CN111733223A - KCNMA1 gene SNP marker for assisting accurate medication of clopidogrel - Google Patents

Abstract

The invention discloses an SNP marker related to accurate medication of an antiplatelet drug clopidogrel for treating ACS, application thereof and a specific amplification primer for detecting the marker. The SNP marker is rs 169934371 on KCNMA1 gene, so that the CAS population with low efficiency and effective efficiency of clopidogrel can be well distinguished, accurate medication of clopidogrel is facilitated, and the application of the SNP marker and an amplification primer thereof in preparing a related detection kit is determined.

Description

KCNMA1 gene SNP marker for assisting accurate medication of clopidogrel

Technical Field

The invention belongs to the technical field of medicines. More particularly, relates to a KCNMA1 gene SNP marker for predicting ACS dosage and curative effect of anti-platelet drug clopidogrel treatment and related side effects and application thereof.

Background

Acute Coronary Syndrome (ACS) is a group of clinical syndromes pathologically based on the rupture of atherosclerotic plaques followed by complete or incomplete occlusive thrombosis, including acute ST elevation myocardial infarction, acute non-ST elevation myocardial infarction and Unstable Angina (UA). ACS is a common serious cardiovascular disease, a serious type of coronary heart disease, can cause arrhythmia, heart failure, and even sudden death, and seriously affects the quality of life and longevity of patients. Percutaneous Coronary Intervention (PCI) for the relief of stenotic coronary artery occlusions is a widely used technique for the treatment of angina or acute coronary events, the most common form of myocardial revascularization. The average increase in PCI surgery is 30-40% per year, and the total number of Chinese PCI surgeries in 2016 is 666,495. One of the major drawbacks of PCI is the occurrence of restenosis. The incidence of restenosis is reported to be about 5-25% depending on individual characteristics of the patient and the technique used in the surgery. Another disadvantage of PCI is the inability to arrest the progression of coronary atherosclerosis, with rates of revascularization of up to 50% in patients with symptomatic disease progression after PCI surgery. Revascularization again due to restenosis and disease progression has placed a significant clinical and economic burden on patients and society.

Clopidogrel is a platelet aggregation inhibitor that was successfully studied and developed by the pharmaceutical company santa delaberg, seofura, france in 1986, has become one of the most common and important drugs for the treatment of Acute Coronary Syndrome (ACS), being a basic drug that needs to be taken for a long time after PCI. However, the individual difference and tolerance of clopidogrel in clinical application are discovered in multi-year clinical application, and the clear reason is that clopidogrel is a prodrug and needs to be metabolized in 2 steps in a human body to become an active form, the first step is the metabolism of CYP2C19, about 10-20% of people have CYP2C19 gene mutation, so that metabolic difficulty is caused, clopidogrel cannot generate an active form product in the body, and the curative effect is reduced. Apart from the reasons of metabolic polymorphism, the activity response of some people to the same dose of clopidogrel is large, so that bleeding phenomena can exist in the people with the same dose, and the people have no curative effect. Therefore, biomarkers other than CYP2C19 are also needed to predict the efficacy of clopidogrel in treating ACS.

Disclosure of Invention

Aiming at the problem that the existing clopidogrel individual difference prediction method based on CYP2C19 polymorphism can not be solved, the invention aims to provide an SNP locus of KCNMA1 gene related to ACS treatment by an antiplatelet drug, which can be used for predicting the clinical medication guidance of ACS patients treated by the antiplatelet drug, preventing drug resistance, enhancing the treatment effect and reducing adverse reactions.

Another object of the present invention is to provide specific amplification primers for the above markers.

The invention also aims to provide application of the marker and the specific amplification primer thereof in preparing an auxiliary diagnostic kit for preventing and treating ACS (acute coronary syndrome) by using an antiplatelet drug clopidogrel.

The above purpose of the invention is realized by the following technical scheme:

in particular, SNP in peripheral blood DNA of ACS patients taking anti-platelet drug clopidogrel is separated and researched, sites highly related to clopidogrel reactivity difference are searched, and the kit can be used for developing a related kit for improving the accuracy of drug dosage when long-term drug administration is carried out on clopidogrel for preventing and treating ACS, and provides support for the treatment of ACS.

The specific amplification primer is an upstream primer and a downstream primer sequence of the rs 169934371 specific amplification primer, which are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.

A kit for the auxiliary diagnosis of the ACS prevention and treatment of clopidogrel is prepared, and comprises a specific primer, a specific fluorescent probe pair and other detection reagents for detecting the SNP in a blood DNA sample of a subject.

The invention has the following beneficial effects:

the marker sequence change provided by the invention is used as a marker for the auxiliary judgment of the treatment of ACS by clopidogrel, and has the advantages that: the SNP marker is a novel gene biomarker, is stable, minimally invasive and easy to detect, can detect results in the early stage of diseases, can effectively improve the sensitivity and specificity related to disease diagnosis and treatment, and can provide accurate guidance for the medication of ACS patients.

Attached: detailed information of SNP markers:

rs16934371[Homo sapiens]

is located at KCNMA1 (pollen-activated channel similarity M alpha 1) at chromosome 10 position, at 77222795 bases, and has front and back sequences

CCCAGAAAAAAGAACTTTAGCTTTA[C/T]TATCTGAGACAGGCAGAGGATTGAA

Detailed Description

The present invention will be further described with reference to the following examples. It should be noted that the following examples are only for illustration and are not intended to limit the present invention. Variations of the teachings of the present invention may be made by those skilled in the art without departing from the scope of the claims of the present application.

Example relationship of SNP mutation to PRU

1. Determination of clopidogrel reaction Unit (PRU)

In order to explore the relationship between genetic polymorphism and clopidogrel pharmacodynamics and adverse drug reactions, patients with coronary heart disease treated by taking antiplatelet drugs are brought in, and platelet function detection is carried out on 71 patients by a Verify Now detector. Platelet function testing is carried out after the effectiveness of the clopidogrel reaches a steady blood concentration (75 mg of clopidogrel is taken for more than 7 days every day, or 300mg of load dose is taken for the first time, 75mg is taken for 5 days every day, or 600mg of load dose is taken for the first time, and 75mg is taken for 3 days every day). Platelet activity was assessed using the Verify Now P2Y12(VN-P2Y12) assay (Accumetrics, San Diego, California, USA) which is a whole blood, instant, light transmission-based optical assay that measures primarily Adenosine Diphosphate (ADP) -induced platelet aggregation.

The determination method comprises the following steps: venous blood was collected using 2ml sodium citrate vacuum blood collection tubes 2, the first for gene sequencing and the 2 nd for platelet function testing. After the blood collection, the sample was mixed by inverting the top and bottom, left to stand at room temperature for 10 minutes, and then measured within 5 minutes, and the measurement data of P2Y12 reaction unit (PRU) was directly read from a Verify Now instrument.

2. Gene detection

Using DNA purification kit (

Promega, usa), genomic DNA was extracted from peripheral whole blood samples of each subject. After obtaining the PRC product, all samples were subjected to SNPs detection by genome-wide SNP typing chip (Omni china-8, Illumina, china) through a gene chip.

The chip specially covers common and rare variation in Chinese population, covers 85% common genetic variation in Chinese population, and has high specificity and specificity²>0.8. The optimized 900,000 signature Single Nucleotide Polymorphisms (SNPs) information was from all three stages of the Hap Map and the thousand human genome project (1000genome project, 1 KGP). Omni Chinese chip assay was entrusted to Beijing Yimeitongdeke technology development Co., Ltd.

Correlation of SNP mutations with PRU

The results of the relationship between the base type of SNP rs 1694371 of KCNMA1 and PRU are shown in the following Table 1:

TABLE 1 correlation results of base type of SNP rs 1694371 of KCNMA1 with PRU

Table 1 lists the correspondence between different gene phenotypes and PRU, with smaller values for PRU indicating a more sensitive response to clopidogrel, below 95 generally considered as being at risk of bleeding. By comparison, the TC type of SNP rs 169934371 of KCNMA1 gene located in chromosome 10 can be found to be too sensitive to clopidogrel reaction. KCNMA1 gene epi-potassium-calcium activation channel subfamily m alpha 1 is an important protein of a platelet activation pathway, so that the treatment effect on clopidogrel can be judged in advance based on the detection of SNP rs 169934371, and accurate medication is realized.

Example II PCR amplification method adopted by SNP rs 1694371 detection kit

Primer design for SNP rs 169934371

Using https:// www.ncbi.nlm.nih.gov/tools/primer-blast as a primer design tool, searching primer sequences by using bases within 100 bases before and after the 77222795 th site of KCNMA1(potassium carbonate-activated channel subset M alpha 1) to obtain a series of primers, and determining the primers as follows according to the conventional principle and experimental screening:

a forward primer: GGCAATCAGCTTCAATCCTCTG

Reverse primer: AGGCAGAGGATTGAAGCTGAT

2. Extraction of genome DNA of sample to be detected

Selecting 2 patients from the above population with different gene phenotypes, sampling blood, and using DNA purification kit (1)

Promega, usa), genomic DNA was extracted from peripheral whole blood samples of each subject.

3. Amplification of DNA

A10 ng/10 mu l reaction system is adopted, and the specific operation is as follows:

mixing the series of primers with blood genome DNA, 2X PCR mixed reaction liquid and deionized water according to a certain proportion to form an independent reaction system, which comprises the following specific steps:

the above reaction system was subjected to PCR cycling under the following conditions as shown in Table 2:

TABLE 2 PCR cycling conditions

4. Observation results

The genotype results of 6 samples of two specific forward primers and one reverse primer pair of SNP rs 169934371 of KCNMA1 gene are shown in Table 3 below.

TABLE 3 detection results of genotypes of 6 samples by the method and Omni Chinese chip method

Numbering	1	2	3	4
					Method for producing a composite material	TT	TT	TC	TC
Chip method	TT	TT	TC	TC

The result shows that the method can quickly, accurately and simply detect the variation of the SNPrs 169934371 of the KCNMA1 gene, and has better practicability.

Sequence listing

SEQ ID NO.1：GGCAATCAGCTTCAATCCTCTG

SEQ ID NO.2：AGGCAGAGGATTGAAGCTGAT

Sequence listing

<110> first Hospital of Beijing university

Tianjin Institute of Pharmaceutical Research Co.,Ltd.

<120> KCNMA1 gene SNP marker for assisting accurate medication of clopidogrel

<130>1

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>22

<212>DNA

<213>Homo sapiens

<400>1

ggcaatcagc ttcaatcctc tg 22

<210>2

<211>21

<212>DNA

<213>Homo sapiens

<400>2

aggcagagga ttgaagctga t 21

Claims (4)

1. An SNP marker related to accurate medication when an antiplatelet drug clopidogrel is used for treating ACS is characterized in that the SNP marker is rs 169934371 on KCNMA1 gene.

2. The specific amplification primer of the SNP marker according to claim 1, wherein the specific amplification primer is an upstream primer and a downstream primer of the rs 169934371 specific amplification primer, which are shown as SEQ ID No.1 and SEQ ID No.2, respectively.

3. The use of the SNP marker of claim 1 in the preparation of an auxiliary diagnostic kit for the prevention and treatment of ACS associated with clopidogrel, an antiplatelet agent.

4. The application of the specific amplification primer of the SNP marker in the claim 2 in preparing an auxiliary diagnostic kit related to the prevention and treatment of ACS (acute coronary syndrome) by an antiplatelet drug clopidogrel.