CN111733262A

CN111733262A - Nucleic acid composition for detecting exogenous gene integration condition and method thereof

Info

Publication number: CN111733262A
Application number: CN202010822868.5A
Authority: CN
Inventors: 林梓凡
Original assignee: Gempharmatech Co ltd
Current assignee: Gempharmatech Co ltd
Priority date: 2020-08-17
Filing date: 2020-08-17
Publication date: 2020-10-02
Also published as: WO2022036803A1

Abstract

The invention discloses a nucleic acid composition for detecting exogenous gene integration condition and a method thereof, relating to the technical field of genetic engineering. The nucleic acid composition comprises a forward primer and/or a reverse primer for detecting whether the exogenous gene inserted into the H11 site or the Rosa26 site is subjected to tandem integration; the complementary combination area A of the forward primer and the homologous arm on the exogenous gene carrier is close to the 3' end of the homologous arm sequence; the complementary binding region B of the reverse primer to the homology arm is near the 5' end of the sequence of the homology arm. The method replaces Southern blot detection with PCR detection, screens the transgenic cells or animal models, can quickly and effectively detect the integration condition of exogenous genes, greatly shortens the experimental period, reduces the experimental cost, and provides a quick and effective way for the preparation of transgenic cells or animal models.

Description

Nucleic acid composition for detecting exogenous gene integration condition and method thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a nucleic acid composition for detecting integration condition of exogenous genes and a method thereof.

Background

For many years, the gene integration status of transgenic cells and transgenic animal models is usually tested by using a double-arm PCR plus sequencing method to verify the correctness of the models. The double-arm PCR method is to select primers outside the homologous arms and internal primers to perform PCR on genomic DNA in transgenic cells, and specifically refer to FIG. 1. In FIG. 1, F1 and R2 are primers outside the homologous arms, and the expected band can be amplified by double-arm PCR only when the primers are correctly inserted into the target site, so that the size of the PCR product can be confirmed to be correct by electrophoresis, and the PCR product can be sequenced to confirm that the recombination sequence is consistent with the theoretical sequence.

However, the method using double-arm PCR has some drawbacks, such as that it cannot identify whether random insertion and tandem recombination occur in the genome. Referring to FIG. 2, when the gene targeting vector fragments form a head-to-tail tandem structure and are recombined to the target site, the size of the PCR product and the sequencing result both match the theoretical value, so the double-arm PCR identification cannot exclude tandem recombination.

Random insertion of a gene targeting vector (Donor) may also affect the function of an unknown gene, thereby causing certain influence on transgenic cells or animal models, and the occurrence probability of tandem recombination is very high, and especially needs to be considered. In order to solve the technical problem, researchers found that the cases of random insertion and tandem recombination can be eliminated by double verification of double-arm PCR and Southern blot, please refer to fig. 3.

FIG. 3 is a schematic diagram of Southern blot (Southern blot hybridization) for identifying single copy insertions. If random insertion occurs, after the amplification product is subjected to enzyme digestion by adopting endonuclease, a DNA fragment with a size inconsistent with that of a target fragment is cut out, and then probe hybridization is carried out to verify whether random insertion and tandem insertion exist.

However, Southern blots used to detect random insertions and tandem integration also have a number of drawbacks, such as: the gene targeting vector fragment cannot be used for designing a probe; the complex gene targeting vector results in that an enzyme digestion scheme cannot be designed; many restriction endonucleases are seriously affected by methylation, and cannot finish enzyme digestion to cause false detection and the like. In the process of preparing the transgenic mouse model, in order to avoid mouse death, the tissue extraction can be carried out on a mouse at 5-7 weeks old, the time of 10-14 days is needed for the Southern blot experiment, and after the experiment result is finished, the sexual maturity and the week age of the mouse are exceeded, so that delayed mating and reproduction are caused; affecting the experimental progress. In addition, Southern blot is also costly and not conducive to the efficient detection of exogenous gene integration status in transgenic cells or animal models.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a nucleic acid composition for detecting integration status of exogenous genes and a method thereof.

The invention is realized by the following steps:

in a first aspect, embodiments provide a nucleic acid composition for detecting integration status of an exogenous gene and a method thereof, which includes a first nucleic acid composition for detecting whether multiple copies of the exogenous gene are connected in tandem;

the first nucleic acid composition comprises a forward primer and/or a reverse primer; the complementary binding region A of the forward primer and the homologous arm on the exogenous gene vector is close to the 3' end of the sequence of the homologous arm; the complementary binding region B of the reverse primer and the homologous arm is close to the 5' end of the homologous arm sequence;

wherein the exogenous gene vector is a vector for inserting an exogenous gene into a site H11 or a site Rosa26 in a homologous recombination mode.

In a second aspect, embodiments provide a method for detecting the integration status of an exogenous gene, comprising: the nucleic acid sample is tested using the nucleic acid composition for detecting the integration status of an exogenous gene as described in the previous examples.

In a third aspect, embodiments provide a kit for detecting integration status of an exogenous gene, which includes the nucleic acid composition for detecting integration status of an exogenous gene as described in the previous embodiments.

In a fourth aspect, embodiments provide a method for constructing a transgenic cell or transgenic model, comprising: the nucleic acid sample of the transgenic cells or animal model is tested using the nucleic acid composition for detecting integration status of exogenous gene as described in the previous examples, or the transgenic cells or animal model is screened using the method for detecting integration status of exogenous gene as described in the previous examples.

The invention has the following beneficial effects:

the embodiment of the invention provides a nucleic acid composition for detecting the integration condition of an exogenous gene and a method thereof, wherein the nucleic acid composition comprises a first nucleic acid composition for detecting whether the exogenous gene is subjected to tandem integration, and the first nucleic acid composition comprises a forward primer and/or a reverse primer; the complementary combination area A of the forward primer and the homologous arm on the exogenous gene carrier is close to the 3' end of the homologous arm sequence; the complementary binding region B of the reverse primer to the homology arm is near the 5' end of the sequence of the homology arm. Wherein the exogenous gene vector is a vector for inserting an exogenous gene into a site H11 or a site Rosa26 in a homologous recombination mode. According to the method, the specific nucleic acid composition is used for screening the transgenic cells or the animal model by replacing a Southern blot detection mode with a PCR mode, so that the technical problem that the integration condition of the exogenous gene cannot be accurately detected in the prior art is solved, the experimental period is greatly shortened, the experimental cost is reduced, and a quick and effective way is provided for the preparation of the transgenic cells or the animal model.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a diagram of a two-arm PCR in the background art; wherein, the Primer is a Primer; homologyarm is a homology arm; 5 'arm is a 5' end homology arm; 3 'arm is a 3' end homology arm; the first and the second are PCR reaction numbers; KI fragment is an inserted exogenous gene;

FIG. 2 is a diagram illustrating a dual-arm PCR method for identifying multiple copies of a tandem;

FIG. 3 is a diagram of a Southern blot used in the background art to identify single copy insertions of a transgene; wherein, Probe is a Probe; enzyme-digested product as Enzyme digestion fragment; BamHI and SacI as enzyme cutting sites

FIG. 4 is a schematic diagram of PCR detection of multiple copies of tandem forward and reverse primer pairs in the same orientation according to an embodiment;

FIG. 5 is a schematic diagram of the PCR detection of multiple copies of the forward primer pair in reverse tandem in one embodiment;

FIG. 6 is a diagram illustrating qPCR detection of single copy insertions by a second nucleic acid composition, in accordance with certain embodiments;

FIG. 7 shows the results of double-arm PCR detection of an H11 site inserted foreign gene in a transgenic mouse and tandem PCR detection of a first nucleic acid composition in validation example 1;

FIG. 8 shows the results of the double-arm PCR and the tandem assay in verification example 2;

FIG. 9 shows the result of detecting Southern blot in validation example 2;

FIG. 10 shows the results of the double-arm PCR and the tandem assay in the validation example 3;

FIG. 11 shows the result of detecting Southern blot in validation example 3;

FIG. 12 shows the results of the double-arm PCR and the tandem assay in the validation example 4;

FIG. 13 shows the Southern blot analysis of the restriction products of NheI and HindIII in PREPARATIVE EXAMPLE 4.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

Noun definitions

A "transgenic cell or animal model" herein is a nucleic acid sequence introduced into an animal model or cell by gene editing techniques, which is partially or completely heterologous (i.e., foreign) to the animal or cell into which it is introduced, or homologous to a gene endogenous to the transgenic animal or cell into which it is introduced, such that the genome of the cell into which it is inserted is altered.

The term "foreign gene" as used herein refers to a DNA molecule inserted into a transgenic cell or animal model, which is a target gene or gene of interest for insertion into a transgenic cell or animal model in transgenic technology.

The "homology arm" herein refers to a flanking sequence on both sides of a foreign gene sequence to be inserted on a foreign gene vector (targeting vector, donor) which is identical to a genome insertion site sequence, for identifying and recombining regions. The "5 'end homology arm" refers to a homology region located at the 5' end of the foreign gene on the foreign gene vector, and the "3 'end homology arm" refers to a homology region located at the 3' end of the foreign gene on the foreign gene vector.

"copy" herein is copy, generally referring to the replication of DNA, "multicopy" refers to 2 copies and above; "multicopy tandem" refers to the insertion of a foreign gene, 2 or more copies of the foreign gene are integrated into the genome of the cell together in tandem.

As used herein, a "forward primer" refers to a primer that is located upstream of a target sequence, also referred to as an upstream primer.

The term "reverse primer" as used herein refers to a primer located downstream of the target sequence, also referred to as a downstream primer.

Detailed description of the preferred embodiments

First, an embodiment of the present invention provides a nucleic acid composition for detecting integration status of an exogenous gene, comprising: a first nucleic acid composition for detecting whether or not multiple copies of a foreign gene are tandemly ligated;

The inventor finds that when the first nucleic acid composition is used for carrying out PCR detection on a nucleic acid sample (such as a genome of a transgenic cell or an animal model), whether the exogenous gene inserted into the H11 site or the Rosa26 site is integrated in tandem can be quickly and effectively detected. The technology of site-specific insertion of exogenous genes by homologous recombination is prior art, and the preparation process can be obtained by the existing literature, and is not described in detail herein. It should be emphasized that, while the above-mentioned "close" is relative, referring to fig. 4, the binding region a of F1 can also be selected from the region close to the 5 'end of the homology arm sequence as long as the condition that it is closer to the 3' end of the homology arm sequence than to R1 is satisfied, and similarly, the binding region B of R1 can also be selected from the region close to the 3 'end of the homology arm sequence as long as the condition that it is closer to the 5' end of the homology arm sequence than to F1 is satisfied.

The judgment mode of the series connection is as follows: when there is a multicopy tandem integration in the same direction, referring to FIG. 4, a certain size of PCR product will exist when PCR amplification is performed using a primer pair consisting of forward primer F1 and reverse primer R1. And when reverse multi-copy tandem integration exists, referring to fig. 5, fig. 5 shows a case of performing single-primer PCR amplification by using a forward primer, single-primer PCR amplification can be performed by using either the forward primer or the reverse primer (when the forward primer or the reverse primer has the same-direction tandem, the forward primer or the reverse primer can be simultaneously used as an upstream primer and a downstream primer of a PCR detection system to perform PCR amplification), and a PCR product with a certain size is obtained. If the forward primer, the reverse primer or the primer pair consisting of the forward primer and the reaction primer can not be used for PCR amplification, namely, if no amplification product exists, the tandem recombination can be judged not to occur.

When the insertion site is H11 site, the base sequence of the forward primer is shown as SEQ ID No. 1; the base sequence of the reverse primer is shown as SEQ ID No. 2;

when the insertion site is a Rosa26 site, the base sequence of the forward primer is shown as SEQ ID No. 9; the base sequence of the reverse primer is shown as SEQ ID No. 10.

In some embodiments, the nucleic acid composition further comprises a second nucleic acid composition for detecting whether the exogenous gene is a single copy insertion;

the second nucleic acid composition comprises a primer pair and/or a probe; wherein the complementary binding region of the upstream primer and the homologous arm of the primer pair is close to the 5 'end of the sequence of the homologous arm, and the complementary binding region of the downstream primer and the homologous arm of the primer pair is close to the 3' end of the sequence of the homologous arm.

The second nucleic acid composition is used for carrying out qPCR amplification (such as a TaqMan probe method or a non-specific fluorescent labeling method SYBR GreenI dye method) on a nucleic acid sample, detecting in a quantitative mode, taking a wild type with the same sex as a background as a reference, using a beta-Actin gene primer as an internal reference, calibrating the quality of a DNA template, detecting a fluorescence value (CT value) according to the primer, and judging single copy insertion when the qPCR amplification result of the nucleic acid sample is consistent with the qPCR amplification result of the corresponding wild type through standard curve operation; if the two are not consistent, the random insertion or the multi-copy series connection is judged to occur, and compared with the traditional southern blot, the method has the advantages of lower detection cost and more accurate effect. With particular reference to figure 6.

FIG. 6 is a view showing a case where the second nucleic acid composition comprises 2 primer pairs, and in FIG. 6, F1 and R1 are used for detecting the 5 'homology arm of the foreign gene vector, and F2 and R2 are used for detecting the 3' homology arm of the foreign gene vector, and binding was verified by 2 PCR reactions. The number of primer pairs in the second nucleic acid composition is not limited, and in other embodiments, 1, 3, or 4 primer pairs may be used.

In some embodiments, the methods of detecting the first nucleic acid composition and the second nucleic acid composition are: whether the situation of multi-copy tandem connection occurs can be judged by a PCR mode according to the first nucleic acid composition, after the situation of tandem connection is eliminated, the integration situation of the exogenous gene can be further determined by carrying out qPCR quantitative detection on the second nucleic acid composition, compared with a detection mode of double-arm PCR + Southern blot, the detection method has the advantage of rapider detection, and the combination use of the first nucleic acid composition and the second nucleic acid composition can detect the condition of Southern blot error detection, so that the detection method has extremely high accuracy and effectiveness. Meanwhile, the experimental cost is reduced, and the preparation efficiency of the transgenic cells or the animal model is remarkably improved.

Preferably, in the second nucleic acid composition, the primer pair comprises primer pair 1 for detecting the 5 'homology arm and/or primer pair 2 for detecting the 3' homology arm.

Preferably, when the insertion site of the foreign gene is H11 site, the sequence of the 5' end homology arm is shown in SEQ ID No. 3: TGACAGAAGGCTGTTAAATCGAATGAACCTACATGGTTCAAATACAAGGGATACAAGATTGTCAGTCCTGGAAGTCTTTCTTTTATAAAATATGTGAATGAAGTGTTGGTGTCTTCTAGAGGTGACACCTAAGGGTTCTGAAAAAATAAAATGTATAGACCCTTATGTACAGACCTGTGTATAAACTTTTGTACATACAAATAGGGTAGCTTTTTTTGAACTTATACATACAGCTGTACATAAAGTAACTATCAGTTAGGCTTGTGTCAACTGTTTGGATTTTTTTCACTTGAATATTTGGGACTTTTTCTTTTGGTTTATTAAAAGTTACATATGCCACGTGTGTGAACGATATGGCTGGTACTGTGTTTATTTCTTCCATGAACTAAGACAGTCTAAATGAGTTCCTTTCACGTTTTAATTTTACCTTAGGACTTCTGGAATTTCTTCTGCACATAAAGTTCTGATAGCATTAGTTTAAGCTGGACTAACCCTGAAAGTAGCTTGTGGCAAGTATCAAGGAATCAATATTATACTCTACAAAATCAAAGTTTACAGAGAAGTCATATAGTAATTTTTCTGAAATTTACTGGCACAATGTTAATCCAGCCTGACTCCAACTAATTAATGGTCACATTAATTTAAGTCTTTCCCTTGCCTCTGCTGCATTAGTTTCTCTCAAAATTGTTAACTTACAACTTGAAGTCTGGTATTATAAATTGAATGTAAAGCATTCTGAAAGATACTATACTGATTGCAGGTTTTTCAGTCAGGTTCAAGCTAATTTGACCAGTCATTGGATTAATTATGGATCTGGGGCCATAAATGCTATTTTAATTCCACTATAGAGATTAAAATAAGCCATTCTCCATTTCATAATATTCTATTGGACTTTGACTGCAGGGGCCTCCAAGTCTTGACAGTAGATTATAATCCTTCAGCTGCCCACTCTACTGGAGGAGGACAAACTGGTCACTTTTCAGCAAAACCTGGCTGTGGATCAGGGCAGTCTGGTACTTCCAAGCTCATTAGATGCCATCATGCTCTCACTGCCTCCTCAGCTTCAAGAGGAATCTGGAAAAAGCAGTCCCACTGGTCAGGAAAGGAACACTAGTGCACTTATCCTGGGTGTCTGCTGAG are provided.

The sequence of the 3' end homology arm is shown as SEQ ID No. 4: GTAAGGGCAGGATGTGTCAAACTGCCAATAGAGAACTACTTACTCTTCAGGCTGAAGCTGATGGAACAGGTAACAAAGGCAAACACTAATCATGATCAGCAAGATGAAGCAGAAAGGGAACAAGGGGATATTAAATGTGTATAGACACGCTAGAGAGATGGCTCAGCAGTTAAGAGAACTAGCTGGTCTTTCAGAGGTCCTGAGATCAATTTTAGACACCCACATGGTGGCTCATGACCATCTATCTATAAATGGATCTGATTTTCATGTCTGGCAGTGTACAGAAGCTAACTGAAGAAAGGTGGAAGACCCACAAGAGTTCAAGATAAGCCCTATATAGTGAAGTTCAAGGCAAGCTTTTTCTACCTGAAACTTAGTCTCAAAAAAAAATGAATACGTAAACAGTCTTCCAGGGGATAAGAACCTTACAGAAAAAGCAGAAATGCCTGGGGCACTGGATTACCGATGTAATCAAATTCAGTCCTTGAATTGAACACAGGATTGCCTAGAGCAAGGCCAGCCAGAGATTCATCTCAGAGGGAGAAAGGTGTCTTTGGAGCAATTTTGTGGTAATCTAGTATGTATCACATAAGTTTAGACGCATTTGGGACTGGAAAGATGTGAACAAAGCACCCTATGGCTCACATCTGTCATTAACTCTAGTTCCAGTGCACCTGACACCGTCTTCTGGCCTCTGCAGTGACCAAGCACATGGGTAGTATGTAGACATATACATAAGCAAAACACACATCATTAAAAAGTGACATTTCCCAAAGGAAGCTGAAGAACCAGTTCTTGAGAAGATAGTAGAAATCAGAAGGGGAAATAGTAGACATACAGAGGGACTGACCAGGTTGTGTCACCTTTATAGGCTAGGCTAATGGATGATCGACACTAGCGCTCTTTGTGAAGGACACACAAATGAGACATAGTTTATAGGACTAAACACACTTCTAAGCAATTTAATGAGACTTAAGACCCTGTCTCTAGCAAATACTCTGGATGATATTCAGCTCAAGGCTCTTGTCAGACATGTTTCCATTTTCAAGGTGAGCTA are provided.

The sequence of the primer pair 1 is shown as SEQ ID No. 5-6; the sequence of the primer pair 2 is shown as SEQ ID No. 7-8.

When the insertion site of the exogenous gene is a Rosa26 site, the sequence of the 5' end homology arm is shown as SEQ ID No. 11: TTGGCCGGTGCGCCGCCAATCAGCGGAGGCTGCCGGGGCCGCCTAAAGAAGAGGCTGTGCTTTGGGGCTCCGGCTCCTCAGAGAGCCTCGGCTAGGTAGGGGATCGGGACTCTGGCGGGAGGGCGGCTTGGTGCGTTTGCGGGGATGGGCGGCCGCGGCAGGCCCTCCGAGCGTGGTGGAGCCGTTCTGTGAGACAGCCGGGTACGAGTCGTGACGCTGGAAGGGGCAAGCGGGTGGTGGGCAGGAATGCGGTCCGCCCTGCAGCAACCGGAGGGGGAGGGAGAAGGGAGCGGAAAAGTCTCCACCGGACGCGGCCATGGCTCGGGGGGGGGGGGGCAGCGGAGGAGCGCTTCCGGCCGACGTCTCGTCGCTGATTGGCTTCTTTTCCTCCCGCCGTGTGTGAAAACACAAATGGCGTGTTTTGGTTGGCGTAAGGCGCCTGTCAGTTAACGGCAGCCGGAGTGCGCAGCCGCCGGCAGCCTCGCTCTGCCCACTGGGTGGGGCGGGAGGTAGGTGGGGTGAGGCGAGCTGGACGTGCGGGCGCGGTCGGCCTCTGGCGGGGCGGGGGAGGGGAGGGAGGGTCAGCGAAAGTAGCTCGCGCGCGAGCGGCCGCCCACCCTCCCCTTCCTCTGGGGGAGTCGTTTTACCCGCCGCCGGCCGGGCCTCGTCGTCTGATTGGCTCTCGGGGCCCAGAAAACTGGCCCTTGCCATTGGCTCGTGTTCGTGCAAGTTGAGTCCATCCGCCGGCCAGCGGGGGCGGCGAGGAGGCGCTCCCAGGTTCCGGCCCTCCCCTCGGCCCCGCGCCGCAGAGTCTGGCCGCGCGCCCCTGCGCAACGTGGCAGGAAGCGCGCGCTGGGGGCGGGGACGGGCAGTAGGGCTGAGCGGCTGCGGGGCGGGTGCAAGCACGTTTCCGACTTGAGTTGCCTCAAGAGGGGCGTGCTGAGCCAGACCTCCATCGCGCACTCCGGGGAGTGGAGGGAAGGAGCGAGGGCTCAGTTGGGCTGTTTTGGAGGCAGGAAGCACTTGCTCTCCCAAAGTCGCTCTGAGTTGTTATCAGTAAGGGAGCTGCAGTGGAGTAGGCGGGGAGAAGGCCGCACCCTTCTCCGGAGGGGGGAGGGGAGTGTTGCAATACCTTTCTGGGAGTTCTCTGCTGCCTCCTGGCTTCTGAGGACCGCCCTGGGCCTGGGAGAATCCCTTCCCCCTCTTCCCTCGTGATCTGCAACTCCAGTCTTT are provided.

The sequence of the 3' end homology arm is shown as SEQ ID No. 12: TGTGTGGGCGTTGTCCTGCAGGGGAATTGAACAGGTGTAAAATTGGAGGGACAAGACTTCCCACAGATTTTCGGTTTTGTCGGGAAGTTTTTTAATAGGGGCAAATAAGGAAAATGGGAGGATAGGTAGTCATCTGGGGTTTTATGCAGCAAAACTACAGGTTATTATTGCTTGTGATCCGCCTCGGAGTATTTTCCATCGAGGTAGATTAAAGACATGCTCACCCGAGTTTTATACTCTCCTGCTTGAGATCCTTACTACAGTATGAAATTACAGTGTCGCGAGTTAGACTATGTAAGCAGAATTTTAATCATTTTTAAAGAGCCCAGTACTTCATATCCATTTCTCCCGCTCCTTCTGCAGCCTTATCAAAAGGTATTTTAGAACACTCATTTTAGCCCCATTTTCATTTATTATACTGGCTTATCCAACCCCTAGACAGAGCATTGGCATTTTCCCTTTCCTGATCTTAGAAGTCTGATGACTCATGAAACCAGACAGATTAGTTACATACACCACAAATCGAGGCTGTAGCTGGGGCCTCAACACTGCAGTTCTTTTATAACTCCTTAGTACACTTTTTGTTGATCCTTTGCCTTGATCCTTAATTTTCAGTGTCTATCACCTCTCCCGTCAGGTGGTGTTCCACATTTGGGCCTATTCTCAGTCCAGGGAGTTTTACAACAATAGATGTATTGAGAATCCAACCTAAAGCTTAACTTTCCACTCCCATGAATGCCTCTCTCCTTTTTCTCCATTTATAAACTGAGCTATTAACCATTAATGGTTTCCAGGTGGATGTCTCCTCCCCCAATATTACCTGATGTATCTTACATATTGCCAGGCTGATATTTTAAGACATTAAAAGGTATATTTCATTATTGAGCCACATGGTATTGATTACTGCTTACTAAAATTTTGTCATTGTACACATCTGTAAAAGGTGGTTCCTTTTGGAATGCAAAGTTCAGGTGTTTGTTGTCTTTCCTGACCTAAGGTCTTGTGAGCTTGTATTTTTTCTATTTAAGCAGTGCTTTCTCTTGGACTGGCTTGACTCATGGCATTCTACACGTTATTGCTGGTCTAAATGTGAT are provided.

The sequence of the primer pair 1 is shown as SEQ ID No. 13-14; the sequence of the primer pair 2 is shown as SEQ ID No. 15-16.

The embodiment of the present invention also provides a method for detecting the integration status of an exogenous gene, which comprises detecting a nucleic acid sample by using the nucleic acid composition for detecting the integration status of an exogenous gene according to any one of the previous embodiments.

Preferably, the nucleic acid sample is extracted from a transgenic cell or a transgenic animal model. The nucleic acid sample is extracted from a transgenic cell or a transgenic animal model in which a foreign gene is inserted in a homologous recombination mode.

Preferably, the transgenic cell comprises an animal cell and/or a plant cell, and the transgenic animal model is selected from mammals.

Preferably, the transgenic animal model is selected from any one of mouse, cattle, sheep, chicken, pig, fish, rabbit and drosophila.

In some embodiments, when a first one of the nucleic acid compositions comprises a forward primer and a reverse primer, the method comprises performing PCR detection on the nucleic acid sample using the forward primer and the reverse primer. In some embodiments, forward primer amplification and reverse primer amplification can be used separately, and the forward/reverse primer pair can be used for common PCR. Single primer amplification of the forward or reaction primers, amplification of the primer pair consisting of forward/reverse primers can be performed in the same PCR reaction. The first nucleic acid composition is tested to exclude the situation of having multi-copy tandem, so as to screen out transgenic cells or animal models without multi-copy tandem integration, and the tandem determination method is the same as that of any of the aforementioned embodiments, and is not repeated herein.

Preferably, when the nucleic acid composition comprises the second nucleic acid composition, the method comprises: and carrying out qPCR detection on the nucleic acid sample of the screened transgenic cell or animal model without tandem integration by using the second nucleic acid composition through the first nucleic acid composition.

Preferably, the method further comprises using the second nucleic acid composition to perform a qPCR assay on a wild-type nucleic acid sample from the transgenic cell or animal model (the wild-type nucleic acid sample is extracted from the wild-type cell or wild-type animal in the same context). The wild-type assay results were compared to the transgene assay results to determine if a single copy insertion was present.

The embodiments of the present invention provide that the detection of the second nucleic acid composition (qPCR) has the advantageous effects as shown in table 1 compared to the detection of Southern blots.

Table 1 beneficial results

Table 1 identifies the difference in effect between the detection of the second nucleic acid composition and the detection of Southern blots. Therefore, the detection by combining the first nucleic acid composition and the second nucleic acid composition has the characteristics of quicker and more accurate detection compared with the technical combination of double-arm PCR and Southern blot or compared with the technical combination of the first nucleic acid composition and Southern blot.

Preferably, the nucleic acid sample detected by the second nucleic acid composition is: and (3) screening nucleic acid samples of the F1 generation transgenic cells or animal models without tandem integration through the first nucleic acid composition.

When an animal model or a transgenic cell is prepared, the F0 generation chimeric gene may have a risk of genetic instability, and when the F0 generation chimeric state is unstable, if the qPCR detection is carried out by only adopting the second nucleic acid composition, the defects of high detection cost and long period exist, and the detection cannot be effectively carried out. And the condition of F0 generation tandem is accurately and quickly screened by the first nucleic acid composition, after a tandem integrated sample is eliminated, verified F0 generation cells or animal models (without tandem cells or animal models) are mated and propagated, and then the insertion copy number of the exogenous gene in the F1 generation nucleic acid sample is quantitatively detected by adopting the second nucleic acid composition, so that the transgenic cells or animal models with single copy insertion success can be screened more accurately and effectively.

The embodiment of the invention also provides a kit for detecting the integration condition of an exogenous gene, which comprises the nucleic acid composition for detecting the integration condition of the exogenous gene as described in any one of the preceding embodiments.

Preferably, the kit further comprises reagents for PCR detection. The reagent for PCR detection is selected from at least one reagent or a combination of reagents as follows: dNTPs, Taq enzyme, DNA polymerase and PCR buffer.

Embodiments of the present invention also provide a method for constructing a transgenic cell or an animal model, which comprises detecting a nucleic acid sample of the transgenic cell or the animal model using the nucleic acid composition for detecting exogenous gene integration condition according to any of the foregoing embodiments, or screening the transgenic cell or the animal model using the method for detecting exogenous gene integration condition according to any of the foregoing embodiments.

In some embodiments, the preparation of transgenic cells and transgenic animal models is not limited, and can be performed using existing transgenic technology.

Preferably, before the nucleic acid composition is used for testing the transgenic cell or the animal model, the method may further comprise: screening the transgenic cells or animal models by adopting a double-arm PCR detection method and/or a sequencing mode to obtain the targeted transgenic cells or animal models.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

The present embodiment provides a nucleic acid composition for detecting integration status of an exogenous gene inserted at H11 site in a transgenic mouse, comprising a first nucleic acid composition.

The first nucleic acid composition comprises: a forward sequence (CTTGAATTGAACACAGGATTGCCTAG) with the sequence shown as SEQ ID No.1 and a reverse sequence (CCAGCCATATCGTTCACACACGT) with the sequence shown as SEQ ID No. 2.

The present embodiment also provides a method for detecting the integration status of an exogenous gene at the H11 locus in a transgenic mouse, which comprises: and carrying out PCR detection on the genome of the sample to be detected by adopting the forward primer and the reverse primer in the first nucleic acid composition. The PCR reaction system and the reaction procedure are shown in Table 2 and Table 3, respectively.

TABLE 2 qPCR reaction System

TABLE 3 qPCR reaction procedure

After detection, gel electrophoresis experiments were performed to verify whether they had specific amplification products. If a band with clear amplification and specificity exists, the presence of tandem can be judged. Specifically, when the forward primer or the reverse primer has an amplification product, the transgenic mouse is judged to have reverse multicopy tandem; when the primer pair of the forward primer and the reverse primer has an amplification product, the transgenic mice are judged to have homodromous multicopy tandem.

After validation, transgenic mice with multiple copies of the tandem were excluded from the screen and the validated mice were used for mating reproduction to obtain F1 generation transgenic mice.

Example 2

The present embodiment provides a nucleic acid composition and a method thereof for detecting the integration status of a foreign gene at the H11 locus in a transgenic mouse, which is substantially the same as in example 1, and which comprises the first nucleic acid composition of example 1.

With the difference that the nucleic acid composition further comprises a second nucleic acid composition for detecting whether the foreign gene inserted at the H11 site is a single copy insertion.

When the insertion site of the exogenous gene is H11 site, the sequence of the 5' end homology arm is shown as SEQ ID No. 3; the sequence of the 3' end homology arm is shown in SEQ ID No. 4. The sequence of the primer pair 1 is shown as SEQ ID No. 5-6; the sequence of the primer pair 2 is shown as SEQ ID No. 7-8, and is specifically shown as Table 4.

TABLE 4 sequence information

The qPCR reaction systems for primer pair 1 and primer pair 2 are shown in table 5, and the qPCR reaction procedures are shown in table 6.

TABLE 5 qPCR reaction System

TABLE 6 qPCR reaction procedure

The method further comprises screening F1 generation validation mice obtained after screening the first nucleic acid composition with the second nucleic acid composition.

And when the qPCR amplification result of the genome of the transgenic cell or the animal model is consistent with the qPCR amplification result of the genome of the wild type of the transgenic cell or the wild type of the transgenic animal model, judging that the transgenic cell or the animal model is inserted in single copy, and if the qPCR amplification result is inconsistent, judging that random insertion or multi-copy tandem connection occurs.

Example 3

This example provides a nucleic acid composition and method for detecting the integration status of a foreign gene inserted at the Rosa26 site in a transgenic mouse, which is substantially the same as in example 2, except that the mouse foreign gene insertion site is different from the first and second nucleic acid compositions, and the insertion site is Rosa26 site.

Specifically, the first nucleic acid composition comprises: a forward sequence (AGATTAAAGACATGCTCACCCGA) with the sequence shown as SEQ ID No.9 and a reverse sequence (TAACAACTCAGAGCGACTTTGGG) with the sequence shown as SEQ ID No. 10.

When the insertion site of the exogenous gene is a Rosa26 site, the sequence of the 5' end homology arm is shown as SEQ ID No. 11; the sequence of the 3' end homology arm is shown in SEQ ID No. 12. The sequence of the primer pair 1 is shown as SEQ ID No. 13-14; the sequence of the primer pair 2 is shown as SEQ ID No. 15-16, and is specifically shown as Table 7.

TABLE 7 sequence information

Verification example 1

The detection of tandem integration by the first nucleic acid composition provided in example 1 was validated.

The first nucleic acid composition and method provided in example 1 were used to perform tandem PCR detection of exogenous gene integration in H11-CAG-LSL-A gene-polyA mouse model (C57 BL/6J) with exogenous gene inserted at H11 site. Meanwhile, the mice with the exogenous gene inserted into the site H11 are detected and screened by adopting a double-arm PCR technology in the prior art, and the tandem detection of the first nucleic acid composition and the detection result of the existing double-arm PCR provided in example 1 are compared.

The primers used in the two-arm PCR are shown in Table 8.

TABLE 8 primer information for two-arm PCR

Please refer to fig. 7 for the detection results. Specifically, a in fig. 7 is a detection result of a primer pair for detecting a 5 'end homology arm (5' ram) of the two-arm PCR, and B in fig. 7 is a detection result of a primer pair for detecting a 3 'end homology arm (3' arm) of the two-arm PCR. FIG. 7C shows the result of PCR detection of the first nucleic acid composition of example 1.

As shown in FIG. 7, the results of the double-arm PCR detection of the No.1 to No.4 mice are positive, but after the detection of the first nucleic acid composition of example 1, the No.1 to No.4 mice are all mice in tandem, and the mice are all excluded, and the embryo injection is scheduled again (if the southern blot is used for detection, the detection result needs to wait for at least 4 weeks, which seriously affects the project schedule).

Verification example 2

The effect of the nucleic acid composition of example 2 on the detection of the integration state of a foreign gene in the genome of a transgenic mouse was verified.

A transgenic mouse model of 20C 57BL/6J strains is obtained, and the mouse model is a transgenic mouse H11-pVillin1-CreERT2 with a CreERT2 sequence inserted into a H11 site. The transgenic mice, the conventional double-arm PCR detection method and the sequencing method were screened by the first nucleic acid composition of example 2, and the primer information used in the double-arm PCR is shown in Table 9.

TABLE 9 primer sequence information

The screening results are shown in FIG. 8 (the numbers on the bands in FIG. 8, such as 22, 25 and 27, are the numbers of the transgenic mouse model). In FIG. 8, A is the result of PCR detection of the 5-terminal homology arm of the two-arm PCR, B is the result of PCR detection of the 3-terminal homology arm of the two-arm PCR in FIG. 8, and C is the result of tandem detection of the first nucleic acid composition in FIG. 8. The combination of the sequencing results shows that the mice No. 22, 25, 27, 118, 135, 136 and 139 were sequenced correctly and used for breeding. A base mutation (C → T) is arranged on the homologous arm at the No. 116 3 end, and is excluded; in 117 and 119, I-CeuI sites were inserted at both ends of the homology arm and at the genome junction, and excluded. 83. No. 87, No. 106 and No. 107, the PCR tandem test result was positive, and positive mice were excluded because they were sufficient. Thus, 7F 0 generation validation mice were obtained.

1. The F0 generation verification mice were subjected to Southern Blot detection.

When constructing the exogenous gene vector, related endonuclease is introduced (see the digestion scheme, see table 10), and the introduced site and the digestion site corresponding to the outside of the arm cut out a DNA fragment with specific size. Amplifying the nucleic acid sample of F0 generation by the designed primer pair (see Table 11), then respectively adopting corresponding endonucleases to carry out enzyme digestion on the amplification product, and verifying whether the product after enzyme digestion meets the expectation by southern blot.

TABLE 10 cleavage schemes

TABLE 11 sequence information

The Southern blot detection result of the enzyme-cleaved product is shown in FIG. 9. In FIG. 9, B6/J is a negative control mouse, and A in FIG. 9 is the detection result of the enzyme digestion product of AflII; in FIG. 9, B is the detection result of the cleavage product of ScaI.

As shown in FIG. 9, the band of No. 27 was not of interest, and other positive mice were selected by breeding. 22. The correct hit bands were present in 25, 27, 118, 135, 136 and 139, positive and could be used for breeding.

Detection of F1 mouse

2.1. The F1 generation mice obtained from the breeding were tested using the second nucleic acid composition provided in example 2.

The 118/135 mouse selected by the Southern blot in the step 1 is mated with the B6J mouse for breeding to obtain F1 generation mouse. The F1 generation mice were tested using primer set 1 of the second nucleic acid composition of example 2 and the test results were calibrated using the reference primer set, as shown in table 12 and table 13.

TABLE 12 primer sequence information

TABLE 13 test results

Remarking: the sample number in Table 13 is the sample number at generation F1.

As can be seen from Table 13, there were random insertions in mice Nos. 157 and 158, which were not single copy insertions. The positive mice screened by the Southern blot also have the risks of omission and false detection, and the detection and verification of the gene integration condition can be more accurately and rapidly carried out by adopting the tandem PCR + qPCR combined detection mode provided by the invention.

2.2. The F1 generation mice obtained from the breeding were tested using the second nucleic acid composition provided in example 2.

22/25 mice selected by the Southern blot in the step 1 are respectively mated with B6J mice for breeding to obtain F1 generation mice. The F1 mouse was tested using primer set 1 of the second nucleic acid composition provided in example 2 (calibration of test results using the internal reference primer set), the primer information is shown in table 12, and the test results are shown in table 14.

TABLE 14 test results

Internal reference calibration	Genotype(s)	Sample number	Genotype(s)
				1.45	1.46	141	\
1.27	1.28	142	\
				1.29	1.30	143	\
1.33	1.35	144	\
				1.39	1.40	145	\
0.88	0.89	B6-1	Wild control
				0.99	1.00	B6-2	Wild control

Remarking: the sample number in Table 14 is the sample number at generation F1.

As can be seen from the results, the random insertions were found in all of the No. 141 to No. 145 mice, and they did not belong to the case of single copy insertion. The positive mice screened by the Southern blot have the risk of omission and inaccurate detection results.

Verification example 3

The results of detecting the gene integration state of the transgenic mice by the nucleic acid composition of example 2 were verified.

A transgenic mouse model of 14C 57BL/6J strains, which is a transgenic mouse with the insertion of MECOM (NM-001105077.3) at the H11 site, was obtained. The first nucleic acid composition of example 2 and the conventional double-arm PCR method were used to screen mice, and the primers used in the double-arm PCR method are shown in Table 15.

TABLE 15 primer information for two-arm PCR

Please refer to fig. 10 for the detection results. FIG. 10A shows the result of PCR detection of the 5 '-end homology arm of the two-arm PCR, FIG. 10B shows the result of PCR detection of the 3' -end homology arm of the two-arm PCR, and FIG. 10C shows the result of tandem detection of the first nucleic acid composition of example 1. From the detection results, F0 generation verification mice (nos. 65, 66, 71, 79, 88, 90, 92, and 100) having no tandem integration were obtained.

The same as in example 2, except that the cleavage schemes were different, primers were used, the cleavage schemes used are shown in Table 16, and the primers used are shown in Table 17.

TABLE 16 cleavage protocol

TABLE 17 sequence information

The Southern blot detection results of the enzyme-cleaved products are shown in FIG. 11. In FIG. 11, B6/J is a negative control mouse, and A in FIG. 11 is the detection result of a HindIII partial cleavage product (bands in the figure are B6/J, 71 and 79 from left to right); in FIG. 11, B is the result of detection of a partial cleavage product of Stu 1.

As can be seen from FIG. 11, both

mice

71 and 79 had the correct target zone, and were positive, and breeding was recommended.

2. The F1 generation mice obtained from the breeding were tested using the second nucleic acid composition provided in example 2.

The F1 generation mice were tested using primer pair 1 and primer pair 2 of the second nucleic acid composition provided in example 2 (and the test results were calibrated using the internal reference primer pair) and are shown in table 18.

TABLE 18 test results

Internal reference calibration	Genotype(s)	Sample number	Genotype(s)
				1.06	1.14	105	/
0.93	0.99	107	/
				1.53	1.64	109	/
1.86	1.99	110	/
				1.55	1.67	111	/
1.75	1.87	113	/
				1.59	1.70	115	/
1.63	1.75	117	/
				0.93	1.00	B6-1	Wild control
0.97	1.04	B6-2	Wild control

Remarking: the sample number in Table 18 is that of F1 mouse.

As can be seen from table 18, random insertions were absent in mice nos. 105 and 107, and random insertions were present in mice nos. 111, 113, 115 and 117.

Verification example 4

A transgenic mouse model of 19C 57BL/6J strains was obtained, and the transgenic information of the mouse model H11-CAG-LSL-Ptpn2-Flag-PolyA is as follows: the insertion site is H11; the promoter adopts CAG; the silencing element regulated by loxp adopts LSL; the foreign gene is Ptpn 2-Flag.

Transgenic mice were screened for tandem integration by the first nucleic acid composition (tandem assay), conventional two-arm PCR assay, and sequencing in example 2 to obtain F0 generation validation mice without tandem integration. For primers used in the two-arm PCR, refer to Table 19.

Table 19 sequence information

Please refer to fig. 12 for the detection results. Specifically, A in FIG. 12 is the result of PCR detection of the 5 '-end homology arm of the two-arm PCR, B in FIG. 12 is the result of PCR detection of the 3' -end homology arm of the two-arm PCR, and C in FIG. 12 is the result of tandem detection of the first nucleic acid composition. As is clear from the results, the double-arm PCR tests of Nos. 2, 11, 14, 16, 18, 24, 25 and 53 were positive, and the breeding was recommended because the sequencing was correct.

The difference from the example 3 is that the cleavage scheme is different and the primers are different. The cleavage schemes are shown in Table 20, and the primers used are shown in Table 9 (verification example 2).

TABLE 20 cleavage protocol

Wherein, the PCR reaction system of the primer is as follows: 2.5. mu.l 10 Xbuffer, 16.75. mu.l ddH₂O, 1. mu.l of forward primer (10. mu.M), 1. mu.l of reverse primer (10. mu.M), 2. mu.l of Mg²⁺0.5. mu.l dNTPs (10 mM each) and 1. mu.l DNA template (100 ng/. mu.l).

The PCR reaction procedure is shown in Table 21.

TABLE 21 PCR reaction procedure

The Southern blot detection results are shown in FIG. 13. In FIG. 13, A is the southern blot detection result of the partial cleavage products of NheI (bands B6/J, Nos. 2, 11, 14 and 16 from left to right). In FIG. 13, B is the Southern blot detection result of the HindIII partial cleavage product. In FIG. 13, B6/J was a negative control mouse, and the results showed that mice Nos. 2, 11, 14 and 16 all had correct hit bands and were positive, and breeding was recommended.

The F1 mouse generation was tested using primer set 1 and the internal reference primer (Table 12 in the same manner as in example 2) of the second nucleic acid composition provided in example 2, and the test results were calibrated using the internal reference primer set, and are shown in Table 22.

TABLE 22 test results

Remarking: the sample number in Table 22 is that of F1 mouse.

As can be seen from table 22, random insertions were present in mice nos. 102, 106 and 107, and random insertions were absent in mice nos. 104, 108, 109, 110, 115, 117 and 118.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Jiangsu Jiejiaokang Biotech limited

<120> a nucleic acid composition for detecting integration status of foreign gene and method thereof

<160>16

<170>PatentIn version 3.5

<210>1

<211>26

<212>DNA

<213> Artificial sequence

<400>1

cttgaattga acacaggatt gcctag 26

<210>2

<211>23

<212>DNA

<213> Artificial sequence

<400>2

ccagccatat cgttcacaca cgt 23

<210>3

<211>1140

<212>DNA

<213> Artificial sequence

<400>3

tgacagaagg ctgttaaatc gaatgaacct acatggttca aatacaaggg atacaagatt 60

gtcagtcctg gaagtctttc ttttataaaa tatgtgaatg aagtgttggt gtcttctaga 120

ggtgacacct aagggttctg aaaaaataaa atgtatagac ccttatgtac agacctgtgt 180

ataaactttt gtacatacaa atagggtagc tttttttgaa cttatacata cagctgtaca 240

taaagtaact atcagttagg cttgtgtcaa ctgtttggat ttttttcact tgaatatttg 300

ggactttttc ttttggttta ttaaaagtta catatgccac gtgtgtgaac gatatggctg 360

gtactgtgtt tatttcttcc atgaactaag acagtctaaa tgagttcctt tcacgtttta 420

attttacctt aggacttctg gaatttcttc tgcacataaa gttctgatag cattagttta 480

agctggacta accctgaaag tagcttgtgg caagtatcaa ggaatcaata ttatactcta 540

caaaatcaaa gtttacagag aagtcatata gtaatttttc tgaaatttac tggcacaatg 600

ttaatccagc ctgactccaa ctaattaatg gtcacattaa tttaagtctt tcccttgcct 660

ctgctgcatt agtttctctc aaaattgtta acttacaact tgaagtctgg tattataaat 720

tgaatgtaaa gcattctgaa agatactata ctgattgcag gtttttcagt caggttcaag 780

ctaatttgac cagtcattgg attaattatg gatctggggc cataaatgct attttaattc 840

cactatagag attaaaataa gccattctccatttcataat attctattgg actttgactg 900

caggggcctc caagtcttga cagtagatta taatccttca gctgcccact ctactggagg 960

aggacaaact ggtcactttt cagcaaaacc tggctgtgga tcagggcagt ctggtacttc 1020

caagctcatt agatgccatc atgctctcac tgcctcctca gcttcaagag gaatctggaa 1080

aaagcagtcc cactggtcag gaaaggaaca ctagtgcact tatcctgggt gtctgctgag 1140

<210>4

<211>1057

<212>DNA

<213> Artificial sequence

<400>4

gtaagggcag gatgtgtcaa actgccaata gagaactact tactcttcag gctgaagctg 60

atggaacagg taacaaaggc aaacactaat catgatcagc aagatgaagc agaaagggaa 120

caaggggata ttaaatgtgt atagacacgc tagagagatg gctcagcagt taagagaact 180

agctggtctt tcagaggtcc tgagatcaat tttagacacc cacatggtgg ctcatgacca 240

tctatctata aatggatctg attttcatgt ctggcagtgt acagaagcta actgaagaaa 300

ggtggaagac ccacaagagt tcaagataag ccctatatag tgaagttcaa ggcaagcttt 360

ttctacctga aacttagtct caaaaaaaaa tgaatacgta aacagtcttc caggggataa 420

gaaccttaca gaaaaagcag aaatgcctgg ggcactggat taccgatgta atcaaattca 480

gtccttgaat tgaacacagg attgcctaga gcaaggccag ccagagattc atctcagagg 540

gagaaaggtg tctttggagc aattttgtgg taatctagta tgtatcacat aagtttagac 600

gcatttggga ctggaaagat gtgaacaaag caccctatgg ctcacatctg tcattaactc 660

tagttccagt gcacctgaca ccgtcttctg gcctctgcag tgaccaagca catgggtagt 720

atgtagacat atacataagc aaaacacaca tcattaaaaa gtgacatttc ccaaaggaag 780

ctgaagaacc agttcttgag aagatagtag aaatcagaag gggaaatagt agacatacag 840

agggactgac caggttgtgt cacctttata ggctaggcta atggatgatc gacactagcg 900

ctctttgtga aggacacaca aatgagacat agtttatagg actaaacaca cttctaagca 960

atttaatgag acttaagacc ctgtctctag caaatactct ggatgatatt cagctcaagg 1020

ctcttgtcag acatgtttcc attttcaagg tgagcta 1057

<210>5

<211>24

<212>DNA

<213> Artificial sequence

<400>5

ctattggact ttgactgcag gggc 24

<210>6

<211>22

<212>DNA

<213> Artificial sequence

<400>6

ctgatccaca gccaggtttt gc 22

<210>7

<211>23

<212>DNA

<213> Artificial sequence

<400>7

gcagaaaggg aacaagggga tat 23

<210>8

<211>25

<212>DNA

<213> Artificial sequence

<400>8

ccaccatgtg ggtgtctaaa attga 25

<210>9

<211>23

<212>DNA

<213> Artificial sequence

<400>9

agattaaaga catgctcacc cga 23

<210>10

<211>23

<212>DNA

<213> Artificial sequence

<400>10

taacaactca gagcgacttt ggg 23

<210>11

<211>1233

<212>DNA

<213> Artificial sequence

<400>11

ttggccggtg cgccgccaat cagcggaggc tgccggggcc gcctaaagaa gaggctgtgc 60

tttggggctc cggctcctca gagagcctcg gctaggtagg ggatcgggac tctggcggga 120

gggcggcttg gtgcgtttgc ggggatgggc ggccgcggca ggccctccga gcgtggtgga 180

gccgttctgt gagacagccg ggtacgagtc gtgacgctgg aaggggcaag cgggtggtgg 240

gcaggaatgc ggtccgccct gcagcaaccg gagggggagg gagaagggag cggaaaagtc 300

tccaccggac gcggccatgg ctcggggggg ggggggcagc ggaggagcgc ttccggccga 360

cgtctcgtcg ctgattggct tcttttcctc ccgccgtgtg tgaaaacaca aatggcgtgt 420

tttggttggc gtaaggcgcc tgtcagttaa cggcagccgg agtgcgcagc cgccggcagc 480

ctcgctctgc ccactgggtg gggcgggagg taggtggggt gaggcgagct ggacgtgcgg 540

gcgcggtcgg cctctggcgg ggcgggggag gggagggagg gtcagcgaaa gtagctcgcg 600

cgcgagcggc cgcccaccct ccccttcctc tgggggagtc gttttacccg ccgccggccg 660

ggcctcgtcg tctgattggc tctcggggcc cagaaaactg gcccttgcca ttggctcgtg 720

ttcgtgcaag ttgagtccat ccgccggcca gcgggggcgg cgaggaggcg ctcccaggtt 780

ccggccctcc cctcggcccc gcgccgcaga gtctggccgc gcgcccctgc gcaacgtggc 840

aggaagcgcg cgctgggggc ggggacgggc agtagggctg agcggctgcg gggcgggtgc 900

aagcacgttt ccgacttgag ttgcctcaag aggggcgtgc tgagccagac ctccatcgcg 960

cactccgggg agtggaggga aggagcgagg gctcagttgg gctgttttgg aggcaggaag 1020

cacttgctct cccaaagtcg ctctgagttg ttatcagtaa gggagctgca gtggagtagg 1080

cggggagaag gccgcaccct tctccggagg ggggagggga gtgttgcaat acctttctgg 1140

gagttctctg ctgcctcctg gcttctgagg accgccctgg gcctgggaga atcccttccc 1200

cctcttccct cgtgatctgc aactccagtc ttt 1233

<210>12

<211>1094

<212>DNA

<213> Artificial sequence

<400>12

tgtgtgggcg ttgtcctgca ggggaattga acaggtgtaa aattggaggg acaagacttc 60

ccacagattt tcggttttgt cgggaagttt tttaataggg gcaaataagg aaaatgggag 120

gataggtagt catctggggt tttatgcagc aaaactacag gttattattg cttgtgatcc 180

gcctcggagt attttccatc gaggtagatt aaagacatgc tcacccgagt tttatactct 240

cctgcttgag atccttacta cagtatgaaa ttacagtgtc gcgagttaga ctatgtaagc 300

agaattttaa tcatttttaa agagcccagt acttcatatc catttctccc gctccttctg 360

cagccttatc aaaaggtatt ttagaacact cattttagcc ccattttcat ttattatact 420

ggcttatcca acccctagac agagcattgg cattttccct ttcctgatct tagaagtctg 480

atgactcatg aaaccagaca gattagttac atacaccaca aatcgaggct gtagctgggg 540

cctcaacact gcagttcttt tataactcct tagtacactt tttgttgatc ctttgccttg 600

atccttaatt ttcagtgtct atcacctctc ccgtcaggtg gtgttccaca tttgggccta 660

ttctcagtcc agggagtttt acaacaatag atgtattgag aatccaacct aaagcttaac 720

tttccactcc catgaatgcc tctctccttt ttctccattt ataaactgag ctattaacca 780

ttaatggttt ccaggtggat gtctcctccc ccaatattac ctgatgtatc ttacatattg 840

ccaggctgat attttaagac attaaaaggt atatttcatt attgagccac atggtattga 900

ttactgctta ctaaaatttt gtcattgtac acatctgtaa aaggtggttc cttttggaat 960

gcaaagttca ggtgtttgtt gtctttcctg acctaaggtc ttgtgagctt gtattttttc 1020

tatttaagca gtgctttctc ttggactggc ttgactcatg gcattctaca cgttattgct 1080

ggtctaaatg tgat 1094

<210>13

<211>23

<212>DNA

<213> Artificial sequence

<400>13

acttgagttg cctcaagagg ggc 23

<210>14

<211>23

<212>DNA

<213> Artificial sequence

<400>14

agagcaagtg cttcctgcct cca 23

<210>15

<211>25

<212>DNA

<213> Artificial sequence

<400>15

aacccctaga cagagcattg gcatt 25

<210>16

<211>26

<212>DNA

<213> Artificial sequence

<400>16

gctacagcct cgatttgtgg tgtatg 26

Claims

1. A nucleic acid composition for detecting the integration status of an exogenous gene, comprising: a first nucleic acid composition for detecting whether or not multiple copies of a foreign gene are tandemly ligated;

2. The nucleic acid composition for detecting integration status of an exogenous gene according to claim 1, wherein when the insertion site is H11 site, the base sequence of the forward primer is shown in SEQ ID No. 1; the base sequence of the reverse primer is shown as SEQ ID No. 2;

3. The nucleic acid composition for detecting integration status of an exogenous gene according to claim 1, further comprising: a second nucleic acid composition for detecting whether the foreign gene is inserted in a single copy;

4. The nucleic acid composition for detecting integration status of foreign gene according to claim 3, wherein in the second nucleic acid composition, the primer pair comprises primer pair 1 for detecting 5 'end homology arm and/or primer pair 2 for detecting 3' end homology arm.

5. The nucleic acid composition for detecting integration status of foreign gene according to claim 4, wherein when the insertion site of the foreign gene is H11 site, the sequence of the homology arm at 5' end is shown in SEQ ID No. 3; the sequence of the 3' end homology arm is shown as SEQ ID No. 4; the sequence of the primer pair 1 is shown as SEQ ID No. 5-6; the sequence of the primer pair 2 is shown as SEQ ID No. 7-8;

when the insertion site of the exogenous gene is a Rosa26 site, the sequence of the 5' end homology arm is shown as SEQ ID No. 11; the sequence of the 3' end homology arm is shown as SEQ ID No. 12; the sequence of the primer pair 1 is shown as SEQ ID No. 13-14; the sequence of the primer pair 2 is shown as SEQ ID No. 15-16.

6. A method for detecting the integration status of an exogenous gene, which comprises detecting a nucleic acid sample with the nucleic acid composition for detecting the integration status of an exogenous gene according to any one of claims 1 to 5.

7. The method for detecting integration status of exogenous gene according to claim 6, wherein the nucleic acid sample is extracted from transgenic cells or transgenic animal model.

8. The method for detecting integration status of an exogenous gene according to claim 6, wherein when a first nucleic acid composition in the nucleic acid composition comprises a forward primer and a reverse primer, the method comprises performing PCR detection on the nucleic acid sample using the forward primer and the reverse primer;

when the nucleic acid composition comprises a second nucleic acid composition, the method comprises: and (3) carrying out qPCR detection on the nucleic acid sample screened from the transgenic cell or the animal model without tandem integration by using the second nucleic acid composition through the first nucleic acid composition.

9. The method for detecting the integration status of an exogenous gene according to claim 8, further comprising performing qPCR detection on a nucleic acid sample of a wild type of transgenic cell or animal model using the second nucleic acid composition.

10. A kit for detecting the integration status of an exogenous gene, comprising the nucleic acid composition for detecting the integration status of an exogenous gene according to any one of claims 1 to 5.

11. A method for constructing a transgenic cell or animal model, comprising: detecting a nucleic acid sample of a transgenic cell or an animal model using the nucleic acid composition for detecting exogenous gene integration condition according to any one of claims 1 to 5, or screening the transgenic cell or the animal model using the method for detecting exogenous gene integration condition according to claim 6 or 7.

12. The method for constructing a transgenic cell or animal model according to claim 11, wherein prior to assaying the transgenic cell or animal model with the nucleic acid composition, the method further comprises: screening the transgenic cells or animal models by adopting a double-arm PCR detection method and/or a sequencing mode to obtain the targeted transgenic cells or animal models.