline (PBS) as a pharmaceutically acceptable carrier. Plasmid DNA may be present at a concentration of, for example, 0.5mg/mL to 5mg/mL, such as 0.5mg/mL, 1mg/mL, 2mg/mL, 3mg/mL, 4mg/mL or 5mg/mL, preferably 1 mg/mL.

The compositions and immunogenic combinations of the present application can be formulated into vaccines (also referred to as "immunogenic compositions") according to methods well known in the art. Such compositions may also comprise adjuvants to enhance the immune response. The optimal ratio of each component in the formulation can be determined by techniques well known to those skilled in the art in light of this disclosure.

In one embodiment of the present application, an adjuvant is included in or co-administered with a composition or immunogenic combination of the present application. The use of an adjuvant is optional and may further enhance the immune response when the composition is used for vaccination purposes. Adjuvants suitable for co-administration with or inclusion in the compositions of the present application should preferably be adjuvants that are potentially safe, well-tolerated and effective in humans. Adjuvants may be small molecules or antibodies, including but not limited to immune checkpoint inhibitors (e.g., anti-PD 1, anti-RIM-3, etc.), toll-like receptor inhibitors, RIG-1 inhibitors, IL-15 superagonists (Altor biosciences), mutant IRF3 and IRF7 gene adjuvants, STING agonists (adoro), FLT3L gene adjuvants, IL-12 gene adjuvants, and IL-7-hyFc.

Embodiments of the present application also relate to methods of making the compositions and immunogenic combinations of the present application. According to embodiments of the present application, methods of making a composition or immunogenic combination comprise admixing an isolated polynucleotide, vector and/or polypeptide encoding an HBV antigen of the present application with one or more pharmaceutically acceptable carriers. Those skilled in the art will be familiar with conventional techniques for preparing such compositions.

Method of inducing an immune response

In another general aspect, the present application also provides a method for inducing an immune response against Hepatitis B Virus (HBV) in a subject in need thereof, comprising administering to said subject an immunologically effective amount of a composition immunogenic or immunogenic composition of the present application. Any of the compositions and immunogenic combinations described herein can be used in the methods of the present application.

The present application provides an improved method for eliciting and boosting an immune response to HBV antigenic proteins or immunogenic polypeptides thereof in a human subject using a MVA vector in combination with an adenovirus vector.

According to a general aspect of the present application, a method of enhancing an immune response in a human subject comprises:

a. administering to the human subject a first composition comprising an immunologically effective amount of an adenoviral vector of the present application; and

b. administering to the human subject a second composition comprising an immunologically effective amount of the MVA vector of the present application;

thereby obtaining an enhanced immune response against the HBV antigen in said human subject.

According to another general aspect of the present application, a method of enhancing an immune response in a human subject comprises:

a. administering to the human subject a first composition comprising an immunologically effective amount of the MVA vector of the present application; and

b. administering to the human subject a second composition comprising an immunologically effective amount of an adenoviral vector of the present application;

a. administering to the human subject a first composition comprising an immunologically effective amount of a first plasmid comprising a first non-naturally occurring nucleic acid comprising a first polynucleotide sequence encoding an HBV pol antigen of the present application and an immunologically effective amount of a second plasmid comprising a second non-naturally occurring nucleic acid comprising a second polynucleotide sequence encoding a truncated HBV core antigen of the present application; and

b. administering to the human subject a second composition comprising an immunologically effective amount of a first plasmid comprising a first non-naturally occurring nucleic acid comprising a first polynucleotide sequence encoding an HBV pol antigen of the present application and an immunologically effective amount of a second plasmid comprising a second non-naturally occurring nucleic acid comprising a second polynucleotide sequence encoding a truncated HBV core antigen of the present application;

The first composition is administered to a human subject in need thereof to elicit an immune response, while the second composition is administered to a human subject in need thereof to boost the immune response. Priming and boosting an immune response can, for example, enhance an immune response.

According to embodiments of the present application, the enhanced immune response comprises an enhanced antibody response against HBV antigenic proteins in a human subject.

Preferably, the enhanced immune response further comprises an enhanced CD4+ response or an enhanced CD8+ T cell response against HBV antigenic proteins in a human subject. The enhanced CD4+ T cell response generated according to the methods of embodiments of the present application may be, for example, an increase or induction of a CD4+ T cell response to the dominance of HBV antigenic proteins, and/or an increase or induction of multifunctional CD4+ T cells specific for HBV antigenic proteins, in a human subject. Multifunctional CD4+ T expresses more than one cytokine, such as two or more of IFN-gamma, IL-2, and TNF-alpha. The enhanced CD8+ T cell response generated by the methods according to embodiments of the present application may be, for example, an increase or induction of HBV antigenic protein-specific multifunctional CD8+ T cells in a human subject.

More preferably, the enhanced immune response generated by an embodiment of the present application includes, in a human subject, an enhanced CD4+ T cell response, an enhanced antibody response and an enhanced CD8+ T cell response against HBV antigenic proteins.

As used herein, the term "infection" refers to the invasion of a host by a disease causing substance. A disease-causing substance is considered "infectious" if it is capable of invading the host and replicating or proliferating in the host. Examples of infectious agents include viruses, such as HBV and certain adenoviruses species, prions, bacteria, fungi, protozoa, and the like. "HBV infection" specifically refers to the invasion of a host organism, e.g., cells and tissues of a host organism, by HBV.

According to embodiments of the present application, "inducing an immune response," when used with respect to the methods described herein, encompasses causing a desired immune response or effect against HBV or HBV infection in a subject in need thereof. "inducing an immune response" also encompasses providing therapeutic immunity for treatment against pathogenic agents (i.e., HBV). As used herein, the term "therapeutic immunity" or "therapeutic immune response" means that a vaccinated subject infected with HBV is able to control infection by a pathogenic agent (i.e., HBV) against which it was vaccinated. In one embodiment, "inducing an immune response" refers to generating immunity in a subject in need thereof, e.g., to provide a therapeutic effect against a disease (e.g., HBV infection). In one embodiment of the present application, "inducing an immune response" refers to eliciting or enhancing cellular immunity, e.g., a T cell response, against HBV. In one embodiment of the present application, "inducing an immune response" refers to eliciting or improving a humoral immune response against HBV. In one embodiment of the present application, "inducing an immune response" refers to eliciting or improving cellular and humoral immune responses against HBV.

In general, administration of the compositions and immunogenic combinations of embodiments of the present application will have the therapeutic purpose of generating an immune response against HBV upon HBV infection or development of symptoms characteristic of HBV infection, i.e. for therapeutic vaccination.

As used herein, "immunogenically effective amount" or "immunologically effective amount" means an amount of a composition, polynucleotide, vector or antigen sufficient to induce a desired immune effect or immune response in a subject in need thereof. In one embodiment, an immunologically effective amount means an amount sufficient to induce an immune response in a subject in need thereof. In another embodiment, an immunologically effective amount refers to an amount sufficient to produce immunity in a subject in need thereof, e.g., to provide a protective effect against a disease (e.g., HBV infection). The immunologically effective amount can vary depending on various factors, such as the physical condition, age, weight, health, etc., of the subject; specific applications, such as providing protective immunity or therapeutic immunity; and specific diseases, such as viral infections, for which immunity is desired. An immunologically effective amount can be readily determined by one of skill in the art in light of this disclosure.

In particular embodiments of the present application, an immunologically effective amount refers to an amount of the composition or immunogenic combination sufficient to achieve 1,2, 3, 4or more of the following effects: (i) reducing or ameliorating the severity of HBV infection or symptoms associated therewith; (ii) reducing the duration of HBV infection or symptoms associated therewith; (iii) preventing the progression of HBV infection or symptoms associated therewith; (iv) causing resolution of the HBV infection or symptoms associated therewith; (v) preventing the development or onset of HBV infection or symptoms associated therewith; (vi) preventing the recurrence of HBV infection or symptoms associated therewith; (vii) reducing hospitalization of a subject with HBV infection; (viii) reducing the length of hospitalization of a subject with HBV infection; (ix) increasing survival of a subject having HBV infection; (x) Eliminating HBV infection in a subject; (xi) Inhibiting or reducing HBV replication in a subject; and/or (xii) enhances or improves the prophylactic or therapeutic effect of the other therapy.

In another specific embodiment, the immunologically effective amount can also be an amount sufficient to reduce HBsAg levels consistent with the evolution of clinical serological switches; achieving a sustained HBsAg clearance associated with a reduction in infected hepatocytes of the immune system of the subject; a population of activated T cells that induce HBV antigen specificity; and/or to achieve a sustained loss of HBsAg over 12 months. Examples of target indices include lower HBsAg and/or higher CD8 counts below the 500 copies HBsAg IU threshold.

As a general guide, when used with viral vectors, the immunologically effective amount can be about 1X10⁷Viral particle/dose to about 1X10¹²Viral particles/dose. An immunologically effective amount can be about 1X10¹⁰About 2X10¹⁰About 3X10¹⁰About 4X10¹⁰About 5X10¹⁰About 6X10¹⁰About 7X10¹⁰About 8X10¹⁰About 9X10¹⁰About 1X10¹¹About 2X10¹¹About 3X10¹¹About 4X10¹¹About 5X10¹¹Or about 1X10¹²Viral particles/dose. The immunologically effective amount can be from one vector or from multiple vectors. An immunologically effective amount can be administered in a single composition or in multiple compositions, such as 1,2, 3, 4,5, 6,7, 8, 9, or 10 compositions (e.g., tablets, capsules, or injections), wherein administration of multiple capsules or injections collectively provides an immunologically effective amount to the subject. In a so-called prime-boost regimen, it is also possible to administer an immunologically effective amount to a subject, followed by another dose of the immunologically effective amount to the same subject. The general concept of prime-boost regimens is well known to those skilled in the vaccine art. Can also be any according to the needsOptionally, further booster doses are added to the regimen.

According to embodiments of the present application, an immunogenic combination can be administered to a subject by mixing two viral vectors (e.g., a first viral vector encoding an HBV core antigen and a second viral vector encoding an HBV pol antigen) and delivering the mixture to a single anatomical site. Alternatively, two separate immunizations may be performed, each delivering a single expression vector. In such regimens, whether the two viral vectors are administered in a single immunization as a mixture or in two separate immunizations, the first and second viral vectors may be administered in a ratio of 10:1 to 1:10 by weight, e.g., 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, or 1:10 by weight. Preferably, the first viral vector and the second viral vector are administered in a 1:1 ratio by weight.

In some embodiments, the subject to be treated according to the methods of the present application is a subject infected with HBV, in particular a subject suffering from chronic HBV infection. Acute HBV infection is characterized by efficient activation of the innate immune system, supplemented by subsequent broadly adaptive responses (e.g., HBV-specific T cells, neutralizing antibodies), which often result in successful suppression of replication or removal of infected hepatocytes. In contrast, such reactions are impaired or reduced due to high viral and antigen loads, e.g. HBV envelope proteins are produced in large quantities and can be released in a1,000-fold excess of subviral particles of infectious virus.

Chronic HBV infection is described as phase (phase) and is characterized by viral load, liver enzyme levels (necrotizing inflammatory (necrotizing) activity), HBeAg or HBsAg load, or the presence of antibodies to these antigens. cccDNA levels remained relatively constant, approximately 10-50 copies/cell, although viremia can vary widely. Persistence of cccDNA material results in chronicity. More specifically, the stages of chronic HBV infection include (i) an immune tolerance stage characterized by a high viral load and normal or minimal elevated liver enzymes; (ii) immune activation of HBeAg positive phase, in which lower or decreased levels of viral replication are observed, with significantly elevated levels of liver enzymes; (iii) inactive HBsAg vector (carrier) phase, which is a low replication state with low viral load in serum and normal liver enzyme levels, which may be accompanied by HBeAg serological switch; and (iv) the HBeAg negative phase, in which viral replication (reactivation) occurs periodically with fluctuations in liver enzyme levels, mutations in the pre-core and/or basal core (basal core) promoters are common, such that infected cells do not produce HBeAg.

As used herein, "chronic HBV infection" refers to a subject having detectable presence of HBV for more than 6 months. A subject with chronic HBV infection may be at any stage of chronic HBV infection. In a preferred embodiment, the chronic HBV infection referred to herein follows the definition published by the centers for disease prevention and control (CDC), according to which chronic HBV infection can be characterized by laboratory standards, (i) is negative for IgM antibodies to hepatitis b core antigen (IgM anti-HBc), and positive for nucleic acid testing of hepatitis b surface antigen (HBsAg), hepatitis b e antigen (HBeAg), or hepatitis b viral DNA; or (ii) HBsAg or HBV DNA positive by nucleic acid testing, or HBeAg positive at least twice 6 months apart.

According to a particular embodiment, an immunogenically effective amount refers to the amount of the composition or immunogenic combination that is sufficient to treat chronic HBV infection.

In some embodiments, a subject with chronic HBV infection is undergoing nucleoside analog (NUC) treatment and is NUC-inhibitory. As used herein, "NUC inhibition" refers to a subject having undetectable HBV viral levels and stable alanine Aminotransferase (ALT) levels for at least 6 months. Examples of nucleoside/nucleotide analog therapies include HBV polymerase inhibitors such as entecavir (entecavir) and tenofovir (tenofovir). Preferably, a subject with chronic HBV infection does not have advanced liver fibrosis or cirrhosis. Such subjects will typically have a METAVIR score of 3 or less and a liver transient elastic stiffness test (fibscan) result of 9kPa or less. The METAVIR score is a scoring system that is commonly used to evaluate the degree of inflammation and fibrosis for histopathological evaluation in liver biopsies of patients with hepatitis b. The scoring system assigns two standardized numbers, one reflecting the degree of inflammation and the other reflecting the degree of fibrosis.

It is believed that elimination or reduction of chronic HBV may achieve early disease block of severe liver disease including virus-induced cirrhosis and hepatocellular carcinoma. Thus, the methods of the present application may also be used as a therapy for treating HBV-induced diseases. Examples of HBV-induced diseases include, but are not limited to, cirrhosis, cancer (e.g., hepatocellular carcinoma), and fibrosis, particularly advanced fibrosis characterized by a METAVIR score of 3 or higher. In such embodiments, the immunogenically effective amount is an amount sufficient to achieve a sustained loss of HBsAg over a 12 month period and a significant reduction in clinical disease (e.g., cirrhosis, hepatocellular carcinoma, etc.).

The methods of the embodiments of the present application further comprise administering to a subject in need thereof another immunogenic agent (such as another HBV antigen or other antigen) or another anti-HBV agent (such as a nucleoside analog or other anti-HBV agent), in combination with the compositions of the present application.

Delivery method

In accordance with the present disclosure, the compositions and immunogenic combinations of the present application can be administered to a subject by any method known in the art, including, but not limited to, parenteral (e.g., intramuscular, subcutaneous, intravenous, or intradermal injection), oral, transdermal, and nasal administration. Preferably, the composition and immunogenic combination are administered parenterally (e.g., by intramuscular injection or intradermal injection) or transdermally.

In some embodiments of the present application, wherein the composition or immunogenic combination comprises one or more viral vectors, administration may be by cutaneous injection, such as intramuscular or intradermal injection, preferably intramuscular injection. Intramuscular injection may be combined with electroporation, i.e., the application of an electric field to facilitate the delivery of DNA plasmids to cells. As used herein, the term "electroporation" refers to the use of transmembrane electric field pulses to induce microscopic pathways (pores) in biological membranes. During in vivo electroporation, an electric field of appropriate strength and duration is applied to the cell to induce a transient increase in the permeability of the cell membrane, thereby enabling the cell to absorb molecules that are self-immoveable across the cell membrane. Creating such pores by electroporation facilitates the passage of biomolecules, such as plasmids, oligonucleotides, siRNA, drugs, etc., from one side of the cell membrane to the other. In vivo electroporation for the delivery of DNA vaccines has been shown to significantly increase the uptake of plasmids by host cells, while also causing mild to moderate inflammation at the injection site. Thus, intradermal or intramuscular electroporation significantly improves transfection efficiency and immune response (e.g., up to 1,000-fold and 100-fold, respectively) compared to conventional injections.

In typical embodiments, electroporation is combined with intramuscular injection. However, electroporation may also be combined with other forms of parenteral administration, such as intradermal injection, subcutaneous injection, and the like.

Administration of the compositions, immunogenic combinations, or vaccines of the present application by electroporation can be accomplished using an electroporation device that can be configured to efficiently deliver an energy pulse to a desired tissue of a mammal to cause the formation of reversible pores within a cellular membrane. The electroporation device may include an electroporation component and an electrode assembly or handle assembly. The electroporation component may include one or more of the following components of the electroporation device: a controller, a current waveform generator, an impedance tester, a waveform recorder, an input element, a status reporting element, a communication port, a memory component, a power supply, and a power switch. Electroporation may be accomplished using an in vivo electroporation device. Electroporation devices and electroporation methods that can facilitate the delivery of the compositions and immunogenic combinations of the present application, particularly those comprising DNA plasmids, examples of which include

(Inovio Pharmaceuticals, Blue Bell, Pa.), Elgen electroporator (Inovio Pharmaceuticals, Inc.) Tri-Grid^TMDelivery Systems (Ichor Medical Systems, inc., San Diego, CA92121), and those described in: U.S. Pat. No. 7,664,545, U.S. Pat. No. 8,209,006, U.S. Pat. No. 9,452,285, U.S. Pat. No. 5,273,525, U.S. Pat. No. 6,110,161, U.S. Pat. No. 6,261,281, U.S. Pat. No. 6,958,060, and U.S. Pat. No. 6,939,862, U.S. Pat. No. 7,328,064, U.S. Pat. No. 6,041,252, U.S. Pat. No. 36U.S. Pat. No. 6,278,895, U.S. Pat. No. 6,319,901, U.S. Pat. No. 6,912,417, U.S. Pat. No. 8,187,249, U.S. Pat. No. 9,364,664, U.S. Pat. No. 9,802,035, U.S. Pat. No. 6,117,660, and international patent application publication No. WO2017172838, which are incorporated herein by reference in their entirety. The application also encompasses the use of pulsed electric fields for the delivery of the compositions and immunogenic combinations of the present application, for example as described in U.S. patent No. 6,697,669, which is incorporated herein by reference in its entirety.

In other embodiments of the present application, wherein the composition or immunogenic combination comprises one or more DNA plasmids, the method of administration is transdermal. Transdermal administration may be used in conjunction with epidermal skin abrasion to facilitate delivery of the DNA plasmid to the cells. For example, a dermatological patch may be used for epidermal skin abrasion. After removal of the dermatological patch, the composition or immunogenic combination may be deposited on the abraded skin.

The delivery method is not limited to the above-described embodiments, and any means for intracellular delivery may be used. Other intracellular delivery methods contemplated by the methods of the present application include, but are not limited to, liposome encapsulation, nanoparticles, and the like.

Adjuvant

In some embodiments of the present application, the method of inducing an immune response against HBV further comprises administering an adjuvant. The terms "adjuvant" and "immunostimulant" are used interchangeably herein and are defined as one or more substances that cause stimulation of the immune system. In this context, adjuvants are used to enhance the immune response to the HBV antigens and antigenic HBV polypeptides of the present application.

According to embodiments of the present application, an adjuvant may be present in the immunogenic combination or composition of the present application, or administered in a separate composition. The adjuvant may be, for example, a small molecule or an antibody. Examples of adjuvants suitable for use herein include, but are not limited to, immune checkpoint inhibitors (e.g., anti-PD 1, anti-RIM-3, etc.), toll-like receptor inhibitors, RIG-1 inhibitors, IL-15 superagonists (Altor biosciences), mutant IRF3 and IRF7 gene adjuvants, STING agonists (adoro), FLT3L gene adjuvants, IL-12 gene adjuvants, and IL-7-hyFc.

The compositions and immunogenic combinations of the present application can also be administered in combination with at least one other anti-HBV agent. Examples of anti-HBV agents suitable for use with the present application include, but are not limited to, small molecules, antibodies and/or CAR-T therapy (which acts as a capsid inhibitor), TLR inhibitors, cccDNA inhibitors, HBV polymerase inhibitors (such as entecavir and tenofovir), and/or immunoassay point inhibitors, among others. Such anti-HBV agents can be administered simultaneously or sequentially with the compositions and immunogenic combinations of the present application.

Method of prime/boost immunization

Embodiments of the present application also contemplate that in a so-called prime-boost regimen, an immunologically effective amount of the composition or immunogenic combination is administered to a subject, followed by another dose of the immunologically effective amount of the composition or immunogenic combination to the same subject. Thus, in one embodiment, the composition or immunogenic combination of the present application is a priming vaccine for eliciting an (priming) immune response. In another embodiment, the composition or immunogenic combination of the present application is a booster vaccine for boosting (boosting) an immune response. The prime and boost vaccines of the embodiments of the present application may be used in the methods of the present application described herein. The general concept of prime-boost (prime-boost) regimens is well known to those skilled in the vaccine art. Any of the compositions and immunogenic combinations of the present application described herein can be used as a prime and/or boost vaccine for eliciting and/or boosting an immune response against HBV.

According to embodiments of the present application, the composition or immunogenic combination of the present application may be administered at least once for priming. The composition or immunogenic combination may be re-administered for boosting. If desired, further booster compositions or vaccine combinations may optionally be added to the regimen. An adjuvant may be present in the compositions of the present application for boosting, in a separate composition, to be administered with the composition or immunogenic combination of the present application for boosting, or to be administered as a boosting itself. In those embodiments where an adjuvant is included in the regimen, the adjuvant is preferably used to boost the immunity.

An illustrative, non-limiting example of a prime-boost regimen includes administering to a subject a single dose of an immunologically effective amount of a composition or immunogenic combination of the present application to elicit an immune response, followed by administration of another dose of an immunologically effective amount of a composition or immunogenic combination of the present application to boost the immune response, wherein the prime is administered about one to twelve (1-12) weeks, about two to twelve (2-12) weeks, about two to ten (2-10) weeks, about two to six (2-6) weeks, preferably about 4 weeks after the prime of the initial administration, the boost is administered for the first time, preferably about 8 weeks after the prime of the initial administration. In one embodiment of the present application, the booster is administered at least 1 week after priming. In one embodiment of the present application, the booster is administered at least 2 weeks after priming. Optionally, a further boosting composition or immunogenic combination or other adjuvant is administered about 10-14 weeks, preferably 12 weeks after the initial administration of the priming immunization.

Reagent kit

The present application also provides a kit comprising an immunogenic combination of the present application. The kit may comprise the first polynucleotide and the second polynucleotide in separate compositions, or the kit may comprise the first polynucleotide and the second polynucleotide in a single composition. The kit may further comprise one or more adjuvants or immunostimulants and/or other anti-HBV agents.

The ability to induce or stimulate an anti-HBV immune response after administration in an animal or human organism can be assessed in vitro or in vivo using various assays standard in the art. A general description of available techniques for assessing the occurrence and activation of an immune response can be found, for example, in Coligan et al (1992and 1994, Current Protocols in immunology; ed.J Wiley & Sons Inc, National Institute of Health). Measurement of cellular immunity can be performed by: measuring cytokine profiles (profiles) secreted by activated effector cells, including those derived from CD4+ and CD8+ T cells (e.g., cells that produce IL-10 or IFN γ are quantified by ELISPOT), determining the activation status of immune effector cells (e.g., T cell proliferation assay by classical [3H ] thymidine uptake), assaying antigen-specific T lymphocytes in sensitized subjects (e.g., peptide-specific lysis in a cytotoxicity assay, etc.).

The ability to stimulate a cellular and/or humoral response can be determined by antibody binding and/or competitive binding (see, e.g., Harlow,1989, Antibodies, Cold Spring Harbor Press). For example, the titer of antibodies produced in response to administration of the composition providing the immunogen can be measured by enzyme-linked immunosorbent assay (ELISA). Immune responses can also be measured by neutralizing antibody assays, where neutralization of a virus is defined as the infectivity lost by the reaction/inhibition/neutralization of specific antibodies to the virus. Immune responses can also be measured by antibody-dependent cellular phagocytosis (ADCP) assays.

Detailed description of the preferred embodiments

The present application also provides the following non-limiting embodiments.

Embodiment 1 is a modified vaccinia virus ankara (MVA) vector comprising a non-naturally occurring nucleic acid molecule comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO: 4.

Embodiment 2 is the MVA vector of embodiment 1, wherein the HBV polymerase antigen does not have reverse transcriptase activity and RNase H activity.

Embodiment 3 is the MVA vector of

embodiment

1 or 2, wherein the HBV polymerase antigen is capable of inducing an immune response in a mammal against at least two HBV genotypes; preferably, the HBV polymerase antigen is capable of inducing a T cell response in a mammal against at least HBV genotypes B, C and D; more preferably, the HBV polymerase antigen is capable of inducing a CD8T cellular response in a human subject against at least HBV genotypes A, B, C and D.

Embodiment 4 is the MVA vector of any of embodiments 1-3 wherein the HBV polymerase antigen comprises the amino acid sequence of seq id No. 4.

Embodiment 5 is the MVA vector of any of embodiments 1-4 further comprising a polynucleotide sequence encoding a signal sequence operably linked to the HBV polymerase antigen.

Embodiment 6 is the MVA vector of embodiment 5, wherein the signal sequence comprises the amino acid sequence of SEQ ID No. 6 or SEQ ID No. 11; preferably the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

Embodiment 7 is the MVA vector of any of embodiments 1-6 wherein the first polynucleotide sequence is at least 90% identical to seq id No. 3.

Embodiment 8 is the MVA vector of embodiment 7 wherein the first polynucleotide sequence comprises the polynucleotide sequence of SEQ ID No. 3.

Embodiment 9 is the MVA vector of any of embodiments 1-8 further comprising a second polynucleotide sequence encoding a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2.

Embodiment 10 is the MVA vector of embodiment 9, wherein the second polynucleotide sequence is at least 90% identical to SEQ ID No. 1.

Embodiment 11 is the MVA vector of embodiment 10 wherein the second polynucleotide sequence comprises the polynucleotide sequence of SEQ id No. 1.

Embodiment 12 is the MVA vector of any of embodiments 9-11 wherein the second polynucleotide sequence further comprises a polynucleotide sequence encoding a signal sequence operably linked to a truncated HBV core antigen.

Embodiment 13 is the MVA vector of embodiment 12 wherein the signal sequence comprises the amino acid sequence of SEQ ID No. 6 or SEQ ID No. 11; preferably, the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

Embodiment 14 is the MVA vector of any of embodiments 9-13 wherein the first and second polynucleotide sequences encode a fusion protein comprising a truncated HBV core antigen operably linked to an HBV polymerase antigen.

Embodiment 15 is the MVA vector of embodiment 14 wherein the fusion protein comprises a truncated HBV core antigen operably linked to an HBV polymerase antigen by a linker.

Embodiment 16 is the MVA vector of embodiment 15 wherein the linker comprises the amino acid sequence of (AlaGly) n, n being an integer from 2 to 5; preferably, the linker is encoded by the polynucleotide sequence of SEQ ID NO. 14.

Embodiment 17 is the MVA vector of embodiment 16 wherein the fusion protein comprises the amino acid sequence of SEQ ID No. 12.

Embodiment 18 is the MVA vector of any of embodiments 14-17, wherein the fusion protein further comprises a signal sequence; preferably, the signal sequence comprises the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11; more preferably, the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

Embodiment 19 is the MVA vector of any of embodiments 1-18 further comprising at least one promoter sequence, optionally one or more additional regulatory sequences; preferably, the at least one promoter sequence comprises the polynucleotide sequence of SEQ ID NO. 25 and/or SEQ ID NO. 26 and the additional regulatory sequence is selected from the enhancer sequence of SEQ ID NO. 8 or SEQ ID NO. 15 and the polyadenylation signal sequence of SEQ ID NO. 9 or SEQ ID NO. 16.

Embodiment 20 is the MVA vector of any of embodiments 1-19, wherein the non-naturally occurring nucleic acid molecule does not encode an HBV antigen selected from: hepatitis b surface antigen (HBsAg), HBV envelope (Env) antigen and HBV L protein antigen.

Embodiment 21 is an MVA vector comprising a first non-naturally occurring nucleic acid molecule comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising the amino acid sequence of SEQ ID No. 4, wherein the first polynucleotide sequence further encodes a signal sequence comprising the amino acid sequence of SEQ ID No. 6, and wherein the first polynucleotide sequence further comprises a promoter sequence comprising the polynucleotide sequence of SEQ ID No. 26; the second non-naturally occurring nucleic acid molecule comprises a second polynucleotide sequence encoding a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2, the second polynucleotide sequence further encoding a signal sequence comprising the amino acid sequence of SEQ ID No. 11, and wherein the second polynucleotide sequence further comprises a promoter sequence comprising the polynucleotide sequence of SEQ ID No. 25.

Embodiment 22 is a composition comprising the MVA vector of any of embodiments 1-21, and a pharmaceutically acceptable carrier.

Embodiment 23 is a method of enhancing an immune response in a human subject, the method comprising (a) administering to the human subject an immunologically effective amount of an adenoviral vector comprising a non-naturally occurring nucleic acid molecule comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID No. 4; and (b) administering to the human subject a second composition comprising an immunologically effective amount of the MVA vector of any one of embodiments 1-21; to obtain an enhanced immune response against the HBV antigen in said human subject.

Embodiment 24 is the method of embodiment 23, wherein the HBV polymerase antigen of the first composition does not have reverse transcriptase activity and RNase H activity.

Embodiment 25 is the method of embodiment 23 or 24, wherein the first composition is used to elicit an immune response and the second composition is used to boost an immune response.

Embodiment 26 is the method of any one of embodiments 23-25, the HBV polymerase antigen of the first composition is capable of inducing an immune response in a human subject against at least two HBV genotypes; preferably, the HBV polymerase antigen is capable of inducing a T cell response in a human subject against at least HBV genotypes B, C and D; more preferably, the HBV polymerase antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D.

Embodiment 27 is the method of any one of embodiments 23-26, wherein the HBV polymerase antigen of the first composition comprises the amino acid sequence of SEQ ID No. 4.

Embodiment 28 is the method of any one of embodiments 23-27, further comprising a polynucleotide sequence encoding a signal sequence of an HBV polymerase antigen operably linked to the first composition.

Embodiment 29 is the method of embodiment 28, wherein the signal sequence comprises the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11; preferably, the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

Embodiment 30 is the method of any one of embodiments 23-29, wherein the first polynucleotide sequence of the first composition is at least 90% identical to SEQ ID NO: 19.

Embodiment 31 is the method of embodiment 30, wherein the first polynucleotide sequence of the first composition comprises the polynucleotide sequence of SEQ ID No. 19.

Embodiment 32 is the method of any one of embodiments 23-31, wherein the nucleic acid molecule of the adenovirus in the first composition further comprises a second polynucleotide sequence encoding a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2.

Embodiment 33 is the method of embodiment 32, wherein the second polynucleotide sequence of the first composition is at least 90% identical to SEQ ID No. 17.

Embodiment 34 is the method of embodiment 33, wherein the second polynucleotide sequence of the first composition comprises the polynucleotide sequence of SEQ ID NO 17.

Embodiment 35 is the method of any one of embodiments 32-34, wherein the first and second polynucleotide sequences of the first composition encode a fusion protein comprising a truncated HBV core antigen operably linked to an HBV polymerase antigen.

Embodiment 36 is the method of embodiment 35, wherein the fusion protein of the first composition comprises a truncated HBV core antigen operably linked to an HBV polymerase antigen through a linker.

Embodiment 37 is the method of embodiment 36, wherein the linker of the first composition comprises the amino acid sequence of (AlaGly) n, n being an integer from 2 to 5; preferably, the linker is encoded by the polynucleotide sequence of SEQ ID NO. 14.

Embodiment 38 is the method of embodiment 37, wherein the fusion protein of the first composition comprises the amino acid sequence of SEQ id No. 12.

Embodiment 39 is the method of any one of embodiments 35-38, wherein the fusion protein of the first composition further comprises a signal sequence; preferably, the signal sequence comprises the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11; more preferably, the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

Embodiment 40 is the method of any one of embodiments 23-39, wherein the non-naturally occurring nucleic acid molecule of the first composition further comprises a promoter sequence, optionally one or more additional regulatory sequences; preferably, the promoter sequence comprises the polynucleotide sequence of SEQ ID NO. 7 and the additional regulatory sequence is selected from the enhancer sequence of SEQ ID NO. 8 or SEQ ID NO. 15 and the polyadenylation signal sequence of SEQ ID NO. 16.

Embodiment 41 is the method of any one of embodiments 23-40, wherein the non-naturally occurring nucleic acid molecule of the first composition does not encode an HBV antigen selected from: hepatitis b surface antigen (HBsAg), HBV envelope (Env) antigen and HBV L protein antigen.

Embodiment 42 is the method of any one of embodiments 23-41, wherein the enhanced immune response comprises an enhanced antibody response to an HBV antigen in a human subject.

Embodiment 43 is the method of embodiment 42, wherein the enhanced immune response comprises an enhanced CD8+ T cell response to the HBV antigen in a human subject.

Embodiment 44 is the method of embodiment 42 or 43, wherein the enhanced immune response comprises a CD4+ T cell response to HBV antigen in a human subject.

Embodiment 45 is the method of any one of embodiments 23-44, wherein the adenoviral vector is a rAd26 or rAd35 vector.

Embodiment 46 is the method of any one of embodiments 23-45, wherein step (b) is performed 1-12 weeks after step (a).

Embodiment 47 is the method of any one of embodiments 23-45, wherein step (b) is performed 2-12 weeks after step (a).

Embodiment 48 is the method of any one of embodiments 23-45, wherein step (b) is performed at least 1 week after step (a).

Embodiment 49 is the method of any one of embodiments 23-45, wherein step (b) is performed at least 2 weeks after step (a).

Embodiment 50 is a vaccine combination comprising (a) a first composition comprising an immunologically effective amount of an adenoviral vector comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4; and (b) a second composition comprising an immunologically effective amount of a modified vaccinia virus ankara (MVA) vector comprising a second polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4; wherein the first composition is administered to a human subject for eliciting an immune response and the second composition is administered to the human subject one or more times for boosting the immune response.

Embodiment 51 is the vaccine combination of embodiment 50, wherein the HBV polymerase antigens of the first and second compositions do not have reverse transcriptase activity and RNase H activity.

Embodiment 52 is the vaccine combination of embodiment 50 or 51, wherein the HBV polymerase antigens of the first and second compositions are capable of inducing an immune response in a mammal against at least two HBV genotypes; preferably, the HBV polymerase antigen is capable of inducing a T cell response in a mammal against at least HBV genotypes B, C and D; more preferably, the HBV polymerase antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D.

Embodiment 53 is the vaccine combination of any one of embodiments 50-52, wherein the HBV polymerase antigens of the first and second compositions comprise the amino acid sequences of SEQ ID No. 4.

Embodiment 54 is the vaccine combination of any one of embodiments 50-53, further comprising a polynucleotide sequence encoding a signal sequence of an HBV polymerase antigen operably linked to the first and second compositions.

Embodiment 55 is the vaccine combination of embodiment 54, wherein the signal sequence comprises the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11; preferably the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

Embodiment 56 is the vaccine combination of any one of embodiments 50-55, wherein the first and second polynucleotide sequences are at least 90% identical to SEQ ID No. 3.

Embodiment 57 is the vaccine combination of embodiment 56, wherein the first and second polynucleotide sequences comprise the polynucleotide sequences of SEQ ID No. 3.

Embodiment 58 is the vaccine combination of any one of embodiments 50-57, wherein the adenoviral vector of the first composition further comprises a third polynucleotide sequence and the MVA vector of the second composition further comprises a fourth polynucleotide sequence, wherein the third and fourth polynucleotide sequences encode a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2.

Embodiment 59 is the vaccine combination of embodiment 58, wherein the third and fourth polynucleotide sequences are at least 90% identical to SEQ ID No. 1.

Embodiment 60 is the vaccine combination of embodiment 59, wherein the third and fourth polynucleotide sequences comprise the polynucleotide sequences of SEQ ID NO. 1.

Embodiment 61 is a vaccine combination comprising (a) a first composition comprising an immunologically effective amount of a modified vaccinia virus ankara (MVA) vector comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4; and (b) a second composition comprising an immunologically effective amount of an adenoviral vector comprising a second polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4; wherein the first composition is administered to a human subject to elicit an immune response and the second composition is administered to the human subject one or more times to boost the immune response.

Embodiment 62 is the vaccine combination of embodiment 61, wherein the HBV polymerase antigens of the first and second compositions do not have reverse transcriptase activity and RNase H activity.

Embodiment 63 is the vaccine combination of embodiment 61 or 62, wherein the HBV polymerase antigens of the first and second compositions are capable of inducing an immune response in a mammal against at least two HBV genotypes; preferably, the HBV polymerase antigen is capable of inducing a T cell response in a mammal against at least HBV genotypes B, C and D; more preferably, the HBV polymerase antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D.

Embodiment 64 is the vaccine combination of any one of embodiments 61-63, wherein the HBV polymerase antigens of the first and second compositions comprise the amino acid sequences of SEQ ID No. 4.

Embodiment 65 is the vaccine combination of any one of embodiments 61-64, further comprising a polynucleotide sequence encoding a signal sequence of the HBV polymerase antigen operably linked to the first and second compositions.

Embodiment 66 is the vaccine combination of embodiment 65, wherein the signal sequence comprises the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11; preferably, the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

Embodiment 67 is the vaccine combination of any one of embodiments 61-66, wherein the first and second polynucleotide sequences are at least 90% identical to SEQ ID No. 3.

Embodiment 68 is the vaccine combination of embodiment 67, wherein the first and second polynucleotide sequences comprise the polynucleotide sequences of SEQ ID NO. 3.

Embodiment 69 is the vaccine combination of any one of embodiments 61-68, wherein the MVA vector of the first composition further comprises a third polynucleotide sequence and the adenoviral vector of the second composition further comprises a fourth polynucleotide sequence, wherein the third and fourth polynucleotide sequences encode a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2.

Embodiment 70 is the vaccine combination of embodiment 69, wherein the third and fourth polynucleotide sequences are at least 90% identical to SEQ ID No. 1.

Embodiment 71 is the vaccine combination of embodiment 70, wherein the third and fourth polynucleotide sequences comprise the polynucleotide sequences of SEQ ID No. 1.

Embodiment 72 is the vaccine combination of any one of embodiments 50-71, which is a kit.

Embodiment 73 is a method of enhancing an immune response in a human subject, the method comprising (a) administering to the human subject a first composition, comprising an immunologically effective amount of a first plasmid comprising a first non-naturally occurring nucleic acid molecule and a second plasmid, the first non-naturally occurring nucleic acid molecule comprises a first polynucleotide sequence encoding an HBV polymerase antigen, the HBV polymerase antigen comprises a sequence identical to SEQ ID NO:4 an amino acid sequence which is at least 98% identical, the second plasmid comprises a second non-naturally occurring nucleic acid molecule comprising a second polynucleotide sequence, the second polynucleotide sequence encodes a truncated HBV core antigen consisting of SEQ ID NO: 2; and (b) administering to the human subject a second composition comprising an immunologically effective amount of the MVA vector of any one of embodiments 1-21; to obtain an enhanced immune response against the HBV antigen in said human subject.

Embodiment 74 is the method of embodiment 73, wherein the HBV polymerase antigen of the first composition does not have reverse transcriptase activity and RNase H activity.

Embodiment 75 is the method of embodiment 73 or 74, wherein the first composition is used to elicit an immune response and the second composition is used to boost an immune response.

Embodiment 76 is the method of any one of embodiments 73-75, wherein the HBV polymerase antigen of the first composition is capable of inducing an immune response in a human subject against at least two HBV genotypes; preferably, the HBV polymerase antigen is capable of inducing a T cell response in a human subject against at least HBV genotypes B, C and D; more preferably, the HBV polymerase antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D.

Embodiment 77 is the method of any one of embodiments 73-76, wherein the HBV polymerase antigen of the first composition comprises the amino acid sequence of SEQ ID No. 4.

Embodiment 78 is the method of any one of embodiments 73-77, further comprising a polynucleotide sequence encoding a signal sequence of an HBV polymerase antigen operably linked to the first composition.

Embodiment 79 is the method of embodiment 78, wherein the signal sequence comprises the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11; preferably, the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

Embodiment 80 is the method of any one of embodiments 73-79, wherein the first polynucleotide sequence of the first composition is at least 90% identical to SEQ ID NO: 20.

Embodiment 81 is the method of embodiment 80, wherein the first polynucleotide sequence of the first composition comprises the polynucleotide sequence of SEQ ID NO. 20.

Embodiment 82 is the method of any one of embodiments 73-81, wherein the second polynucleotide sequence of the first composition is at least 90% identical to SEQ ID NO: 18.

Embodiment 83 is the method of embodiment 82, wherein the second polynucleotide sequence of the first composition comprises the polynucleotide sequence of SEQ ID No. 18.

Embodiment 84 is the method of any one of embodiments 73-83, wherein the first and second polynucleotide sequences of the first composition further comprise a promoter sequence, optionally one or more additional regulatory sequences; preferably, the promoter sequence comprises the polynucleotide sequence of SEQ ID NO. 7 and the additional regulatory sequence is selected from the enhancer sequence of SEQ ID NO. 8 or SEQ ID NO. 15 and the polyadenylation signal sequence of SEQ ID NO. 16.

Embodiment 85 is the method of any one of embodiments 73-84, wherein the enhanced immune response comprises an enhanced antibody response to an HBV antigen in a human subject.

Embodiment 86 is the method of embodiment 85, wherein the enhanced immune response comprises an enhanced CD8+ T cell response to the HBV antigen in a human subject.

Embodiment 87 is the method of embodiment 85 or 86, wherein the enhanced immune response comprises a CD4+ T cell response to the HBV antigen in a human subject.

Embodiment 88 is the method of any one of embodiments 73 to 87, wherein step (b) is performed 1 to 12 weeks after step (a).

Embodiment 89 is the method of any one of embodiments 73 to 87, wherein step (b) is performed 2 to 12 weeks after step (a).

Embodiment 90 is the method of any one of embodiments 73 to 87, wherein step (b) is performed at least 1 week after step (a).

Embodiment 91 is the method of any one of embodiments 73 to 87, wherein step (b) is performed at least 2 weeks after step (a).

Embodiment 92 is a method of enhancing an immune response in a human subject, the method comprising (a) administering to the human subject a first composition comprising an immunologically effective amount of the MVA vector of any one of embodiments 1-21; and (b) administering to the human subject a second composition comprising an immunologically effective amount of a first plasmid comprising a non-naturally occurring nucleic acid molecule comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID No. 4 and a second plasmid comprising a non-naturally occurring nucleic acid molecule comprising a second polynucleotide sequence encoding a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2; to obtain an enhanced immune response against the HBV antigen in said human subject.

Embodiment 93 is the method of embodiment 92, wherein the HBV polymerase antigen of the second composition does not have reverse transcriptase activity and RNase H activity.

Embodiment 94 is the method of embodiment 92 or 93, wherein the first composition is used to elicit an immune response and the second composition is used to boost an immune response.

Embodiment 95 is the method of any one of embodiments 92-94, wherein the HBV polymerase antigen of the second composition is capable of inducing an immune response in a human subject against at least two HBV genotypes; preferably, the HBV polymerase antigen is capable of inducing a T cell response in a human subject against at least HBV genotypes B, C and D; more preferably, the HBV polymerase antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D.

Embodiment 96 is the method of any one of embodiments 92-95, wherein the HBV polymerase antigen of the second composition comprises the amino acid sequence of SEQ ID No. 4.

Embodiment 97 is the method of any one of embodiments 92-96, further comprising a polynucleotide sequence encoding a signal sequence of an HBV polymerase antigen operably linked to the second composition.

Embodiment 98 is the method of embodiment 97, wherein the signal sequence comprises the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11; preferably, the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

Embodiment 99 is the method of any one of embodiments 92-98, wherein the first polynucleotide sequence of the second composition is at least 90% identical to SEQ ID NO: 20.

Embodiment 100 is the method of embodiment 99, wherein the first polynucleotide sequence of the second composition comprises the polynucleotide sequence of SEQ ID NO: 20.

Embodiment 101 is the method of any one of embodiments 92-100, wherein the second polynucleotide sequence of the second composition is at least 90% identical to SEQ ID NO: 18.

Embodiment 102 is the method of embodiment 101, wherein the second polynucleotide sequence of the second composition comprises the polynucleotide sequence of SEQ ID No. 18.

Embodiment 103 is the method of any one of embodiments 92-102, wherein the first and second polynucleotide sequences of the second composition further comprise a promoter sequence, optionally one or more additional regulatory sequences; preferably, the promoter sequence comprises the polynucleotide sequence of SEQ ID NO. 7 and the additional regulatory sequence is selected from the enhancer sequence of SEQ ID NO. 8 or SEQ ID NO. 15 and the polyadenylation signal sequence of SEQ ID NO. 16.

Embodiment 104 is the method of any one of embodiments 92-103, wherein the enhanced immune response comprises an enhanced antibody response to an HBV antigen in a human subject.

Embodiment 105 is the method of embodiment 104, wherein the enhanced immune response comprises an enhanced CD8+ T cell response to the HBV antigen in a human subject.

Embodiment 106 is the method of embodiment 104 or 105, wherein the enhanced immune response comprises a CD4+ T cell response to the HBV antigen in a human subject.

Embodiment 107 is the method of any one of embodiments 92 to 106, wherein step (b) is performed 1 to 12 weeks after step (a).

Embodiment 108 is the method of any one of embodiments 92 to 106, wherein step (b) is performed 2 to 12 weeks after step (a).

Embodiment 109 is the method of any one of embodiments 92-106, wherein step (b) is performed at least 1 week after step (a).

Embodiment 110 is the method of any one of embodiments 92 to 106, wherein step (b) is performed at least 2 weeks after step (a).

Embodiment 111 is the method of any one of embodiments 92-106, wherein step (b) is performed at least 4 weeks after step (a).

Embodiment 112 is the method of any one of embodiments 92-106, wherein step (b) is performed at least 8 weeks after step (a).

Embodiment 113 is the method of any one of embodiments 92-106, wherein step (b) is performed at least 12 weeks after step (a).

Examples

The following examples of the present application serve to further illustrate the nature of the present application. It should be understood that the following examples do not limit the invention, and that the scope of the invention is defined by the appended claims.

Example 1: production of HBV core and Pol antigen sequences

It is believed that the T cell epitope on the hepatitis core protein is important to eliminate hepatitis b infection and that hepatitis b viral proteins (such as polymerase) may contribute to the breadth of the response. Thus, hepatitis b core protein and polymerase protein were selected as antigens for the design of therapeutic Hepatitis B Virus (HBV) vaccines.

Derivation of HBV core and polymerase antigen consensus sequences

HBV pol and core antigen consensus sequences were generated based on HBV genotypes B, C and D. Different HBV sequences were obtained from different sources and aligned for the core and polymerase proteins, respectively. The original sequence alignment of all subtypes (A-H) was subsequently limited to HBV genotypes B, C and D. A consensus sequence was defined for each subtype aligned separately with each protein in all joint BCD sequences. The most frequently used amino acid in the consensus sequence is at the variable alignment position.

Optimization of HBV core antigens

The HBV core antigen consensus sequence is optimized by generating two deletions contained in the native viral proteins. The first deletion is a deletion of the N-terminal extension of the core protein that constitutes the pre-core "zinc finger" portion, since literature reports have indicated that viruses use this sequence to induce tolerance to viral proteins in infected individuals. The second deletion is a deletion of 34 amino acids corresponding to a highly positively charged segment at the C-terminus, which is essential for pregenomic packaging and production of viral plus strand DNA synthesis in the viral life cycle.

Optimization of HBV Pol antigens

The HBV pol antigen consensus sequence was optimized by changing 4 residues to eliminate reverse transcriptase and RNAseH enzymatic activity. Specifically, the aspartate residue (D) in the "YXDD" motif of the reverse transcriptase domain is changed to an asparagine residue (N) to eliminate any coordination function, thereby eliminating nucleotide/metal ion binding. Further, in the "ded" motif of RNaseH domain, the first aspartic acid residue (D) is changed to asparagine residue (N), and the first glutamic acid residue (E) is changed to glutamine residue (a) to eliminate Mg²⁺And (4) coordination. In addition, the sequence of the HBV pol antigen is codon optimized to perturb the internal open reading frame of the envelope proteins, including the S protein and the S proteins with an N-terminal extension pre-S1 and pre-S2. As a result, the open reading frames of the envelope proteins (pre-S1, pre-S2, and S protein) and the X protein were removed.

Selection of Signal peptides for efficient protein secretion

Evaluation of 3 different signal peptides introduced in-frame at the N-terminus of HBV core antigen: (1) ig heavy chain gamma signal peptide, SPIgG (BAA 75024.1); (2) ig heavy chain signal peptide, SPIgE (AAB 59424.1); and (3) Cystatin S precursor signal peptide SPCS (NP _ 0018901.1). Signal P prediction program was used to optimize Signal peptide cleavage sites for core fusion in silico. Secretion efficiency was determined by analyzing the core protein level in the supernatant. Western blot analysis of core antigen secretion using 3 different signal peptides fused at the N-terminus showed that the hemi-Cystatin S signal peptide caused the most efficient protein secretion.

Example 2: generation of adenoviral vectors expressing fused truncated HBV core antigen and HBV Pol antigen

Adenoviral vectors were created to express a fusion protein of a truncated HBV core antigen and HBV pol antigen from a single open reading frame. Additional configurations for expressing two proteins (e.g., truncated HBV core antigen and HBV pol antigen) are also contemplated, e.g., using two separate expression cassettes, or using 2A-like sequences to separate the two sequences.

Design of expression cassette for adenovirus vector

The expression cassette (shown schematically in FIGS. 2A and 2B) contains the CMV promoter (SEQ ID NO:7), intron (SEQ ID NO:15) (fragment derived from the human ApoAI gene-GenBank accession number X01038295-523 base pairs with the ApoAI second intron), followed by an optimized coding sequence-either a core alone or a core and polymerase fusion protein, preceded by a human immunoglobulin secretion signal coding sequence (SEQ ID NO:10) and followed by an SV40 polyadenylation signal (SEQ ID NO: 16).

Secretion signals were included because past experience showed that the manufacturability of certain adenovirus vectors with secreted transgenes was improved without affecting the elicited T cell response (mouse experiments).

The last two residues of the core protein (VV) and the first two residues of the polymerase protein (MP) if fused result in a linker sequence (VVMP) which is present in the human dopamine receptor protein (subtype D3), as well as flanking homology.

The insertion of an AGAG linker between the core and polymerase sequences abrogated this homology and there was no further hit in Blast of the human proteome.

Example 3: generation of MVA vectors expressing HBV core antigen and HBV pol antigen

The MVA vector has been designed to encode each of the HBV Core and Pol coding sequences of the present application. Each of the HBV Core and Pol coding sequences was inserted into the MVA vector at IGR44/45, each under the control of a separate promoter. Other configurations for expressing both proteins are also envisaged, for example using a single expression cassette in which the core and Pol antigens comprise a fusion protein, or using 2A-like sequences to separate the two sequences. Furthermore, additional and/or alternative insertion sites in the MVA vector are also contemplated, e.g., each of the HBV core and Pol coding sequences are inserted into the same or different insertion sites.

Design of expression cassettes for MVA vectors

The expression cassette (shown schematically in FIG. 2C) contains the Pr13.5 long promoter (SEQ ID NO:25), which is adjacent to and directs expression of the HBV core antigen, and the PrHyb promoter (SEQ ID NO:26), which is adjacent to and directs expression of the HBV pol antigen. The HBV core coding sequence comprises SEQ ID NO 1 and the HBV Pol coding sequence comprises SEQ ID NO 3.

SEQ ID NO

1 and 3 are each modified by elimination of the negative cis-acting site and by adjustment of GC content. Furthermore,

SEQ ID NO

1 and 3 were each codon optimized for human codon usage without affecting the amino acid sequence. Each of SEQ ID NOS: 1 and 3 includes an additional early stop signal (TTTTTNT (SEQ ID NO:28)) disposed adjacent to the stop codon.

Example 4: immunogenicity of a combination of HBV adenovirus vector and HBV MVA vector in mice

Materials and methods

Designing a carrier:two adenoviral vectors were used, which expressed Core (HBV Core antigen having the amino acid sequence of SEQ ID NO: 2) alone or Polymerase (HBV pol antigen having the amino acid sequence of SEQ ID NO: 4) and Core as fusion proteins expressed from a single open reading frame. For this purpose, in the calculationSequences were designed in-flight to provide a consensus for the B, C and D genotypes of hepatitis B virus. The expression cassette contains the CMV promoter, ApoAI intron, human immunoglobulin secretion signal, followed by the coding sequence-Core alone or Core and Polymerase fusion protein and SV40 polyadenylation signal.

The recombinant MVA vector comprises the poxvirus promoters Pr13.5(SEQ ID NO:25) and PrHyb (SEQ ID NO:26), both followed by TTTTTNT (SEQ ID NO:28) transcription termination sequence, Pr13.5 linked to the core coding sequence (the nucleotide sequence of SEQ ID NO:1, and the polypeptide sequence of SEQ ID NO: 2), PrHyb (SEQ ID NO:26) linked to the nucleotide sequence encoding the polymerase (the nucleotide sequence of SEQ ID NO:3, and the polypeptide sequence of SEQ ID NO: 4). The core coding sequence comprises an N-terminal immunoglobulin secretion tag (SEQ ID NO:11) and the polymerase coding sequence comprises an N-terminal cystatin S signal sequence (SEQ ID NO: 6). See, for example, fig. 2C.

Immunogenicity Studies in mice: to assess the in vivo immunogenicity of the combination of HBV adenoviral vector and HBV MVA, F1 mice (C57BL/6x Balb/C) were immunized intramuscularly with different vector combinations. These immunogenicity studies focused on determining the cellular immune response caused by HBV antigens Core and Polymerase.

Antigen-specific responses were analyzed and quantified by IFN- γ Enzyme Linked Immunospot (ELISPOT) and intracellular cytokine production (TNF-. alpha., IL-2, and IFN-. gamma.) was detected by flow cytometry. In these assays, isolated splenocytes from immunized animals are incubated with a pool of peptides covering the Core protein, Pol protein or small peptide leader and linker sequences (2. mu.g/ml of each peptide). In addition, MVA-specific peptides (2. mu.g/ml) were used. The pool consisted of 15-membered (mer) peptides overlapping by 11 residues that matched the genotype ABCD consensus sequence of Core and Pol adenoviral vectors. The 94kDa large HBV Pol protein is split in the middle into two peptide pools. In ELISPOT, IFN- γ release from individual antigen-specific T cells is observed by appropriate antibodies and subsequent chromogenic detection as colored spots on microwell plates, known as spot-forming cells (SFC). Within ICS, the percentage of cytokine-releasing cells in a particular population (CD 3-positive, CD 4-positive, or CD 8-positive cells) is determined.

Results

Immunogenicity assessment of HBV adenoviral vector and HBV MVA combination in mice:the objective of this study was to evaluate the immune response induced by the combination of HBV adenoviral vectors and HBV MVA following IM delivery to F1 mice. The administration to F1 mice is summarized in table 1. Animals received one HBV adenovirus vector immunization followed by HBV MVA immunization after 8 weeks. Splenocytes were collected 1 week after the last immunization.

Table 1: mouse immunization experiment design

IM: intramuscular administration; vp is as follows: a viral particle; TCID 50: 50% tissue culture infectious dose; MVA: improved vaccinia virus ankara

HBV adenoviral vectors alone, and in combination with HBV MVA vectors, generate Pol-specific T cell responses in mice. Core pol fusion + Core adenovirus vectors induce low levels of Core responses, which are amplified by boosting with HBV MVA vectors. The combination of Core pol fusion adenovirus vector and HBV MVA vector also induced a Core response (fig. 3).

The Pol response is mainly mediated by CD8(+) T cells, whereas the core response mainly involves CD4(+) T cells (fig. 4 and 5). The combination of Core pol fusion + Core adenoviral vector and HBV MVA also induced a CD8(+) T cell driven Core response (fig. 4).

And (4) conclusion:the combination of HBV adenoviral vectors and HBV MVA vectors elicited T cell responses against core and pol in F1 mice.

Example 5: immunogenicity of combination of HBV adenovirus vector and HBV MVA vector in non-human primate (NHP)

In vivo immunogenicity studies of NHPs:to assess the in vivo immunogenicity of the combination of HBV adenovirus and HBV MVA vectors, intramuscular prime-boost immunization was performed on mary cynomolgus monkeys with different vector combinations. These immunogenicity studies have focused onDetermining the cellular immune response elicited by the HBV core and the polymerase antigen.

Antigen-specific responses were analyzed and quantified by IFN- γ Enzyme Linked Immunospot (ELISPOT) and intracellular cytokine production (TNF-. alpha., IL-2, and IFN-. gamma.) was detected by flow cytometry. In these assays, PBMCs of immunized animals were incubated with a pool of peptides (2. mu.g/ml of each peptide) covered with either Core protein or Pol protein. The pool consisted of 15-membered peptides overlapping by 11 residues that matched the genotype ABCD consensus sequence of Core and Pol adenoviral vectors. The 94kDa large HBV Pol protein is split in the middle into two peptide pools. In ELISPOT, the release of IFN- γ by individual antigen-specific T cells is observed by appropriate antibodies and subsequent chromogenic detection as coloured spots on microwell plates, known as spot-forming cells (SFC). In Intracellular Cytokine Staining (ICS), the percentage of cytokine-releasing cells in a particular population (CD 3-positive, CD 4-positive, or CD 8-positive cells) was determined.

Results

The immunogenicity of the combination of HBV adenoviral vectors and HBV MVA vectors was evaluated in NHP:the objective of this study was to evaluate the immune response induced by the combination of HBV adenoviral vectors and HBV MVA vectors following IM delivery to a mauritius cynomolgus monkey. Administration to NHPs is summarized in table 2. Animals received one HBV adenovirus vector immunization, followed by HBV MVA vector immunization after 8 weeks, followed by HBV adenovirus vector immunization after 8 weeks. PBMCs were collected 2 weeks after each immunization.

Table 2: design of NHP immunization experiment

The Core Pol fusion adenoviral vector alone, and the combination of the Core Pol fusion + Core adenoviral vector with the HBV MVA vector, produced robust (robust) Pol and Core-specific T cell responses in NHPs. Further boosting with Core pol fusion adenoviral vectors did not further increase the response (FIG. 6).

Core and Pol responses in NHPs are mediated by CD4(+) and CD8(+) T cells. The combination of Core Pol fusion adenoviral vector + Core adenoviral vector (used as prime) and HBV MVA (used as boost) induced the highest CD4(+) Core-specific and CD8(+) Pol-specific T cell IFN- γ responses (fig. 7).

These results indicate that the combination of HBV adenoviral vectors and HBV MVA vectors generates robust T cell responses against core and pol antigens in NHPs.

It will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof. It is understood, therefore, that this invention is not limited to the particular embodiments disclosed, but it is intended to cover modifications within the spirit and scope of the present invention as defined by the present specification.

Reference to the literature

1.Cohen et al.“Is chronic hepatitis B being undertreated in theUnited States？”J.Viral Hepat.(2011)18(6)，377-83.

2.Obeng-Adjei et al.“DNA vaccine cocktail expressing genotype A and CHBV surface and consensus core antigens generates robust cytotoxic andantibody responses and mice and Rhesus macaques”Cancer Gene Therapy(2013)20，652-662.

3.World Health Organization，Hepatitis B：Fact sheet No.204[Internet]2015 March.Available fromhttp://www.who.nt/mediacentre/factsheets/fs204/en/.

4.Belloni et al.“IFN-αinhibits HBV transcription and replication incell culture and in humanized mice by targeting the epigenetic regulation ofthe nuclear cccDNA minichromosome”J.Clin.Invest.(2012)122(2)，529-537.

5.Michel et al.“Therapeutic vaccines and immune-based therapies forthe treatment of chronic hepatitis B：perspectives and challenges.”J.Hepatol.(2011)54(6)，1286-1296.

Sequence listing

<110> Infinite Ellan of Yanson science

BAVARIAN NORDIC A/S

<120> methods and compositions for inducing an immune response against Hepatitis B Virus (HBV)

<130>688097-413WO1

<150>PCT/IB2017/058148

<151>2017-12-19

<150>US 62/607,439

<151>2017-12-19

<160>28

<170>PatentIn version 3.5

<210>1

<211>447

<212>DNA

<213>Artificial Sequence

<220>

<223>HBV core

<400>1

atggacatcg atccctacaa ggagttcggt gccagcgtgg aactgctgag cttcctgccc 60

agcgacttct tcccttccat cagagacctg ctggacactg ccagcgcact gtacagagag 120

gctctggaaa gccctgagca ctgcagccct caccacaccg ctctgagaca ggccatcctg 180

tgctggggag agctgatgaa cctggccacc tgggtcggaa gcaacctgga agatccagcc 240

agtcgcgagc tggtggtgtc ctacgtgaac gtgaacatgg gcttgaagat ccggcagctc 300

ctgtggttcc acatcagctg cctgaccttc ggacgggaaa ccgtgctgga atacctggtg 360

tcctttggcg tgtggatccg gacacctcca gcctacagac ctcccaacgc tcctatcctg 420

agcaccctgc ctgagacaac cgtggtg 447

<210>2

<211>149

<212>PRT

<213>Artificial Sequence

<220>

<223>HBV core

<400>2

Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Ser Val Glu Leu Leu

1 5 10 15

Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Ile Arg Asp Leu Leu Asp

20 25 30

Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys

35 40 45

Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu

50 55 60

Leu Met Asn Leu Ala Thr Trp Val Gly Ser Asn Leu Glu Asp Pro Ala

65 70 75 80

Ser Arg Glu Leu Val Val Ser Tyr Val Asn Val Asn Met Gly Leu Lys

85 90 95

Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg

100 105 110

Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr

115 120 125

Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro

130 135 140

Glu Thr Thr Val Val

145

<210>3

<211>2529

<212>DNA

<213>Artificial Sequence

<220>

<223>HBV pol

<400>3

atgcctctga gctaccagca ctttcggaag ctgctgctcc tggacgacga ggccggacct 60

ctggaagagg aactgcccag actggcagac gagggtctga acagaagagt ggccgaggac 120

ctgaacctgg gcaacctgaa cgtgtccatc ccttggaccc acaaggtcgg aaacttcacc 180

ggtctgtaca gcagcaccgt gcctgtgttc aaccctgagt ggcagacacc cagctttccc 240

aacatccatc tgcaggaaga tatcatcaac cgctgcgagc agttcgtggg acctctgacc 300

gtgaacgaga agcggagact gaagctgatc atgccagcca gattctaccc taacgtgacc 360

aagtacctgc ctctggacaa gggcatcaag ccctactacc ctgagcacct ggtcaaccac 420

tacttccaga ccagacacta cctgcacacc ctgtggaagg ccggcatcct gtacaagaga 480

gagacaacca gaagcgccag cttctgcggc agcccttaca gctgggagca ggaactccag 540

cacggacgcc tggtgttcca gaccagcacc agacacggcg acgagagctt ttgccagcag 600

agcagcggca tcctgagcag atctcctgtg ggtccttgcc tgcagagcca gctgaggaag 660

tccagactgg gcctgcagcc tcagcaggga catctggcta gacggcagca gggcagaagc 720

ggcagcatca gagccagagt gcaccctacc accagacggc ctttcggcgt ggaacctagc 780

ggctctggcc acaccaccaa caccgcctct agctccagct cctgcctgca ccagtcagcc 840

gtgcggaagg ctgcctacag ccacctgagc accagcaaga gacacagcag ctccggacac 900

gctgtcgagc tgcacaacat ccctcccaac agcgccagaa gccagagcga gggtcctgtg 960

ttcagctgtt ggtggctgca gttccggaac agcaagccct gcagcgacta ctgcctgagc 1020

cacatcgtga acctgctgga agattgggga ccttgcaccg agcacggcga gcaccacatc 1080

cggatcccta gaacaccagc cagagtgaca ggaggcgtgt tcctcgtgga caagaaccct 1140

cacaacacca ccgagagcag actggtggtg gacttcagcc agttctccag aggcaacacc 1200

agagtgtcct ggcccaagtt cgccgttccc aacctgcagt ccctgaccaa cctgctgagc 1260

agcaacctga gctggctgag cctggacgtg tccgctgcct tctaccatct gcctctgcac 1320

cctgcagcca tgcctcatct gctcgttggc agcagcggac tgtccagata cgtggctcgg 1380

ctgtccagca actctcggat catcaaccac cagcacggca ccatgcagaa cctgcacgac 1440

agctgcagca gaaatctgta tgtgtccctg ctcctgctgt acaagacctt tggccggaag 1500

ctgcacctgt acagccatcc catcatcctg ggcttccgga agatccctat gggcgtggga 1560

ctgagcccat tcctgctggc ccagttcacc agcgccatct gcagcgtcgt gcggagagcc 1620

ttccctcact gcctggcctt cagctacatg aacaacgtgg tgctgggcgc caagagcgtg 1680

cagcacctgg aatccctgtt taccgccgtg accaacttcc tgctgtccct gggcatccac 1740

ctgaatccca acaagaccaa gagatgggga tacagcctga acttcatggg ctacgtgatc 1800

ggcagctggg gcacactgcc tcaggaacac atcgtccaga agatcaaaga gtgcttccgc 1860

aagcttcccg tgaacagacc catcgactgg aaagtgtgcc agcggatcgt tggactgctg 1920

ggctttgcag ctcctttcac ccagtgcggc taccctgctc tgatgcctct gtacgcctgc 1980

atccagagca agcaggcctt caccttcagc cctacctaca aggccttcct gtgcaagcag 2040

tacctgaatc tgtaccctgt ggccagacag agaccaggcc tgtgccaggt gttcgccaat 2100

gccacaccta ccggctgggg ccttgccatt ggccaccaga gaatgagagg caccttcgtg 2160

gctcctctgc ccatccacac agcccagctg ctggctgcct gcttcgccag aagcagatcc 2220

ggagccaagc tgatcggcac cgacaactcc gtggtgctga gccggaagta caccagcttc 2280

ccttggctgc tgggctgcgc tgccaactgg atcctgcgag gcaccagctt cgtgtacgtg 2340

ccctctgccc tgaaccctgc cgacgaccct tctagaggca ggctgggact gtacagacct 2400

ctgcttagac tgcccttcag acccaccacc ggacggacca gcctgtacgc cgatagccct 2460

agcgtgccca gccatctgcc cgacagagtg cacttcgcca gccctctgca tgtggcctgg 2520

agacctcca 2529

<210>4

<211>843

<212>PRT

<213>Artificial Sequence

<220>

<223>HBV pol

<400>4

Met Pro Leu Ser Tyr Gln His Phe Arg Lys Leu Leu Leu Leu Asp Asp

1 5 10 15

Glu Ala Gly Pro Leu Glu Glu Glu Leu Pro Arg Leu Ala Asp Glu Gly

20 25 30

Leu Asn Arg Arg Val Ala Glu Asp Leu Asn Leu Gly Asn Leu Asn Val

35 40 45

Ser Ile Pro Trp Thr His Lys Val Gly Asn Phe Thr Gly Leu Tyr Ser

50 55 60

Ser Thr Val Pro Val Phe Asn Pro Glu Trp Gln Thr Pro Ser Phe Pro

65 70 75 80

Asn Ile His Leu Gln Glu Asp Ile Ile Asn Arg Cys Glu Gln Phe Val

85 90 95

Gly Pro Leu Thr Val Asn Glu Lys Arg Arg Leu Lys Leu Ile Met Pro

100 105 110

Ala Arg Phe Tyr Pro Asn Val Thr Lys Tyr Leu Pro Leu Asp Lys Gly

115 120 125

Ile Lys ProTyr Tyr Pro Glu His Leu Val Asn His Tyr Phe Gln Thr

130 135 140

Arg His Tyr Leu His Thr Leu Trp Lys Ala Gly Ile Leu Tyr Lys Arg

145 150 155 160

Glu Thr Thr Arg Ser Ala Ser Phe Cys Gly Ser Pro Tyr Ser Trp Glu

165 170 175

Gln Glu Leu Gln His Gly Arg Leu Val Phe Gln Thr Ser Thr Arg His

180 185 190

Gly Asp Glu Ser Phe Cys Gln Gln Ser Ser Gly Ile Leu Ser Arg Ser

195 200 205

Pro Val Gly Pro Cys Leu Gln Ser Gln Leu Arg Lys Ser Arg Leu Gly

210 215 220

Leu Gln Pro Gln Gln Gly His Leu Ala Arg Arg Gln Gln Gly Arg Ser

225 230 235 240

Gly Ser Ile Arg Ala Arg Val His Pro Thr Thr Arg Arg Pro Phe Gly

245 250 255

Val Glu Pro Ser Gly Ser Gly His Thr Thr Asn Thr Ala Ser Ser Ser

260 265 270

Ser Ser Cys Leu His Gln Ser Ala Val Arg Lys Ala Ala Tyr Ser His

275 280 285

Leu Ser Thr Ser LysArg His Ser Ser Ser Gly His Ala Val Glu Leu

290 295 300

His Asn Ile Pro Pro Asn Ser Ala Arg Ser Gln Ser Glu Gly Pro Val

305 310 315 320

Phe Ser Cys Trp Trp Leu Gln Phe Arg Asn Ser Lys Pro Cys Ser Asp

325 330 335

Tyr Cys Leu Ser His Ile Val Asn Leu Leu Glu Asp Trp Gly Pro Cys

340 345 350

Thr Glu His Gly Glu His His Ile Arg Ile Pro Arg Thr Pro Ala Arg

355 360 365

Val Thr Gly Gly Val Phe Leu Val Asp Lys Asn Pro His Asn Thr Thr

370 375 380

Glu Ser Arg Leu Val Val Asp Phe Ser Gln Phe Ser Arg Gly Asn Thr

385 390 395 400

Arg Val Ser Trp Pro Lys Phe Ala Val Pro Asn Leu Gln Ser Leu Thr

405 410 415

Asn Leu Leu Ser Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala

420 425 430

Ala Phe Tyr His Leu Pro Leu His Pro Ala Ala Met Pro His Leu Leu

435 440 445

Val Gly Ser Ser Gly Leu SerArg Tyr Val Ala Arg Leu Ser Ser Asn

450 455 460

Ser Arg Ile Ile Asn His Gln His Gly Thr Met Gln Asn Leu His Asp

465 470 475 480

Ser Cys Ser Arg Asn Leu Tyr Val Ser Leu Leu Leu Leu Tyr Lys Thr

485 490 495

Phe Gly Arg Lys Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe

500 505 510

Arg Lys Ile Pro Met Gly Val Gly Leu Ser Pro Phe Leu Leu Ala Gln

515 520 525

Phe Thr Ser Ala Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys

530 535 540

Leu Ala Phe Ser Tyr Met Asn Asn Val Val Leu Gly Ala Lys Ser Val

545 550 555 560

Gln His Leu Glu Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser

565 570 575

Leu Gly Ile His Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser

580 585 590

Leu Asn Phe Met Gly Tyr Val Ile Gly Ser Trp Gly Thr Leu Pro Gln

595 600 605

Glu His Ile Val Gln Lys Ile Lys GluCys Phe Arg Lys Leu Pro Val

610 615 620

Asn Arg Pro Ile Asp Trp Lys Val Cys Gln Arg Ile Val Gly Leu Leu

625 630 635 640

Gly Phe Ala Ala Pro Phe Thr Gln Cys Gly Tyr Pro Ala Leu Met Pro

645 650 655

Leu Tyr Ala Cys Ile Gln Ser Lys Gln Ala Phe Thr Phe Ser Pro Thr

660 665 670

Tyr Lys Ala Phe Leu Cys Lys Gln Tyr Leu Asn Leu Tyr Pro Val Ala

675 680 685

Arg Gln Arg Pro Gly Leu Cys Gln Val Phe Ala Asn Ala Thr Pro Thr

690 695 700

Gly Trp Gly Leu Ala Ile Gly His Gln Arg Met Arg Gly Thr Phe Val

705 710 715 720

Ala Pro Leu Pro Ile His Thr Ala Gln Leu Leu Ala Ala Cys Phe Ala

725 730 735

Arg Ser Arg Ser Gly Ala Lys Leu Ile Gly Thr Asp Asn Ser Val Val

740 745 750

Leu Ser Arg Lys Tyr Thr Ser Phe Pro Trp Leu Leu Gly Cys Ala Ala

755 760 765

Asn Trp Ile Leu Arg Gly Thr Ser Phe Val TyrVal Pro Ser Ala Leu

770 775 780

Asn Pro Ala Asp Asp Pro Ser Arg Gly Arg Leu Gly Leu Tyr Arg Pro

785 790 795 800

Leu Leu Arg Leu Pro Phe Arg Pro Thr Thr Gly Arg Thr Ser Leu Tyr

805 810 815

Ala Asp Ser Pro Ser Val Pro Ser His Leu Pro Asp Arg Val His Phe

820 825 830

Ala Ser Pro Leu His Val Ala Trp Arg Pro Pro

835 840

<210>5

<211>63

<212>DNA

<213>Artificial Sequence

<220>

<223>Cystatin S signal peptide

<400>5

atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60

agc 63

<210>6

<211>21

<212>PRT

<213>Artificial Sequence

<220>

<223>Cystatin S signal peptide

<400>6

Met Ala Arg Pro Leu Cys Thr Leu Leu Leu Leu Met Ala Thr Leu Ala

1 5 10 15

Gly Ala Leu Ala Ser

20

<210>7

<211>684

<212>DNA

<213>Artificial Sequence

<220>

<223>hCMV promoter

<400>7

accgccatgt tgacattgat tattgactag ttattaatag taatcaatta cggggtcatt 60

agttcatagc ccatatatgg agttccgcgt tacataactt acggtaaatg gcccgcctgg 120

ctgaccgccc aacgaccccc gcccattgac gtcaataatg acgtatgttc ccatagtaac 180

gccaataggg actttccatt gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt 240

ggcagtacat caagtgtatc atatgccaag tacgccccct attgacgtca atgacggtaa 300

atggcccgcc tggcattatg cccagtacat gaccttatgg gactttccta cttggcagta 360

catctacgta ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt acatcaatgg 420

gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg acgtcaatgg 480

gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc 540

attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca gagctcgttt 600

agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc atagaagaca 660

ccgggaccga tccagcctcc gcgg 684

<210>8

<211>378

<212>DNA

<213>Artificial Sequence

<220>

<223>triple enhancer

<400>8

ggctcgcatc tctccttcac gcgcccgccg ccctacctga ggccgccatc cacgccggtt 60

gagtcgcgtt ctgccgcctc ccgcctgtgg tgcctcctga actgcgtccg ccgtctaggt 120

aagtttaaag ctcaggtcga gaccgggcct ttgtccggcg ctcccttgga gcctacctag 180

actcagccgg ctctccacgc tttgcctgac cctgcttgct caactctagt tctctcgtta 240

acttaatgag acagatagaa actggtcttg tagaaacaga gtagtcgcct gcttttctgc 300

caggtgctga cttctctccc ctgggctttt ttctttttct caggttgaaa agaagaagac 360

gaagaagacg aagaagac 378

<210>9

<211>225

<212>DNA

<213>Artificial Sequence

<220>

<223>BGH poly A

<400>9

ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 60

tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 120

tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 180

gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgg 225

<210>10

<211>81

<212>DNA

<213>Artificial Sequence

<220>

<223>Immunoglobulin secretion signal

<400>10

atggagttcg gcctgtcttg ggtctttctg gtggcaatcc tgaagggcgt gcagtgtgaa 60

gtgcagctgc tggagtctgg a 81

<210>11

<211>27

<212>PRT

<213>Artificial Sequence

<220>

<223>Immunoglobulin secretion signal

<400>11

Met Glu Phe Gly Leu Ser Trp Val Phe Leu Val Ala Ile Leu Lys Gly

1 5 10 15

Val Gln Cys Glu Val Gln Leu Leu Glu Ser Gly

20 25

<210>12

<211>996

<212>PRT

<213>Artificial Sequence

<220>

<223>Core-Pol fusion

<400>12

Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Ser Val Glu Leu Leu

1 5 10 15

Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Ile Arg Asp Leu Leu Asp

20 25 30

Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys

35 40 45

Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu

50 55 60

Leu Met Asn Leu Ala Thr Trp Val Gly Ser Asn Leu Glu Asp Pro Ala

65 70 75 80

Ser Arg Glu Leu Val Val Ser Tyr Val Asn Val Asn Met Gly Leu Lys

85 90 95

Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg

100 105 110

Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr

115 120 125

Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro

130 135 140

Glu Thr Thr Val Val Ala Gly Ala Gly Met Pro Leu Ser Tyr Gln His

145 150 155 160

Phe Arg Lys Leu Leu Leu Leu Asp Asp Glu Ala Gly Pro Leu Glu Glu

165 170 175

Glu Leu Pro Arg Leu Ala Asp Glu Gly Leu Asn Arg Arg Val Ala Glu

180 185 190

Asp Leu Asn Leu Gly Asn Leu Asn Val Ser Ile Pro Trp Thr His Lys

195 200 205

Val Gly Asn Phe Thr Gly Leu Tyr Ser Ser Thr Val Pro Val Phe Asn

210 215 220

Pro Glu Trp Gln Thr Pro Ser Phe Pro Asn Ile His Leu Gln Glu Asp

225 230 235 240

Ile Ile Asn Arg Cys Glu Gln Phe Val Gly Pro Leu Thr Val Asn Glu

245 250 255

Lys Arg Arg Leu Lys Leu Ile Met Pro Ala Arg Phe Tyr Pro Asn Val

260 265 270

Thr Lys Tyr Leu Pro Leu Asp Lys Gly Ile Lys Pro Tyr Tyr Pro Glu

275 280 285

His Leu Val Asn His Tyr Phe Gln Thr Arg His Tyr Leu His Thr Leu

290 295 300

Trp Lys Ala Gly Ile Leu Tyr Lys Arg Glu Thr Thr Arg Ser Ala Ser

305 310 315 320

Phe Cys Gly Ser Pro Tyr Ser Trp Glu Gln Glu Leu Gln His Gly Arg

325 330 335

Leu Val Phe Gln Thr Ser Thr Arg His Gly Asp Glu Ser Phe Cys Gln

340 345 350

Gln Ser Ser Gly Ile Leu Ser Arg Ser Pro Val Gly Pro Cys Leu Gln

355 360 365

Ser Gln Leu Arg Lys Ser Arg Leu Gly Leu Gln Pro Gln Gln Gly His

370 375 380

Leu Ala Arg Arg Gln Gln Gly Arg Ser Gly Ser Ile Arg Ala Arg Val

385 390 395 400

His Pro Thr Thr Arg Arg Pro Phe Gly Val Glu Pro Ser Gly Ser Gly

405 410 415

His Thr Thr Asn Thr Ala Ser Ser Ser Ser Ser Cys Leu His Gln Ser

420 425 430

Ala Val Arg Lys Ala Ala Tyr Ser His Leu Ser Thr Ser Lys Arg His

435 440 445

Ser Ser Ser Gly His Ala Val Glu Leu His Asn Ile Pro Pro Asn Ser

450 455 460

Ala Arg Ser Gln Ser Glu Gly Pro Val Phe Ser Cys Trp Trp Leu Gln

465 470 475 480

Phe Arg Asn Ser Lys Pro Cys Ser Asp Tyr Cys Leu Ser His Ile Val

485 490 495

Asn Leu Leu Glu Asp Trp Gly Pro Cys Thr Glu His Gly Glu His His

500 505 510

Ile Arg Ile Pro Arg Thr Pro Ala Arg Val Thr Gly Gly Val Phe Leu

515 520 525

Val Asp Lys Asn Pro His Asn Thr Thr Glu Ser Arg Leu Val Val Asp

530 535 540

Phe Ser Gln Phe Ser Arg Gly Asn Thr Arg Val Ser Trp Pro Lys Phe

545 550 555 560

Ala Val Pro Asn Leu Gln Ser Leu Thr Asn Leu Leu Ser Ser Asn Leu

565 570 575

Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His Leu Pro Leu

580 585 590

His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser Ser Gly Leu Ser

595 600 605

Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile Ile Asn His Gln

610 615 620

His Gly Thr Met Gln Asn Leu His Asp Ser Cys Ser Arg Asn Leu Tyr

625 630 635 640

Val Ser Leu Leu Leu Leu Tyr Lys Thr Phe Gly Arg Lys Leu His Leu

645 650 655

Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro Met Gly Val

660 665 670

Gly Leu Ser Pro Phe Leu Leu Ala Gln Phe Thr Ser Ala Ile Cys Ser

675 680 685

Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe Ser Tyr Met Asn

690 695 700

Asn Val Val Leu Gly Ala Lys Ser Val Gln His Leu Glu Ser Leu Phe

705 710 715 720

Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile His Leu Asn Pro

725 730 735

Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe Met Gly Tyr Val

740 745 750

Ile Gly Ser Trp Gly Thr Leu Pro Gln Glu His Ile Val Gln Lys Ile

755 760 765

Lys Glu Cys Phe Arg Lys Leu Pro Val Asn Arg Pro Ile Asp Trp Lys

770 775 780

Val Cys Gln Arg Ile Val Gly Leu Leu Gly Phe Ala Ala Pro Phe Thr

785 790 795 800

Gln Cys Gly Tyr Pro Ala Leu Met Pro Leu Tyr Ala Cys Ile Gln Ser

805 810 815

Lys Gln Ala Phe Thr Phe Ser Pro Thr Tyr Lys Ala Phe Leu Cys Lys

820825 830

Gln Tyr Leu Asn Leu Tyr Pro Val Ala Arg Gln Arg Pro Gly Leu Cys

835 840 845

Gln Val Phe Ala Asn Ala Thr Pro Thr Gly Trp Gly Leu Ala Ile Gly

850 855 860

His Gln Arg Met Arg Gly Thr Phe Val Ala Pro Leu Pro Ile His Thr

865 870 875 880

Ala Gln Leu Leu Ala Ala Cys Phe Ala Arg Ser Arg Ser Gly Ala Lys

885 890 895

Leu Ile Gly Thr Asp Asn Ser Val Val Leu Ser Arg Lys Tyr Thr Ser

900 905 910

Phe Pro Trp Leu Leu Gly Cys Ala Ala Asn Trp Ile Leu Arg Gly Thr

915 920 925

Ser Phe Val Tyr Val Pro Ser Ala Leu Asn Pro Ala Asp Asp Pro Ser

930 935 940

Arg Gly Arg Leu Gly Leu Tyr Arg Pro Leu Leu Arg Leu Pro Phe Arg

945 950 955 960

Pro Thr Thr Gly Arg Thr Ser Leu Tyr Ala Asp Ser Pro Ser Val Pro

965 970 975

Ser His Leu Pro Asp Arg Val His Phe Ala Ser Pro Leu His Val Ala

980985 990

Trp Arg Pro Pro

995

<210>13

<211>1023

<212>PRT

<213>Artificial Sequence

<220>

<223>Core-Pol fusion

<400>13

Met Glu Phe Gly Leu Ser Trp Val Phe Leu Val Ala Ile Leu Lys Gly

1 5 10 15

Val Gln Cys Glu Val Gln Leu Leu Glu Ser Gly Met Asp Ile Asp Pro

20 25 30

Tyr Lys Glu Phe Gly Ala Ser Val Glu Leu Leu Ser Phe Leu Pro Ser

35 40 45

Asp Phe Phe Pro Ser Ile Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu

50 55 60

Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr

65 70 75 80

Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Asn Leu Ala

85 90 95

Thr Trp Val Gly Ser Asn Leu Glu Asp Pro Ala Ser Arg Glu Leu Val

100 105 110

Val Ser TyrVal Asn Val Asn Met Gly Leu Lys Ile Arg Gln Leu Leu

115 120 125

Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu

130 135 140

Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg

145 150 155 160

Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr Val Val

165 170 175

Ala Gly Ala Gly Met Pro Leu Ser Tyr Gln His Phe Arg Lys Leu Leu

180 185 190

Leu Leu Asp Asp Glu Ala Gly Pro Leu Glu Glu Glu Leu Pro Arg Leu

195 200 205

Ala Asp Glu Gly Leu Asn Arg Arg Val Ala Glu Asp Leu Asn Leu Gly

210 215 220

Asn Leu Asn Val Ser Ile Pro Trp Thr His Lys Val Gly Asn Phe Thr

225 230 235 240

Gly Leu Tyr Ser Ser Thr Val Pro Val Phe Asn Pro Glu Trp Gln Thr

245 250 255

Pro Ser Phe Pro Asn Ile His Leu Gln Glu Asp Ile Ile Asn Arg Cys

260 265 270

Glu Gln Phe Val GlyPro Leu Thr Val Asn Glu Lys Arg Arg Leu Lys

275 280 285

Leu Ile Met Pro Ala Arg Phe Tyr Pro Asn Val Thr Lys Tyr Leu Pro

290 295 300

Leu Asp Lys Gly Ile Lys Pro Tyr Tyr Pro Glu His Leu Val Asn His

305 310 315 320

Tyr Phe Gln Thr Arg His Tyr Leu His Thr Leu Trp Lys Ala Gly Ile

325 330 335

Leu Tyr Lys Arg Glu Thr Thr Arg Ser Ala Ser Phe Cys Gly Ser Pro

340 345 350

Tyr Ser Trp Glu Gln Glu Leu Gln His Gly Arg Leu Val Phe Gln Thr

355 360 365

Ser Thr Arg His Gly Asp Glu Ser Phe Cys Gln Gln Ser Ser Gly Ile

370 375 380

Leu Ser Arg Ser Pro Val Gly Pro Cys Leu Gln Ser Gln Leu Arg Lys

385 390 395 400

Ser Arg Leu Gly Leu Gln Pro Gln Gln Gly His Leu Ala Arg Arg Gln

405 410 415

Gln Gly Arg Ser Gly Ser Ile Arg Ala Arg Val His Pro Thr Thr Arg

420 425 430

Arg Pro Phe Gly Val Glu ProSer Gly Ser Gly His Thr Thr Asn Thr

435 440 445

Ala Ser Ser Ser Ser Ser Cys Leu His Gln Ser Ala Val Arg Lys Ala

450 455 460

Ala Tyr Ser His Leu Ser Thr Ser Lys Arg His Ser Ser Ser Gly His

465 470 475 480

Ala Val Glu Leu His Asn Ile Pro Pro Asn Ser Ala Arg Ser Gln Ser

485 490 495

Glu Gly Pro Val Phe Ser Cys Trp Trp Leu Gln Phe Arg Asn Ser Lys

500 505 510

Pro Cys Ser Asp Tyr Cys Leu Ser His Ile Val Asn Leu Leu Glu Asp

515 520 525

Trp Gly Pro Cys Thr Glu His Gly Glu His His Ile Arg Ile Pro Arg

530 535 540

Thr Pro Ala Arg Val Thr Gly Gly Val Phe Leu Val Asp Lys Asn Pro

545 550 555 560

His Asn Thr Thr Glu Ser Arg Leu Val Val Asp Phe Ser Gln Phe Ser

565 570 575

Arg Gly Asn Thr Arg Val Ser Trp Pro Lys Phe Ala Val Pro Asn Leu

580 585 590

Gln Ser Leu Thr Asn Leu Leu Ser SerAsn Leu Ser Trp Leu Ser Leu

595 600 605

Asp Val Ser Ala Ala Phe Tyr His Leu Pro Leu His Pro Ala Ala Met

610 615 620

Pro His Leu Leu Val Gly Ser Ser Gly Leu Ser Arg Tyr Val Ala Arg

625 630 635 640

Leu Ser Ser Asn Ser Arg Ile Ile Asn His Gln His Gly Thr Met Gln

645 650 655

Asn Leu His Asp Ser Cys Ser Arg Asn Leu Tyr Val Ser Leu Leu Leu

660 665 670

Leu Tyr Lys Thr Phe Gly Arg Lys Leu His Leu Tyr Ser His Pro Ile

675 680 685

Ile Leu Gly Phe Arg Lys Ile Pro Met Gly Val Gly Leu Ser Pro Phe

690 695 700

Leu Leu Ala Gln Phe Thr Ser Ala Ile Cys Ser Val Val Arg Arg Ala

705 710 715 720

Phe Pro His Cys Leu Ala Phe Ser Tyr Met Asn Asn Val Val Leu Gly

725 730 735

Ala Lys Ser Val Gln His Leu Glu Ser Leu Phe Thr Ala Val Thr Asn

740 745 750

Phe Leu Leu Ser Leu Gly Ile His Leu Asn ProAsn Lys Thr Lys Arg

755 760 765

Trp Gly Tyr Ser Leu Asn Phe Met Gly Tyr Val Ile Gly Ser Trp Gly

770 775 780

Thr Leu Pro Gln Glu His Ile Val Gln Lys Ile Lys Glu Cys Phe Arg

785 790 795 800

Lys Leu Pro Val Asn Arg Pro Ile Asp Trp Lys Val Cys Gln Arg Ile

805 810 815

Val Gly Leu Leu Gly Phe Ala Ala Pro Phe Thr Gln Cys Gly Tyr Pro

820 825 830

Ala Leu Met Pro Leu Tyr Ala Cys Ile Gln Ser Lys Gln Ala Phe Thr

835 840 845

Phe Ser Pro Thr Tyr Lys Ala Phe Leu Cys Lys Gln Tyr Leu Asn Leu

850 855 860

Tyr Pro Val Ala Arg Gln Arg Pro Gly Leu Cys Gln Val Phe Ala Asn

865 870 875 880

Ala Thr Pro Thr Gly Trp Gly Leu Ala Ile Gly His Gln Arg Met Arg

885 890 895

Gly Thr Phe Val Ala Pro Leu Pro Ile His Thr Ala Gln Leu Leu Ala

900 905 910

Ala Cys Phe Ala Arg Ser Arg Ser Gly Ala Lys Leu IleGly Thr Asp

915 920 925

Asn Ser Val Val Leu Ser Arg Lys Tyr Thr Ser Phe Pro Trp Leu Leu

930 935 940

Gly Cys Ala Ala Asn Trp Ile Leu Arg Gly Thr Ser Phe Val Tyr Val

945 950 955 960

Pro Ser Ala Leu Asn Pro Ala Asp Asp Pro Ser Arg Gly Arg Leu Gly

965 970 975

Leu Tyr Arg Pro Leu Leu Arg Leu Pro Phe Arg Pro Thr Thr Gly Arg

980 985 990

Thr Ser Leu Tyr Ala Asp Ser Pro Ser Val Pro Ser His Leu Pro Asp

995 1000 1005

Arg Val His Phe Ala Ser Pro Leu His Val Ala Trp Arg Pro Pro

1010 1015 1020

<210>14

<211>12

<212>DNA

<213>Artificial Sequence

<220>

<223>Linker coding sequence

<400>14

gccggagctg gc 12

<210>15

<211>248

<212>DNA

<213>Artificial Sequence

<220>

<223>ApoA1 gene fragment

<400>15

ttggccgtgc tcttcctgac gggtaggtgt cccctaacct agggagccaa ccatcggggg 60

gccttctccc taaatccccg tggcccaccc tcctgggcag aggcagcagg tttctcactg 120

gccccctctc ccccacctcc aagcttggcc tttcggctca gatctcagcc cacagctggc 180

ctgatctggg tctcccctcc caccctcagg gagccaggct cggcatttcg tcgacaagct 240

tagccacc 248

<210>16

<211>130

<212>DNA

<213>Artificial Sequence

<220>

<223>SV40 polyadenylation signal

<400>16

aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60

aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120

tatcatgtct 130

<210>17

<211>447

<212>DNA

<213>Artificial Sequence

<220>

<223>HBV core

<400>17

atggacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 60

agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctctgtatcgggaa 120

gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 180

tgctgggggg agctgatgaa cctggccaca tgggtgggat ccaatctgga ggaccccgct 240

tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 300

ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 360

tccttcggcg tctggatccg cactccccct gcttatcgac cacccaacgc accaattctg 420

tccaccctgc ccgagaccac agtggtc 447

<210>18

<211>447

<212>DNA

<213>Artificial Sequence

<220>

<223>HBV core

<400>18

atggacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 60

agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctct gtatcgggaa 120

gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 180

tgctgggggg agctgatgaa cctggccaca tgggtgggat cgaatctgga ggaccccgct 240

tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 300

ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 360

tccttcggcg tctggattcg cactccccct gcttatcgac cacccaacgc accaattctg 420

tccaccctgc ccgagaccac agtggtc 447

<210>19

<211>2529

<212>DNA

<213>Artificial Sequence

<220>

<223>HBV pol

<400>19

atgcccctgt cttaccagca ctttagaaag ctgctgctgc tggacgatga agccgggcct 60

ctggaggaag agctgccaag gctggcagac gaggggctga accggagagt ggccgaagat 120

ctgaatctgg gaaacctgaa cgtgagcatc ccttggactc ataaagtcgg caacttcacc 180

gggctgtaca gctccacagt gcctgtcttc aatccagagt ggcagacacc atcctttccc 240

aacattcacc tgcaggagga catcattaat agatgcgaac agttcgtggg acctctgaca 300

gtcaacgaaa agaggcgcct gaaactgatc atgcctgcca ggttttaccc aaatgtgact 360

aagtatctgc cactggataa gggcatcaag ccttactatc cagagcacct ggtgaaccat 420

tacttccaga ctagacacta tctgcatacc ctgtggaagg ccggaatcct gtacaaacga 480

gaaactaccc ggagtgcttc attttgtggc tccccatatt cttgggaaca ggagctgcag 540

catggcaggc tggtgttcca gaccagcaca cgccacgggg atgagtcctt ttgccagcag 600

tctagtggca tcctgagcag atcccccgtg gggccttgtc tgcagtctca gctgcggaag 660

agtagactgg gactgcagcc acagcaggga cacctggcac gacggcagca gggaaggtct 720

ggcagtatcc gggctagagt gcatcccaca actagaaggc ctttcggcgt cgagccatca 780

ggaagcggcc acaccacaaa caccgcatca agctcctcta gttgcctgca tcagtcagcc 840

gtgagaaagg ccgcttacag ccacctgtcc acatctaaaa ggcactcaag ctccgggcat 900

gctgtggagc tgcacaacatccctccaaat tctgcacgca gtcagtcaga aggacccgtg 960

ttcagctgct ggtggctgca gtttcggaac tcaaagcctt gcagcgacta ttgtctgagc 1020

catattgtga atctgctgga ggattggggc ccttgtaccg agcacgggga acaccatatc 1080

aggattccac gaacaccagc acgagtgact ggaggggtgt tcctggtgga caagaacccc 1140

cacaatacta ccgagagccg gctggtggtc gatttcagtc agttttcaag aggcaacaca 1200

agggtgtcat ggcccaaatt cgccgtccct aatctgcaga gtctgactaa cctgctgtct 1260

agtaatctga gctggctgtc cctggacgtg tccgcagcct tttaccacct gcctctgcat 1320

ccagctgcaa tgccccatct gctggtgggg tcaagcggac tgagtcgcta cgtcgcccga 1380

ctgtcctcta actcacgcat cattaatcac cagcatggca ccatgcagaa cctgcacgat 1440

agctgttccc ggaatctgta cgtgtctctg ctgctgctgt ataagacatt cggcagaaaa 1500

ctgcacctgt acagccatcc tatcattctg gggtttagga agatcccaat gggagtggga 1560

ctgagcccct tcctgctggc acagtttacc tccgccattt gctctgtggt ccgccgagcc 1620

ttcccacact gtctggcttt ttcctatatg aacaatgtgg tcctgggcgc caaatccgtg 1680

cagcatctgg agtctctgtt cacagctgtc actaactttc tgctgagcct ggggatccac 1740

ctgaacccaa ataagactaa acgctggggg tacagcctga atttcatggg atatgtgatt 1800

ggatcctggg ggaccctgcc acaggagcac atcgtgcaga agatcaagga atgctttcgg 1860

aagctgcccg tcaacagacc tatcgactgg aaagtgtgcc agcggattgt cggactgctg 1920

ggcttcgccg ctccctttac ccagtgcggg tacccagcac tgatgcccct gtatgcctgt 1980

atccagtcta agcaggcttt cacctttagt cctacataca aggcattcct gtgcaaacag 2040

tacctgaacc tgtatccagt ggcaaggcag cgacctggac tgtgccaggt ctttgcaaat 2100

gccactccta ccggctgggg gctggctatc ggacatcagc gaatgcgggg cacattcgtg 2160

gcccccctgc ctattcacac tgctcagctg ctggcagcct gctttgctag atctaggagt 2220

ggagcaaagc tgatcggcac cgacaatagt gtggtcctgt caagaaaata cacatccttc 2280

ccatggctgc tgggatgtgc tgcaaactgg attctgaggg gcaccagctt cgtgtacgtc 2340

ccctcagccc tgaatcctgc tgacgatcca tcccgcgggc gactgggact gtaccgacct 2400

ctgctgagac tgcccttcag gcctacaact ggccggacat ctctgtatgc cgattcacca 2460

agcgtgccct cacacctgcc tgacagagtc cactttgctt cacccctgca cgtcgcttgg 2520

cggcctcca 2529

<210>20

<211>2529

<212>DNA

<213>Artificial Sequence

<220>

<223>HBV pol

<400>20

atgcccctgt cttaccagca ctttagaaag cttctgctgc tggacgatga agccgggcct 60

ctggaggaag agctgccaag gctggcagac gaggggctga accggagagt ggccgaagat 120

ctgaatctgg gaaacctgaa cgtgagcatc ccttggactc ataaagtcgg caacttcacc 180

gggctgtaca gctccacagt gcctgtcttc aatccagagt ggcagacacc atcctttccc 240

aacattcacc tgcaggagga catcattaat agatgcgaac agttcgtggg acctctgaca 300

gtcaacgaaa agaggcgcct gaaactgatc atgcctgcca ggttttaccc aaatgtgact 360

aagtatctgc cactggataa gggcatcaag ccttactatc cagagcacct ggtgaaccat 420

tacttccaga ctagacacta tctgcatacc ctgtggaagg ccggaatcct gtacaaacga 480

gaaactaccc ggagtgcttc attttgtggc tccccatatt cttgggaaca ggagctgcag 540

catggcaggc tggtgttcca gaccagcaca cgccacgggg atgagtcctt ttgccagcag 600

tctagtggca tcctgagcag atcccccgtg gggccttgtc tgcagtctca gctgcggaag 660

agtagactgg gactgcagcc acagcaggga cacctggcac gacggcagca gggaaggtct 720

ggcagtatcc gggctagagt gcatcccaca actagaaggc ctttcggcgt cgagccatca 780

ggaagcggcc acaccacaaa caccgcatca agctcctcta gttgcctgca tcagtcagcc 840

gtgagaaagg ccgcttacag ccacctgtcc acatctaaaa ggcactcaag ctccgggcat 900

gctgtggagc tgcacaacat ccctccaaat tctgcacgca gtcagtcaga aggacccgtg 960

ttcagctgct ggtggctgca gtttcggaac tcaaagcctt gcagcgacta ttgtctgagc 1020

catattgtga atctgctgga ggattggggc ccttgtaccg agcacgggga acaccatatc 1080

aggattccac gaacaccagc acgagtgact ggaggggtgt tcctggtgga caagaacccc 1140

cacaatacta ccgagagccg gctggtggtc gatttcagtc agttttcaag aggcaacaca 1200

agggtgtcat ggcccaaatt cgccgtccct aatctgcaga gtctgactaa cctgctgtct 1260

agtaatctga gctggctgtc cctggacgtg tccgcagcct tttaccacct gcctctgcat 1320

ccagctgcaa tgccccatct gctggtgggg tcaagcggac tgagtcgcta cgtcgcccga 1380

ctgtcctcta actcacgcat cattaatcac cagcatggca ccatgcagaa cctgcacgat 1440

agctgttccc ggaatctgta cgtgtctctg ctgctgctgt ataagacatt cggcagaaaa 1500

ctgcacctgt acagccatcc tatcattctg gggtttagga agatcccaat gggagtggga 1560

ctgagcccct tcctgctggc acagtttacc tccgccattt gctctgtggt ccgccgagcc 1620

ttcccacact gtctggcttt ttcctatatg aacaatgtgg tcctgggcgc caaatccgtg 1680

cagcatctgg agtctctgtt cacagctgtc actaactttc tgctgagcct ggggatccac 1740

ctgaacccaa ataagactaa acgctggggg tacagcctga atttcatggg atatgtgatt 1800

ggatcctggg ggaccctgcc acaggagcac atcgtgcaga agatcaagga atgctttcgg 1860

aagctgcccg tcaacagacc tatcgactgg aaagtgtgcc agcggattgt cggactgctg 1920

ggcttcgccg ctccctttac ccagtgcggg tacccagcac tgatgcccct gtatgcctgt 1980

atccagtcta agcaggcttt cacctttagt cctacataca aggcattcct gtgcaaacag 2040

tacctgaacc tgtatccagt ggcaaggcag cgacctggac tgtgccaggt ctttgcaaat 2100

gccactccta ccggctgggg gctggctatc ggacatcagc gaatgcgggg cacattcgtg 2160

gcccccctgc ctattcacac tgctcagctg ctggcagcct gctttgctag atctaggagt 2220

ggagcaaagc tgatcggcac cgacaatagt gtggtcctgt caagaaaata cacatccttc 2280

ccatggctgc tgggatgtgc tgcaaactgg attctgaggg gcaccagctt cgtgtacgtc 2340

ccctcagccc tgaatcctgc tgacgatcca tcccgcgggc gactgggact gtaccgacct 2400

ctgctgagac tgcccttcag gcctacaact ggccggacat ctctgtatgc cgattcacca 2460

agcgtgccct cacacctgcc tgacagagtc cactttgctt cacccctgca cgtcgcttgg 2520

cggcctcca 2529

<210>21

<211>671

<212>DNA

<213>Artificial Sequence

<220>

<223>pUC Ori

<400>21

cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc 60

ttgcaaacaa aaaaaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 120

ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt tcttctagtg 180

tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 240

ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 300

tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 360

cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 420

gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 480

ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 540

gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 600

agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct 660

tttgctcaca t 671

<210>22

<211>795

<212>DNA

<213>Artificial Sequence

<220>

<223>Kan resistance

<400>22

atgattgagc aagatggtct tcacgctggc tcgccagctg cgtgggtgga acgcctgttt 60

ggttatgatt gggcgcagca gactattgga tgttccgacg cggctgtatt tcggctgtct 120

gctcagggtc gccccgtgct gtttgtgaag acggatttgt ctggcgcatt aaatgagtta 180

caggacgagg cggctcgtct gagttggttg gccaccaccg gcgtgccctg cgccgcagtg 240

ctggatgtcg tgacagaagc aggccgcgat tggctccttc tcggcgaagt gccgggccag 300

gacctgctca gcagccactt ggcaccggca gaaaaagttt ctatcatggc cgacgccatg 360

cgtcgtcttc acactctcga tccggccacg tgcccctttg accaccaggc caagcatcgt 420

attgaacgtg cgcgtactcg gatggaagca ggtttagtag accaggacga tttggatgag 480

gaacatcaag gcctggcccc ggctgaactg tttgcgcgct taaaagcgtc gatgccagat 540

ggcgaagatt tggtagtcac ccatggagat gcgtgtttgc caaacatcat ggttgaaaat 600

ggccgcttct caggctttat tgactgtggg cgcctgggtg ttgccgaccg ctatcaagat 660

attgcgctcg caactcgtga catcgctgaa gagctgggcg gagaatgggc tgaccgtttc 720

ctggtactgt atggcattgc agcgcccgat tcccaacgca tcgcatttta tcgtctgctg 780

gatgagtttt tctaa 795

<210>23

<211>264

<212>PRT

<213>Artificial Sequence

<220>

<223>Kan resistance

<400>23

Met Ile Glu Gln Asp Gly Leu His Ala Gly Ser Pro Ala Ala Trp Val

1 5 10 15

Glu Arg Leu Phe Gly Tyr Asp Trp Ala Gln Gln Thr Ile Gly Cys Ser

20 25 30

Asp Ala Ala Val Phe Arg Leu Ser Ala Gln Gly Arg Pro Val Leu Phe

35 40 45

Val Lys Thr Asp Leu Ser Gly Ala Leu Asn Glu Leu Gln Asp Glu Ala

50 55 60

Ala Arg Leu Ser Trp Leu Ala Thr Thr Gly Val Pro Cys Ala Ala Val

65 70 75 80

Leu Asp Val Val Thr Glu Ala Gly Arg Asp Trp Leu Leu Leu Gly Glu

85 90 95

Val Pro Gly Gln Asp Leu Leu Ser Ser His Leu Ala Pro Ala Glu Lys

100 105 110

Val Ser Ile Met Ala Asp Ala Met Arg Arg Leu His Thr Leu Asp Pro

115 120 125

Ala Thr Cys Pro Phe Asp His Gln Ala Lys His Arg Ile Glu Arg Ala

130 135 140

Arg Thr Arg Met Glu Ala Gly Leu Val Asp Gln Asp Asp Leu Asp Glu

145 150155 160

Glu His Gln Gly Leu Ala Pro Ala Glu Leu Phe Ala Arg Leu Lys Ala

165 170 175

Ser Met Pro Asp Gly Glu Asp Leu Val Val Thr His Gly Asp Ala Cys

180 185 190

Leu Pro Asn Ile Met Val Glu Asn Gly Arg Phe Ser Gly Phe Ile Asp

195 200 205

Cys Gly Arg Leu Gly Val Ala Asp Arg Tyr Gln Asp Ile Ala Leu Ala

210 215 220

Thr Arg Asp Ile Ala Glu Glu Leu Gly Gly Glu Trp Ala Asp Arg Phe

225 230 235 240

Leu Val Leu Tyr Gly Ile Ala Ala Pro Asp Ser Gln Arg Ile Ala Phe

245 250 255

Tyr Arg Leu Leu Asp Glu Phe Phe

260

<210>24

<211>99

<212>DNA

<213>Artificial Sequence

<220>

<223>bla promoter

<400>24

acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa 60

ccctgataaa tgcttcaata atattgaaaa aggaagagt 99

<210>25

<211>124

<212>DNA

<213>Artificial Sequence

<220>

<223>PrMVA13.5 Long Promoter

<400>25

taaaaataga aactataatc atataatagt gtaggttggt agtattgctc ttgtgactag 60

agactttagt taaggtactg taaaaataga aactataatc atataatagt gtaggttggt 120

agta 124

<210>26

<211>227

<212>DNA

<213>Artificial Sequence

<220>

<223>PrHyb Promoter

<400>26

gttttgaaaa tttttttata ataaatatcc ggtaaaaatt gaaaaactat tctaatttat 60

tgcacggtcc ggtaaaaatt gaaaaactat tctaatttat tgcacggtcc ggtaaaaatt 120

gaaaaactat tctaatttat tgcacggtcc ggtaaaaatt gaaaaactat tctaatttat 180

tgcacggtcc ggtaaaaatt gaaaaactat tctaatttat tgcacgg 227

<210>27

<211>81

<212>DNA

<213>Artificial Sequence

<220>

<223>Immunoglobulin Secretion Tag

<400>27

atggaattcg gcctgagctg ggtgttcctg gtggccatcc tgaagggagt gcagtgcgag 60

gtgcagctgc tggaaagcgg t 81

<210>28

<211>7

<212>DNA

<213>Artificial Sequence

<220>

<223>Transcription Termination Sequence

<220>

<221>n

<222>(6)..(6)

<223>n, wherein n can be any nucleotide

<400>28

tttttnt 7

Claims

1. A modified vaccinia virus ankara (MVA) vector comprising a non-naturally occurring nucleic acid molecule comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID No. 4.

2. The MVA vector of claim 1, wherein

The HBV polymerase antigen is capable of inducing an immune response in a mammal against at least two HBV genotypes;

preferably, the HBV polymerase antigen is capable of inducing a T cell response in a mammal against at least HBV genotypes B, C and D;

more preferably, the HBV polymerase antigen is capable of inducing a CD8T cell response in a human subject against at least HBV genotypes A, B, C and D.

3. The MVA vector of claim 1, wherein

The HBV polymerase antigen comprises an amino acid sequence of SEQ ID NO. 4.

4. The MVA vector of any one of claims 1 to 3, further comprising a polynucleotide sequence encoding a signal sequence operably linked to the HBV polymerase antigen.

5. The MVA vector of any of claims 1 to 4, wherein

The first polynucleotide sequence is at least 90% identical to SEQ ID NO. 3.

6. The MVA vector of claim 5, wherein

The first polynucleotide sequence comprises the polynucleotide sequence of SEQ ID NO. 3.

7. The MVA vector of any one of claims 1 to 6, further comprising a second polynucleotide sequence encoding a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID NO 2.

8. The MVA vector of claim 7, wherein

The second polynucleotide sequence is at least 90% identical to SEQ ID NO. 1.

9. The MVA vector of claim 8, wherein

The second polynucleotide sequence comprises the polynucleotide sequence of SEQ ID NO. 1.

10. A composition comprising the MVA vector of any of claims 1-9 and a pharmaceutically acceptable carrier.

11. A method of enhancing an immune response in a human subject, the method comprising:

a. administering to the human subject a first composition comprising an immunologically effective amount of an adenoviral vector comprising a non-naturally occurring nucleic acid molecule comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID NO 4; and

b. administering to the human subject a second composition comprising an immunologically effective amount of the MVA vector of any of claims 1-10;

to obtain an enhanced immune response against the HBV antigen in said human subject.

12. The method of claim 11, wherein

The HBV polymerase antigen of the first composition is capable of inducing an immune response in a human subject against at least two HBV genotypes;

preferably, the HBV polymerase antigen is capable of inducing a T cell response in a human subject against at least HBV genotypes B, C and D;

13. The method of claim 12, wherein

The HBV polymerase antigen of the first composition comprises the amino acid sequence of SEQ ID NO. 4.

14. The method of any one of claims 11-13, wherein

The first polynucleotide sequence of the first composition is at least 90% identical to SEQ ID NO 19.

15. The method of claim 14, wherein

The first polynucleotide sequence of the first composition comprises the polynucleotide sequence of SEQ ID NO 19.

16. The method of any one of claims 11-15, wherein

The nucleic acid molecule of the adenoviral vector in the first composition further comprises a second polynucleotide sequence encoding a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2.

17. The method of claim 16, wherein

The second polynucleotide sequence of the first composition is at least 90% identical to SEQ ID NO 17.

18. The method of claim 17, wherein

The second polynucleotide sequence of the first composition comprises the polynucleotide sequence of SEQ ID NO 17.

19. The method of any one of claims 16-18, wherein

The first and second polynucleotide sequences of the first composition encode a fusion protein comprising a truncated HBV core antigen operably linked to an HBV polymerase antigen.

20. The method of claim 19, wherein

The fusion protein of the first composition comprises a truncated HBV core antigen operably linked to an HBV polymerase antigen via a linker.

21. The method of claim 20, wherein

The linker of the first composition comprises the amino acid sequence of (AlaGly) n, and n is an integer from 2 to 5; preferably, the linker is encoded by a polynucleotide sequence comprising SEQ ID NO. 14.

22. The method of claim 21, wherein

The fusion protein of the first composition comprises the amino acid sequence of SEQ ID NO 12.

23. The method of any one of claims 11-22, wherein

The enhanced immune response comprises an enhanced antibody response against an HBV antigen in a human subject.

24. The method of claim 23, wherein

The enhanced immune response comprises an enhanced CD8+ T cell response to HBV antigen in a human subject.

25. The method of claim 23 or 24, wherein

The enhanced immune response comprises a CD4+ T cell response to HBV antigen in a human subject.

26. The method of any one of claims 11-25, wherein

The adenovirus vector is an rAd26 or rAd35 vector.

27. The method of any one of claims 11-26, wherein

Step (b) is performed 1-12 weeks after step (a).

28. The method of any one of claims 11-26, wherein

Step (b) is performed 2-12 weeks after step (a).

29. The method of any one of claims 11-26, wherein

Step (b) is performed at least 1 week after step (a).

30. The method of any one of claims 11-26, wherein

Step (b) is performed at least 2 weeks after step (a).

31. A method of enhancing an immune response in a human subject, the method comprising:

a. administering to the human subject a first composition comprising an immunologically effective amount of a first plasmid comprising a first non-naturally occurring nucleic acid molecule comprising a first polynucleotide sequence encoding an HBV polymerase antigen comprising an amino acid sequence at least 98% identical to SEQ ID No. 4 and a second plasmid comprising a second non-naturally occurring nucleic acid molecule comprising a second polynucleotide sequence encoding a truncated HBV core antigen consisting of the amino acid sequence of SEQ ID No. 2; and

32. The method of claim 31, wherein

The HBV polymerase antigen of the first composition has no reverse transcriptase activity and RNase H activity.

33. The method of claim 31 or 32, wherein

The first composition is used to elicit an immune response and the second composition is used to boost an immune response.

34. The method of any one of claims 31-33, wherein

35. The method of any one of claims 31-34, wherein

36. The method of any one of claims 31-35, further comprising a polynucleotide sequence encoding a signal sequence of an HBV polymerase antigen operably linked to the first composition.

37. The method of claim 36, wherein

The signal sequence comprises the amino acid sequence of SEQ ID NO 6 or SEQ ID NO 11;

preferably, the signal sequence is encoded by the polynucleotide sequence of SEQ ID NO. 5 or SEQ ID NO. 10.

38. The method of any one of claims 31-37, wherein

The first polynucleotide sequence of the first composition is at least 90% identical to SEQ ID NO 20.

39. The method of claim 38, wherein

The first polynucleotide sequence of the first composition comprises the polynucleotide sequence of SEQ ID NO. 20.

40. The method of any one of claims 31-39, wherein

The second polynucleotide sequence of the first composition is at least 90% identical to SEQ ID NO 18.

41. The method of claim 40, wherein

The second polynucleotide sequence of the first composition comprises the polynucleotide sequence of SEQ ID NO. 18.

42. The method of any one of claims 31-41, wherein

The first and second polynucleotide sequences of the first composition further comprise a promoter sequence, optionally one or more additional regulatory sequences,

preferably, the promoter sequence comprises the polynucleotide sequence of SEQ ID NO. 7 and the additional regulatory sequence is selected from the enhancer sequence of SEQ ID NO. 8 or SEQ ID NO. 15 and the polyadenylation signal sequence of SEQ ID NO. 16.

43. The method of any one of claims 31-42, wherein

44. The method of claim 43, wherein

45. The method of claim 43 or 44, wherein

The enhanced immune response comprises an enhanced CD4+ T cell response to HBV antigen in a human subject.

46. The method of any one of claims 31-45, wherein

Step (b) is performed 1-12 weeks after step (a).

47. The method of any one of claims 31-45, wherein

Step (b) is performed 2-12 weeks after step (a).

48. The method of any one of claims 31-45, wherein

Step (b) is performed at least 1 week after step (a).

49. The method of any one of claims 31-45, wherein

Step (b) is performed at least 2 weeks after step (a).