CN111733288A - Nucleic acid detection method and device and application in COVID-19 detection - Google Patents
Nucleic acid detection method and device and application in COVID-19 detection Download PDFInfo
- Publication number
- CN111733288A CN111733288A CN202010578157.8A CN202010578157A CN111733288A CN 111733288 A CN111733288 A CN 111733288A CN 202010578157 A CN202010578157 A CN 202010578157A CN 111733288 A CN111733288 A CN 111733288A
- Authority
- CN
- China
- Prior art keywords
- connecting groove
- cavity
- nucleic acid
- detection
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
A nucleic acid detection device comprises a first cavity, a second cavity, a third cavity, a first connecting groove, a second connecting groove and a third connecting groove. The first cavity is used for RT-RAA amplification, the second cavity contains buffer solution, and the third cavity is used for placing test paper strips. The first connecting groove is communicated with the first cavity, the second connecting groove is communicated with the second cavity, and the third connecting groove is communicated with the first connecting groove, the second connecting groove and the third cavity respectively. The substrate provides support for the first chamber, the second chamber, the third chamber, the first connecting groove, the second connecting groove and the third connecting groove. The device provided by the invention can be used for rapidly detecting the nucleic acid amplification product through the nucleic acid detection test strip in a physically closed environment. The method has the characteristics of simple operation, quick interpretation, pollution prevention, no toxic substance, no need of large instruments and equipment and the like, can completely meet the requirement of COVID-19 epidemic situation field detection, and is beneficial to early diagnosis and isolation of the epidemic situation, reduction of infection rate and control of epidemic situation spread.
Description
Technical Field
The invention relates to a method for detecting a substance, in particular to a nucleic acid detection method and a device thereof, and application in COVID-19 virus detection.
Background
The reverse transcription recombinase-mediated isothermal nucleic acid amplification technology combined with the Lateral flow chromatography test strip is a technology for directly detecting RAA amplification products by combining a reverse transcription recombinase-mediated isothermal nucleic acid amplification technology (RT-RAA technology) with a Lateral flow chromatography test strip (LFD) technology. Based on the RAA technology, the RAA-LFD technology mainly utilizes a specific probe (nfo probe) with a 5 'end labeled with a fluorescent group (usually FAM) and a reverse primer with a 5' end labeled with biotin or digoxin, and an amplification product with double labels can be formed after the reaction is carried out for 20 to 40 minutes at a constant temperature of between 37 and 42 ℃. When the test strip is used for detection, an amplification product to be detected flows to a binding region which is coated with FAM antibody-nano gold particles in advance by utilizing the capillary action. The FAM antibody-gold nanoparticles form immune complexes after binding with FAM in the double-labeled amplification product. The detection line (test, T) is coated with biotin antibody, and when the immune complex diffuses to the detection line, biotin in the double-labeled amplification product is captured by the biotin antibody and forms a macroscopic immune complex. The quality control line (C) is coated with a secondary antibody, and can be combined with FAM antibody-nano gold particles to generate a color reaction. The method is particularly suitable for low-resource areas or POCT inspection modes due to the characteristics of quick response, simple and convenient operation, no need of special equipment and the like. However, these methods still have problems of complicated operation, low sensitivity, and low degree of integration. Therefore, there is an urgent need to develop a novel instant detection technology with simplicity, low cost and high integration degree for biomedical analysis.
The microfluidic platform allows for the integration of analytical processes including reagent transfer, separation, mixing, reaction and detection in a single small device (e.g., a chip). A variety of microfluidic chip-based point-of-care detection strategies have been developed. For example: the ELISA process is integrated on a micro-flow control pneumatic Chip (IV-Chip), and the visual quantitative detection of troponin (cTnI), myoglobin (Myo) and creatine kinase isoenzyme (CK-MB) of the myocardial infarction is realized (Lab Chip 2016, 16, 2955-. In order to facilitate the application of the ELISA in detection, a highly integrated distance reading-based 'sample input-response' ELISA chip is provided, which integrates a fussy ELISA into a microfluidic device and can detect disease biomarkers only by simple permanent magnet operation. (Biosens.Bioelectron.2017, 96, 332)
Disclosure of Invention
An object of the present invention is to provide a method for detecting nucleic acids, which can shorten the time required for detecting nucleic acids and improve the convenience of detection.
Another object of the present invention is to provide a nucleic acid detecting apparatus which facilitates nucleic acid detection in a living body and improves the convenience of detection.
It is still another object of the present invention to provide a nucleic acid detecting apparatus, which is used as a microfluidic chip to increase the integration level of nucleic acid amplification and detection and increase the detection speed.
It is still another object of the present invention to provide a kit for detecting CODVI-19 nucleic acid, which is advantageous for applying the above-mentioned nucleic acid detection method to nucleic acid detection of CODVI-19 so as to prevent cross-contamination.
A device for nucleic acid detection, comprising:
a first lumen for RT-RAA amplification;
a second chamber containing a buffer solution therein;
and the third cavity is internally provided with a test strip.
In order to facilitate the mixing of the samples as required, the device is also provided with a plurality of connecting grooves which are respectively communicated with the cavities.
Another apparatus for nucleic acid detection, comprising:
a first lumen for RT-RAA amplification;
a second chamber containing a buffer solution therein;
a third chamber, wherein the test strip is placed in the third chamber;
a first connecting groove communicating with the first chamber;
a second connecting groove communicating with the second chamber;
and the third connecting groove is communicated with the first connecting groove, the second connecting groove and the third cavity respectively.
The nucleic acid detection device further comprises a base material which provides support for the first cavity, the second cavity, the third cavity, the first connecting groove, the second connecting groove and the third connecting groove. Materials that are "inert" to the nucleic acid detection reagents can be used as substrates. Typically, the substrate is also a part of the detection plate, and the detection plate is formed by the substrate, the first chamber, the second chamber, the third chamber, the first connecting groove, the second connecting groove, the third connecting groove and the like. A commonly understood test panel, has a bottom edge, a top edge, and two side edges. The direction along the bottom edge toward the top edge is understood to be the upper side or the upward side, and the direction along the top edge toward the bottom edge is understood to be the lower side or the downward side. By bottom end should be understood a local part of the detector plate near the edge of the bottom end. By tip, we mean that part of the detector plate near the edge of the tip.
For the purpose of detecting nucleic acid, the present invention is configured such that a third connecting groove is provided at the bottom end of a detection plate, and a first connecting groove and a second connecting groove are provided on the upper side of the third connecting groove. The first connecting groove and the second connecting groove are connected with each other, so that the first connecting groove and the second connecting groove are communicated. The junction is located on the upper side of the third connecting groove, so that the substance from the first cavity and the substance from the second cavity are mixed in advance and then are introduced into the third connecting groove. And the mixed substance moves to the third cavity along the third connecting groove, and the mixed substance is detected in the third cavity.
The third cavity is arranged on the upper side of the third connecting groove and is generally in a strip shape, so that a test strip can be conveniently arranged in the third cavity, a sample from the third connecting groove can be conveniently driven by capillary phenomenon on the test strip to move upwards, and the detection purpose can be realized. Such as: presenting a T-line and a C-line.
To facilitate mixing of the substances in the first chamber, and mixing of the substances in the second chamber, the present invention also applies a mark on a corner of the test plate indicating that a greater force is being applied to a local portion of the test plate. Preferably, the bottom edge near the intersection is marked with an applied force, in the form of: but are not limited to arrows, targets, or finger-like indicator symbols, etc.
The detection plate of the nucleic acid detection device is used for microfluidic detection, and the specifications of each cavity and each groove on the detection plate are designed according to the microfluidic detection requirements (microfluidic chip laboratory [ P ], Beijing: science publishing agency, 2006; graphic microfluidic chip laboratory [ P ], Beijing: science publishing agency, 2008).
The nucleic acid detecting device of the present invention further comprises a base plate disposed below the detection plate to support the detection plate.
The nucleic acid detecting apparatus of the present invention further includes a cover plate covering the detection plate and including a first well, a second well, and a third well. The first hole and the second hole are respectively used for adding the composition for RT-RAA amplification and the test strip buffer solution to the first cavity and the second cavity correspondingly. The third aperture is for venting.
Adding a molecular crowding reagent in the first chamber, such as: but are not limited to polyethylene glycol (PEG) with the molecular weight of 35,000 and the concentration of 20 wt%, nucleic acid amplification initiator (such as 280nM magnesium acetate), sample nucleic acid (such as RNA), upstream primer of fluorescence label (such as FAM), downstream primer of Biotin (Biotin) label, reaction dry powder enzyme reagent and the like.
Strip buffer was added in the second chamber.
On the nucleic acid test strip, colloidal gold is fixed on a binding pad of the nucleic acid test strip to bind with an anti-FAM antibody, a streptavidin-labeled antibody is fixed on a T line, and a fluorescein-anti-antibody is fixed on a C line.
The invention provides a nucleic acid detection method, which comprises the following amplification steps:
and (3) blending the molecular crowding reagent, the nucleic acid amplification starter, the reaction dry powder enzyme preparation and the amplification primer pair, putting the mixture into constant temperature equipment at 37-42 ℃, taking out the mixture after 3-7 minutes, oscillating the substance in the first cavity again, standing the mixture in the constant temperature equipment at 37-42 ℃ again for continuous amplification, taking out the mixture after 9-13 minutes, and finishing the reaction.
The invention provides another nucleic acid detection method, which comprises the following amplification steps:
adding strip buffer (e.g., 200. mu.L) to the second chamber of the assay plate, and
adding a mixture of a molecular crowding reagent, a sample nucleic acid, a primer pair and a reaction dry powder enzyme reagent into a first cavity of a detection plate;
then, adding a nucleic acid amplification initiator into the first cavity;
and (3) blending the molecular crowding reagent, the nucleic acid amplification starter, the reaction dry powder enzyme preparation and the amplification primer pair, putting the mixture into constant temperature equipment at 37-42 ℃, taking out the mixture after 3-7 minutes, oscillating the substance in the first cavity again, standing the mixture in the constant temperature equipment at 37-42 ℃ again for continuous amplification, taking out the mixture after 9-13 minutes, and finishing the reaction.
The invention provides another nucleic acid detection method, which comprises the following steps:
adding strip buffer (e.g., 200. mu.L) to the second chamber of the assay plate, and
adding a mixture of a molecular crowding reagent, a sample nucleic acid, a primer pair and a reaction dry powder enzyme reagent into a first cavity of a detection plate;
then, adding a nucleic acid amplification initiator into the first cavity;
then, reversing the detection plate to enable the third connecting groove at the bottom end to be positioned at the upper side, oscillating the substance in the first cavity (for example, flicking the first cavity by a finger for 5-10 times), standing in constant temperature equipment at 37-42 ℃, taking out after 3-7 minutes, again oscillating the substance in the first cavity (for example, flicking the first cavity by a finger for 5-10 times), standing in constant temperature equipment at 37-42 ℃ again for continuous amplification, taking out after 9-13 minutes, and finishing the reaction;
applying an acting force to the detection plate to mix the substance in the first cavity with the test strip buffer solution in the second cavity, and inverting the detection plate again to enable the third connecting groove to recover and be positioned at the bottom end of the detection plate, and enabling the substance in the third connecting groove to move towards the third cavity and contact the test strip;
and finally, observing for 5-10 minutes and judging the result. And (4) judging the test strip to be positive when two lines are presented on the test strip (namely, the T line and the C line are developed).
The new coronavirus (COVID-19) epidemic situation appearing in 2019 can be used for realizing the rapid detection of virus nucleic acid by adopting the nucleic acid detection device and the nucleic acid detection method, such as: preparing a virus nucleic acid detection kit.
Such as: primer pairs with the following sequences are added into the first cavity:
upstream primer of 5' end labeled FAM group: gcaacagttcaagaaattcaactccaggcagc, respectively; and
downstream primer of 5' end labeled Biotin: tagtgacagtttggccttgttgttgttggcct are provided.
The kit of the present invention further comprises instructions describing a primer amplification method and a nucleic acid detection method.
The nucleic acid detecting apparatus and the detecting method provided by the present invention have versatility, and can detect cells, viruses, bacteria, and the like containing target nucleic acids.
The beneficial effects brought by the invention are as follows:
1. the nucleic acid detection device is particularly suitable for being combined with a microfluidic chip technology to obtain a closed cavity, aerosol pollution in the isothermal amplification process can be prevented, and reagents can be well mixed in the cavity. The test strip is packaged in the microfluidic chip and can be stably detected.
2. The primer pair used in the invention is obtained by screening a large number of primers, has strong detection specificity and high sensitivity on the N gene of COVID-19, and the lower detection limit is 1 RNA copy per microliter.
3. The invention adopts RT-RAA-LFD technology to establish the micro-fluidic chip for rapidly detecting the new coronavirus, and has the advantages of high sensitivity and high flux of molecular biological detection, high specificity of immunological detection, high integration and high closure of the micro-fluidic technology, simple and convenient operation, no dependence on complex instruments and complete satisfaction of the requirement of detecting the new coronavirus on site.
4. The technical scheme of the invention can obviously improve the detection speed. Compared with the conventional PCR, the RT-RAA amplification reaction can be completed in about 20 minutes at 42 ℃ without three steps of denaturation, annealing and extension.
5. The detection device does not need complex instruments and equipment, is not easy to cross-contaminate and is suitable for field detection. The detection method can be used for amplification and visual detection of test strips under the conditions of normal temperature and isothermality, does not need to depend on complex instruments and equipment such as a PCR instrument, a fluorescent quantitative PCR instrument, an electrophoresis apparatus, an electrophoresis tank and the like, does not need complex sample treatment for RT-RAA, can be automatically detected by anyone according to the instruction, and can really realize portable on-site rapid nucleic acid detection.
6. The invention adopts RT-RAA-LFD technology to establish the micro-fluidic chip for rapidly detecting the new coronavirus for the first time, can be used for clinical field detection through specificity, sensitivity and actual sample analysis, and provides a sensitive and reliable new method for the instant detection of the new coronavirus.
Drawings
FIG. 1a is a schematic structural diagram of a nucleic acid detecting apparatus according to an embodiment of the present invention;
FIG. 1b is a schematic view showing an example of nucleic acid detection using the nucleic acid detecting apparatus of the present invention;
FIG. 2 is a schematic diagram of a procedure for detecting nucleic acid using the apparatus shown in FIG. 1a, which includes steps of amplification, mixing, chromatography, and color development of sample RNA, performed sequentially along FIG. 2a, FIG. 2b, and FIGS. 2c to 2 d;
FIG. 3 is a graph showing the results of a feasibility test for detecting the COVID-19 virus using the apparatus of the present invention, wherein the minimum detection limit of the nucleic acid is 2aM as indicated by the addition of a "box";
FIG. 4 is a graph showing the results of specific detection of the COVID-19 virus using the apparatus of the present invention, wherein the addition of a "box" indicates that the virus N gene results in positive results;
FIG. 5 is a graph showing the results of sensitivity verification for detecting the COVID-19 virus using the device of the present invention, where the "box" is added to indicate that the minimum detection limit of nucleic acid is 2 aM.
Detailed Description
The technical scheme of the invention is described in detail in the following with reference to the accompanying drawings. Although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the spirit and scope of the invention as defined in the appended claims.
Example 1
FIG. 1a is a schematic structural diagram of an embodiment of the nucleic acid detecting apparatus of the present invention, and FIG. 1b is a schematic structural diagram of an embodiment of nucleic acid detection performed by the nucleic acid detecting apparatus of the present invention. As shown in FIGS. 1 and 2, the nucleic acid detecting apparatus of the present invention includes a cover plate 100, a detection plate 200, and a base plate 300. The bottom plate 300 is arranged below the detection plate 200 to support the detection plate 200, and the bottom plate is made of the following materials: but are not limited to, Polymethylmethacrylate (PMMA), Polycarbonate (PC), Cyclic Olefin Copolymers (COC), glass, polyethylene, and the like. The cover plate 100 is made of the following materials: but are not limited to, Polymethylmethacrylate (PMMA), Polycarbonate (PC), Cyclic Olefin Copolymer (COC), glass, polyethylene, and the like, which covers the sensing plate 200, including the first hole 110, the second hole 120, and the third hole 130.
The first lumen 210 is used for RT-RAA amplification. The second chamber 220 contains a buffer solution. A test strip is placed in the third chamber 230. In this example, the first connection groove 240 communicates with the first chamber 210. The second coupling groove 250 communicates with the second chamber 220. The third coupling groove 260 is formed at the bottom end of the sensing plate 200 to communicate with the first coupling groove 240, the second coupling groove 250, and the third chamber 230, respectively. The third cavity 230 is disposed above the third connecting groove 260, and the third cavity 230 is generally in the shape of a "strip", which is beneficial to disposing the test strip 400 therein, and is also beneficial to driving the sample from the third connecting groove 260 to move upward by capillary phenomenon on the test strip 400, and achieving the purpose of detection. Such as: presenting a T-line and a C-line.
The first coupling groove 240 and the second coupling groove 250 are coupled to each other, so that the first coupling groove 240 and the second coupling groove 250 communicate with each other. The junction 280 is located at the upper side of the third connecting groove 260 to facilitate the mixing of the substance from the first chamber 210 and the substance from the second chamber 220 before being introduced into the third connecting groove 260.
The cover plate 100 is provided with a first hole 110, a second hole 120, and a third hole 130. The first well 110 and the second well 120 are used to add a composition for RT-RAA amplification and a nucleic acid amplification priming solution to the first chamber 210 and the second chamber 220, respectively. The third well 130 is used for venting, i.e. displaced gas can be vented from the third well 130 when the sample is added to the first well 110 and the strip buffer is added to the second well 120. The cover plate 100 is further provided with a window (not shown) for detecting the detection result of the test strip (for example, observing with naked eyes or extracting images by an image capturing device), so as to facilitate the judgment of the detection result, such as: when the T line and the C line appear, the sample is judged to be positive, that is, the sample contains the target nucleic acid.
The nucleic acid detecting apparatus of the present embodiment can be made into a microfluidic chip. The specific method comprises the following steps:
the chip is designed by software Auto CAD, each layer of chip is cut out of the PMMA plate by a laser cutting machine (as shown in figure 1), and the disposable nucleic acid detection test strip is loaded into the detection cavity and then manufactured into a complete chip in a thermal bonding mode. To prevent capillary action, the bonded chip channels were incubated with fluoro oil and left to stand after overnight fluoro oil evaporation.
In use, the strip buffer is pre-injected into the second chamber 220 through the second well 120. The extracted RNA and the amplification reagent are mixed and injected into the first cavity 210, RT-RAA amplification is performed in the first cavity, and then the detection can be completed by manually adjusting the angle of the chip to control the flow of the solution. FIG. 2 is a schematic diagram of an operation process of nucleic acid detection using the apparatus shown in FIG. 1a, and FIG. 2 is a schematic diagram of an operation process of the apparatus of this embodiment in which a dye is used to simulate a nucleic acid sample.
Example 2
(1) Extracting nucleic acid:
extracting nucleic acid according to a traditional commercialized kit;
(2) sample detection:
200 μ L of the strip buffer system was added to the second chamber 220 of the microfluidic chip.
13.5L of molecular crowding reagent (20 wt% concentration and molecular weight of 35,000 polyethylene glycol), 30 muL of sample RNA and 4 muL of primer pair are sequentially added into a PCR tube, and subjected to palm type low-speed centrifugation for 10 seconds, the liquid is transferred into a detection tube filled with reaction dry powder enzyme preparation, a tube cover is covered, and the mixture is fully mixed by being turned upside down for 7-8 times, and subjected to palm type low-speed centrifugation for 10 seconds.
The solution in the detection tube is added to the first chamber 210 to perform RT-RAA amplification (taking care to avoid bubble generation as much as possible), 2.5. mu.L of an amplification initiator (280nM magnesium acetate) is added, timing is started (the first hole 210 and the second hole 220 are sealed by using an adhesive tape at the same time), the detection plate is inverted, the third chamber 230 is positioned at the upper side (see figure 2a), the third chamber is flicked 5-10 times by using a finger, the third chamber is vertically placed into a 42 ℃ thermostatic equipment, the third chamber is taken out after 6 minutes, kept inverted and vertical, flicked 5-10 times by using a forefinger, and the third chamber is placed into the thermostatic box again to continue amplification. The reaction was completed in 10 minutes.
After the reaction is finished, forcibly throwing 5 times in the direction of an arrow marked at the corner of the bottom end close to the joint on the microfluidic chip at 45 degrees (see fig. 1b), slowly inverting the detection plate again after the samples are mixed, inclining the detection plate until the liquid in the third connecting groove 260 contacts the test strip, observing the result after 5-10 minutes, and judging the test strip to be positive if the T line and the C line are in line color.
Example 3
This example demonstrates the feasibility of a highly integrated microfluidic chip for amplification and detection of COVID-19 virus, which was constructed in example 2. The method comprises the following steps:
extracting nucleic acid by thermal cracking to obtain 0, 10 per microliter0、101、102、103、104、105Copy number of sample RNA. The procedure for RT-RAA amplification and detection of the amplification product was the same as in step (2) of example 2. The results are shown in fig. 3, and the sample containing the N gene and the test strip both show two clear bands, which indicates that the method in example 1 of the present invention is feasible.
Example 4
This example demonstrates the specificity of a highly integrated microfluidic chip for amplification and detection of COVID-19 virus, which was built in example 2. The method comprises the following steps:
the N, ORF1ab and E, S genes of the COVID-19 virus were amplified and detected according to the step (2) of example 2, while a blank control group was set. As shown in FIG. 4, only the N gene amplified the target band, and the other genes amplified specifically as the blank control, indicating that the method has strong specificity.
Example 5
This example demonstrates the sensitivity of the method for detecting COVID-19 established in example 2. The method comprises the following steps:
nucleic acid was extracted by the method of step (1) of example 2 to obtain 0, 10 per microliter0、101、102、103、104、105Copy number of sample RNA. The RT-RAA amplification and detection of the amplification products were performed as in example 2. The results are shown in FIG. 5, where the primer pairs used in this example had high sensitivity, down to 1 RNA copy per microliter.
Example 6
This example performs actual sample validation of the method for detecting COVID-19 established in example 2. The method comprises the following steps:
the nucleic acid of the neocoronal patient was extracted by the method of step (1) of example 2 to obtain actual sample RNA. The RT-RAA amplification and RT-RAA amplification products were detected in the same manner as in example 2. As a result, the detection sensitivity of the method was 95% and the detection specificity was 100%, as shown in Table 1.
TABLE 1
Sequence listing
<110> university of mansion
HUAQIAO University
<120> nucleic acid detection method and device and application in COVID-19 detection
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gcaacagttc aagaaattca actccaggca gc 32
<210>2
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
tagtgacagt ttggccttgt tgttgttggc ct 32
Claims (18)
1. An apparatus for detecting nucleic acid, comprising a detection panel, wherein said detection panel comprises:
a first lumen for RT-RAA amplification;
a second chamber containing a buffer solution therein;
a third chamber, wherein the test strip is placed in the third chamber;
the first connecting groove is communicated with the first cavity;
a second connecting groove communicated with the second cavity;
and the third connecting groove is respectively communicated with the first connecting groove, the second connecting groove and the third cavity and provides support for the first cavity, the second cavity, the third cavity, the first connecting groove, the second connecting groove and the third connecting groove.
2. The apparatus as claimed in claim 1, wherein said third connecting groove is provided at a bottom end of said detection plate, and said first connecting groove and said second connecting groove are provided at an upper side of said third connecting groove.
3. The apparatus of claim 1 wherein said first connecting groove and said second connecting groove meet to allow said first connecting groove and said second connecting groove to communicate, said meeting being located above said third connecting groove.
4. The apparatus of claim 1, further comprising a base plate disposed below said detection plate.
5. The device of claim 1, further comprising a cover plate overlying said detection plate and comprising a first well, a second well and a third well, said first well and said second well for adding a composition for RT-RAA amplification and a strip buffer to said first chamber and said second chamber respectively, and said third well for venting air.
6. The device of claim 1, wherein the test strip has a conjugate pad on which a gold-conjugated anti-FAM antibody is immobilized, a streptavidin-labeled antibody is immobilized on the T-line, and a fluorescein-labeled anti-antibody is immobilized on the C-line.
7. The device of claim 1, wherein said detection panel is microfluidic.
8. Use of the device of claim 1 in the manufacture of a COVID-19 nucleic acid detection kit.
9. A method for detecting a nucleic acid, comprising the following amplification steps:
adding a test strip buffer to a second chamber of the detection plate, an
Adding a mixture of a molecular crowding reagent, a sample nucleic acid, a primer pair and a reaction dry powder enzyme reagent into a first cavity of a detection plate;
then, adding a nucleic acid amplification initiator into the first cavity;
and then, reversing the detection plate to enable the third connecting groove at the bottom end to be positioned at the upper side, oscillating the substance in the first cavity, standing in constant temperature equipment at 37-42 ℃, taking out after 3-7 minutes, oscillating the substance in the first cavity again, standing in constant temperature equipment at 37-42 ℃ again for continuous amplification, taking out after 9-13 minutes, and finishing the reaction.
10. The method of claim 9, wherein the primer pair is as follows:
upstream primer with 5' end labeled with fluorophore: gcaacagttcaagaaattcaactccaggcagc and
downstream primer of 5' end labeled Biotin: tagtgacagtttggccttgttgttgttggcct are provided.
11. The method of claim 10, wherein said fluorophore is FAM.
12. A kit characterized by comprising the device of claim 1.
13. The kit according to claim 12, characterized by further comprising the following primer pairs:
upstream primer with 5' end labeled with fluorophore: gcaacagttcaagaaattcaactccaggcagc and
downstream primer of 5' end labeled Biotin: tagtgacagtttggccttgttgttgttggcct are provided.
14. The kit of claim 13, wherein said fluorophore is FAM.
15. The kit of claim 12, further comprising molecular crowding reagents, nucleic acid amplification promoters, and reaction dry powder enzyme reagents.
16. The kit of claim 12, further comprising instructions describing the following amplification steps:
and (3) blending the molecular crowding reagent, the nucleic acid amplification starter, the reaction dry powder enzyme preparation and the amplification primer pair, putting the mixture into a 37-42 ℃ incubator, and after amplification is carried out for 10-20 minutes, finishing the reaction.
17. The kit of claim 12, further comprising instructions describing the following amplification steps:
and (3) blending the molecular crowding reagent, the nucleic acid amplification starter, the reaction dry powder enzyme preparation and the amplification primer pair, putting the mixture into constant temperature equipment at 37-42 ℃, taking out the mixture after 3-7 minutes, oscillating the substance in the first cavity again, standing the mixture in the constant temperature equipment at 37-42 ℃ again for continuous amplification, taking out the mixture after 9-13 minutes, and finishing the reaction.
18. The kit of claim 12, further comprising instructions describing thereon:
applying an acting force to the detection plate to mix the substance in the first cavity with the test strip buffer solution in the second cavity, and inverting the detection plate again to enable the third connecting groove to recover and be positioned at the bottom end of the detection plate, and enabling the substance in the third connecting groove to move towards the third cavity and contact the test strip;
finally, observing for 5-10 minutes and judging the result;
and when the T line and the C line on the test strip are developed, judging the test strip to be positive.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010578157.8A CN111733288B (en) | 2020-06-22 | 2020-06-22 | Nucleic acid detection method and device and application in COVID-19 detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010578157.8A CN111733288B (en) | 2020-06-22 | 2020-06-22 | Nucleic acid detection method and device and application in COVID-19 detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111733288A true CN111733288A (en) | 2020-10-02 |
| CN111733288B CN111733288B (en) | 2022-09-30 |
Family
ID=72650534
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010578157.8A Active CN111733288B (en) | 2020-06-22 | 2020-06-22 | Nucleic acid detection method and device and application in COVID-19 detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111733288B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112779355A (en) * | 2021-01-06 | 2021-05-11 | 常州市疾病预防控制中心 | Self-heating amplification detection device and preparation method and use method thereof |
| CN115011454A (en) * | 2022-06-23 | 2022-09-06 | 浙江大学 | Nucleic acid detection device and method |
| CN115011454B (en) * | 2022-06-23 | 2024-05-17 | 浙江大学 | Nucleic acid detection device and method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104862216A (en) * | 2014-02-21 | 2015-08-26 | 宁波大学 | High-throughput visual totally-enclosed split-type LAMP-LFD detection chip device |
| CN105018341A (en) * | 2015-07-06 | 2015-11-04 | 西安交通大学 | Paper-based nucleic acid amplification and detection integrated detection device and detection method |
| CN105039149A (en) * | 2015-07-20 | 2015-11-11 | 宁波大学 | Closed experiment system device for quickly identifying nucleic acid amplification products and application of closed experiment system device |
| CN105273997A (en) * | 2015-10-21 | 2016-01-27 | 西安交通大学 | Paper-based nucleic acid extraction, amplification and detection integrated detection system and paper-based nucleic acid extraction, amplification and detection integrated detection method |
| CN106967790A (en) * | 2017-02-20 | 2017-07-21 | 浙江大学 | A kind of detection method of nucleic acid amplification |
| CN111074007A (en) * | 2020-02-15 | 2020-04-28 | 上海迪飞医学检验实验室有限公司 | Isothermal amplification kit and primer probe set for detecting SARS-COV-2 virus |
-
2020
- 2020-06-22 CN CN202010578157.8A patent/CN111733288B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104862216A (en) * | 2014-02-21 | 2015-08-26 | 宁波大学 | High-throughput visual totally-enclosed split-type LAMP-LFD detection chip device |
| CN105018341A (en) * | 2015-07-06 | 2015-11-04 | 西安交通大学 | Paper-based nucleic acid amplification and detection integrated detection device and detection method |
| CN105039149A (en) * | 2015-07-20 | 2015-11-11 | 宁波大学 | Closed experiment system device for quickly identifying nucleic acid amplification products and application of closed experiment system device |
| CN105273997A (en) * | 2015-10-21 | 2016-01-27 | 西安交通大学 | Paper-based nucleic acid extraction, amplification and detection integrated detection system and paper-based nucleic acid extraction, amplification and detection integrated detection method |
| CN106967790A (en) * | 2017-02-20 | 2017-07-21 | 浙江大学 | A kind of detection method of nucleic acid amplification |
| CN111074007A (en) * | 2020-02-15 | 2020-04-28 | 上海迪飞医学检验实验室有限公司 | Isothermal amplification kit and primer probe set for detecting SARS-COV-2 virus |
Non-Patent Citations (3)
| Title |
|---|
| NEHA UPADHYAY等: "Lateral flow assay for rapid detection of Staphylococcus aureus enterotoxin A in milk", 《MICROCHEMICAL JOURNAL》 * |
| SHULU ZHANG等: "Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP(®) using reverse transcription-recombinase polymerase amplification", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| YANG YANG等: "Development of real-time and lateral flow strip reverse transcription recombinase polymerase Amplification assays for rapid detection of peste des petits ruminants virus", 《VIROLOGY JOURNAL》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112779355A (en) * | 2021-01-06 | 2021-05-11 | 常州市疾病预防控制中心 | Self-heating amplification detection device and preparation method and use method thereof |
| CN115011454A (en) * | 2022-06-23 | 2022-09-06 | 浙江大学 | Nucleic acid detection device and method |
| CN115011454B (en) * | 2022-06-23 | 2024-05-17 | 浙江大学 | Nucleic acid detection device and method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111733288B (en) | 2022-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tang et al. | Improved sensitivity of lateral flow assay using paper-based sample concentration technique | |
| KR102592388B1 (en) | A single platform for biomarker enrichment and signal amplification for use in paper-based immunoassays, and for extraction, concentration and amplification of DNA. | |
| KR101523754B1 (en) | Hydrogen peroxide droplet-based assays | |
| US20180036727A1 (en) | Apparatuses and methods for pathogen detection using microfluidic biochips | |
| US20170173578A1 (en) | Microfluidic devices for the rapid detection of analytes | |
| JP2017514686A (en) | Multi-index detection microfluidic chip and method of use | |
| WO2003050537A1 (en) | Diagnostic testing process | |
| CN101526520B (en) | Method and device for biological sample detection | |
| JP2010506583A (en) | Nucleic acid amplification and detection device | |
| JPH07504498A (en) | Assays with improved dose-response curves | |
| JPWO2005090972A1 (en) | Biological substance analysis kit, analysis device, and analysis method | |
| CN107429209B (en) | Target analysis chip and target analysis method | |
| US20220137040A1 (en) | Method of Detecting the Presence of an Analyte in a Sample | |
| CN113528625A (en) | Microfluidic nucleic acid detection method and application | |
| Feng et al. | From interface to solution: integrating immunoassay with netlike rolling circle amplification for ultrasensitive detection of tumor biomarker | |
| CN111733288B (en) | Nucleic acid detection method and device and application in COVID-19 detection | |
| Bu et al. | A low-cost, programmable, and multi-functional droplet printing system for low copy number SARS-CoV-2 digital PCR determination | |
| CN114107019B (en) | Microfluidic chip for simultaneously detecting nucleic acid and protein, detection method and application | |
| US20130130243A1 (en) | Method and device for detecting and quantifying an analyte with recycling of the reagents | |
| CN111197110A (en) | RPA-FLD method for detecting feline panleukopenia virus | |
| CN113786869A (en) | Detection chip, equipment and method | |
| TWI295730B (en) | Microfluidic chip for sample assay and method thereof | |
| KR102129937B1 (en) | Paper-based detecting kit for nucleic acid and detecting method thereof | |
| WO2014078775A1 (en) | Multiplexed bioassay techniques | |
| JPH0373854A (en) | Apparatus and method for film strip flow- through diagnosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |