CN111718966A - Microbial synthesis method of eugenol - Google Patents
Microbial synthesis method of eugenol Download PDFInfo
- Publication number
- CN111718966A CN111718966A CN202010524389.5A CN202010524389A CN111718966A CN 111718966 A CN111718966 A CN 111718966A CN 202010524389 A CN202010524389 A CN 202010524389A CN 111718966 A CN111718966 A CN 111718966A
- Authority
- CN
- China
- Prior art keywords
- eugenol
- leu
- val
- seq
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01318—Eugenol synthase (1.1.1.318)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Abstract
The invention discloses a microbial synthesis method of eugenol. The amino acid sequence and the nucleotide sequence of coniferyl alcohol acyltransferase CFAT provided by the invention are respectively shown by SEQ ID No.1 and SEQ ID No.2, and the nucleotide sequences of eugenol synthetase EGS2, APS1 and AIS1 are respectively shown by SEQ ID No.6, SEQ ID No.9 and SEQ ID No. 11. The combination of coniferyl alcohol acyltransferase and eugenol synthetase EGS2, or the combination of coniferyl alcohol acyltransferase and eugenol synthetase APS1, or the combination of coniferyl alcohol acyltransferase and eugenol synthetase AIS1 can efficiently catalyze coniferyl alcohol to synthesize eugenol, reduce the accumulation of intermediates, and lay the foundation for the industrial production of eugenol by microbial fermentation.
Description
Technical Field
The invention belongs to the technical field of biological pesticides, and relates to application of coniferyl alcohol acyltransferase and three eugenol synthetases in synthesis of eugenol by converting coniferyl alcohol in microorganisms.
Background
Eugenol is a high-efficiency botanical biopesticide and is mainly used for preventing and treating important agricultural diseases such as tomato gray mold, grape downy mildew, potato late blight and the like. At present, eugenol is extracted and prepared from plants such as clove at home, and the problems of low content, slow growth and other raw material sources exist.
It is reported in the literature that coniferyl alcohol acyltransferase (CFAT) can catalyze the acylation reaction of coniferyl alcohol to generate coniferyl acetate, and eugenol synthetase (EGS) can catalyze the reduction reaction of coniferyl acetate to generate eugenol, and the pathway is shown in FIG. 1.
Coniferyl alcohol acyltransferase (CFAT) belongs to BAHD acyltransferase family, and has been identified from petunia, Prunus cerasifera, and Malus pumila and enzymatically characterized[1-4]. Eugenol synthase is an NADPH-dependent reductase that reduces ester linkages on coniferyl acetate side chains to allyl groups. At present, eugenol synthetase derived from various plants such as basil, hop, morning glory, Chinese rose, strawberry, gymnadenia conopsea has been identified [5-9]. The yield of allogenic synthesis of eugenol in Escherichia coli is low and is below 20 mg/L. For example, the combination of LtCAAT1/LtAPS1 synthesizes about 27mg/L eugenol [ 10%]The yield is the highest reported in the literature at present.
[1]Dexter R,Qualley A,Kish C M,et al.Characterization of a petuniaacetyltransferase involved in the biosynthesis of the floral volatileisoeugenol[J].Plant J.,2007,49(2):265-275.
[2]Koeduka T,Orlova I,Baiga T J,et al.The lack of floral synthesisand emission of isoeugenol in petunia axillaris subsp.Parodii is due to amutation in the isoeugenol synthase gene[J].Plant J., 2009,58(6):961-969.
[3]Zhang T,Huo T,Ding A,et al.Genome-wide identification,characterization,expression and enzyme activity analysis of coniferyl alcoholacetyltransferase genes involved in eugenol biosynthesis in Prunus mume[J].PLoS One,2019,14(10):e0223974.
[4]Yauk Y K,Souleyre E J F,Matich AJ,et al.Alcohol acyl transferase1links two distinct volatile pathways that produce esters andphenylpropenesin apple fruit[J].Plant J.,2017,91(2): 292-305.
[5]Koeduka T,Louie G V,Orlova I,et al.The multiple phenylpropenesynthases in both Clarkia breweri and Petunia hybrida represent two distinctprotein lineages[J].Plant J.,2008,54(3): 362-374.
[6] Cloning and expression analysis of the Everest eugenol synthase gene RheGS1 [ J ] Chinese agricultural science, 2012,45(3):590 Amplifier 597.
[7] Cloning and expression analysis of the eugenol synthase gene RcEGS1 from Rosa chinensis (Rosa chinensis), J.J.. Hill., J.Hill., 2012,39(7):1387.
[8]Araguez I,Osorio S,Hoffmann T,et al.Eugenol production in achenesand receptacles of strawberry fruits is catalyzed by synthases exhibitingdistinct kinetics[J].Plant Physiol.2013, 163(2):946-958.
[9]Gupta AK,Schauvinhold I,Pichersky E,et al.Eugenol synthase genesin floral scent variation in Gymnadenia species[J].Funct.Integr.Genomics,2014,14(4):779-788.
[10]Kim S J,Vassao D G,Moinuddin S G,et al.Allyl/propenyl phenolsynthases from the Creosote bush and engineering production of specialty/commodity chemicals,eugenol/isoeugenol,in Escherichia coli[J].Arch.Biochem.Biophys.,2014,541:37-46.
Disclosure of Invention
In order to solve the problems in the prior art, the invention provides a microbial synthesis method of eugenol, which solves the problem of low content of eugenol prepared in the prior art.
The technical scheme of the invention is summarized as follows:
a microbial synthesis method of eugenol comprises expressing coniferyl alcohol acyltransferase CFAT and eugenol synthetase EGS2 in combination, and directly synthesizing eugenol with coniferyl alcohol as substrate. The amino acid sequence and the gene sequence of the coniferyl alcohol acyltransferase CFAT are respectively shown as SEQ ID No.1 and SEQ ID No.2, and the amino acid sequence and the gene sequence of the eugenol synthetase EGS2 are respectively shown as SEQ ID No.5 and SEQ ID No. 6.
A microbial synthesis method of eugenol comprises expressing coniferyl alcohol acyltransferase CFAT and eugenol synthetase APS1 in combination, and directly synthesizing eugenol with coniferyl alcohol as substrate. The amino acid sequence and the gene sequence of coniferyl alcohol acyltransferase CFAT are respectively shown as SEQ ID No.1 and SEQ ID No.2, and the gene sequence of eugenol synthetase APS1 is shown as SEQ ID No. 9.
A microbial synthesis method of eugenol comprises expressing coniferyl alcohol acyltransferase CFAT and eugenol synthetase AIS1 in combination, and directly synthesizing eugenol with coniferyl alcohol as substrate. The amino acid sequence and the gene sequence of coniferyl alcohol acyltransferase CFAT are respectively shown as SEQ ID No.1 and SEQ ID No.2, and the amino acid sequence and the gene sequence of eugenol synthetase AIS1 are respectively shown as SEQ ID No.10 and SEQ ID No. 11.
The coniferyl alcohol acyltransferase CFAT is combined with eugenol synthetase EGS2 or APS1 or AIS1, coniferyl alcohol is used as a substrate, and the application in the synthesis of eugenol is realized.
The invention has the advantages that:
the invention converts coniferyl alcohol into eugenol by a microbiological method, screens the combined expression of coniferyl alcohol acyltransferase and three eugenol synthetases, establishes a biosynthesis method, and directly synthesizes the eugenol by taking the coniferyl alcohol as a substrate. The invention screens out the optimal enzyme and the optimal combination thereof through the expression of escherichia coli, the yield of the eugenol reaches more than 200mg/L, and the invention is beneficial to the industrial production of the eugenol.
Drawings
FIG. 1 is a pathway for converting coniferyl alcohol into eugenol by a microbiological method;
FIG. 2 is a gas chromatogram of a fermentation sample of strain BEG 1;
FIG. 3 is a mass spectrum of a fermentation sample of the strain BEG 1;
FIG. 4 is a standard mass spectrum of eugenol.
Detailed Description
Coli strains e.coli BL21(DE3) and e.coli DH5 α used in the present invention were purchased from beijing hologold biotechnology limited.
The LB medium consisted of: 10g/L NaCl, 10g/L peptone and 5g/L yeast powder, the balance being water, sterilizing at 121 ℃ under 0.1MPa for 20 min.
The composition of the M9Y culture medium is as follows: 6.8g/L Na2HPO4、3.0g/LKH2PO4、1.0g/L NaCl、0.5g/L NH4Cl, 1.0 g/L yeast powder and the balance ofSterilizing with water and culture medium under 0.1Mpa at 121 deg.C for 20 min. After sterilization, the final concentration of 2mM MgSO was added4、0.1mM CaCl2And 10g/L glucose.
The present invention will be further described with reference to the following examples.
EXAMPLE 1 obtaining of (class) coniferyl alcohol acyltransferase
The coniferyl alcohol acyltransferase can catalyze coniferyl alcohol to generate an acylation reaction to generate coniferyl acetate, and three kinds of coniferyl alcohol acyltransferases are screened out through biological information analysis, sequence alignment and other modes of mining, wherein the three kinds of coniferyl alcohol acyltransferases are CFAT (GenBank: ABG75942.1), CAAT1(GenBank: KF543260.1) and AT (NCBI: NP-178020.1). The following description will be given of how to obtain a coniferyl alcohol acyltransferase (kind) by taking coniferyl alcohol acyltransferase PhCFAT as an example.
And (3) combining the amino acid sequence of coniferyl alcohol acyltransferase CFAT and the preference of escherichia coli to codons, removing common enzyme cutting sites, and designing a full-length CFAT gene, wherein the nucleic acid sequence is shown as SEQ ID No. 2. The CFAT gene is designed to be connected with the downstream of the first T7 promoter of the plasmid pCDFDuet-1, and P with Nco I and BamH I enzyme cutting sites respectively added at both ends is completely synthesizedT7CFAT gene fragment, the gene fragment obtained being designated synCFAT.
The synCFAT fragment obtained by chemical total synthesis was amplified by the PCR method. And (3) establishing a PCR system by using high-fidelity DNA polymerase. The synCFAT-F (SEQ ID No.3) and the synCFAT-R (SEQ ID No.4) are used as primers, and the synCFAT fragment is used as a template for mass amplification preparation.
The PCR process is pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15s, annealing at 55 ℃ for 15s, and extension at 72 ℃ for 45s, with 30 cycles. The synCFAT fragment was amplified and the amplified product was purified and used.
In a similar manner, the gene sequences of AT and CAAT1 were obtained.
Example 2 obtention of eugenol synthetase
The eugenol synthetase catalyzes the coniferyl acetate to generate the eugenol through a reduction reaction. Four eugenol synthetases are screened out by biological information analysis, sequence comparison and other modes. These are EGS1(GenBank: ABR24113.1), EGS2 (GenBank: AKB11750.1), APS1(GenBank: KF543262.1) and AIS1(GenBank: ACL13526.1), respectively. The following describes how to obtain eugenol synthase, taking eugenol synthase EGS2 as an example.
And (3) combining the amino acid sequence of the eugenol synthetase EGS2 and the preference of escherichia coli to codons, removing common enzyme cutting sites, and designing a full-length EGS2 gene, wherein the nucleic acid sequence is shown as SEQ ID No. 6. The EGS2 gene was ligated to the downstream of the second T7 promoter of plasmid pCDFDuet-1, and P with Nde I and Kpn I cleavage sites added to both ends was synthesizedT7The EGS2 gene fragment, the resulting gene fragment was named synEGS 2.
The synEGS2 fragment obtained by chemical total synthesis was amplified by PCR. And (3) establishing a PCR system by using high-fidelity DNA polymerase. The synEGS2 fragment is used as a template for mass amplification preparation by using synEGS2-F (SEQ ID No.7) and synEGS2-R (SEQ ID No.8) as primers.
The PCR process is pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15s, annealing at 52 ℃ for 15s, and extension at 72 ℃ for 30s, with 30 cycles. The synEGS2 fragment was amplified and the amplification product was purified and used.
In a similar manner, the gene sequences of EGS1, APS1 and AIS1 were obtained.
EXAMPLE 3 construction of recombinant expression vectors
The optimized two genes are combined and connected to a plasmid pCDFDuet-1, wherein coniferyl alcohol acyltransferase is inserted between enzyme cutting sites Nco I and BamH I, and eugenol synthetase is inserted between enzyme cutting sites Nde I and Kpn I. The construction of the recombinant expression vector will be described below by taking the recombinant expression vector pCPG1 as an example.
The synPhCFAT fragment was cleaved enzymatically using the Fastdigest endonucleases Nco I and BamH I in the following reaction scheme: mu.L of 10 × FD buffer, 2. mu.L of Nco I endonuclease, 2. mu.L of BamH I endonuclease, 41. mu.L of synCFAT fragment. The reaction conditions are as follows: 37 ℃ for 2 h. And purifying and recovering the synCFAT fragment which is subjected to double enzyme digestion by using a kit to obtain Nco I and BamH I. The synCFAT fragment obtained after purification and recovery and the linearized vector backbone pCDFDuet-1 (including replicon and resistant fragment parts) obtained by enzyme digestion with the same enzyme are subjected to ligation reaction to obtain pCP plasmid. The connection reaction system is as follows: mu.L of 10 × T4 DNA LigaseBuffer, 1. mu. L T4 DNA Ligase, 6. mu.L of the linearized vector backbone obtained by digesting with synCFAT fragment obtained after purification and 2. mu.L of the same enzyme. The ligation reaction conditions were: 30 ℃ for 0.5 h. Similarly, the synEGS2 fragment and the pCP plasmid were digested with Fastdigest endonucleases Nde I and KpnI, and the respective fragments were recovered and purified, followed by ligation reaction to obtain the recombinant expression vector pCEG 1.
The combination of each recombinant expression vector is as follows:
pCEG1：pCDFDuet-1，PT7-CFAT-PT7-EGS2；
pCEG2：pCDFDuet-1，PT7-CFAT-PT7-APS1；
pCEG3：pCDFDuet-1，PT7-CFAT-PT7-EGS1；
pCEG4：pCDFDuet-1，PT7-CFAT-PT7-AIS1；
pCEG5：pCDFDuet-1，PT7-AT-PT7-EGS1；
pCEG6：pCDFDuet-1，PT7-AT-PT7-EGS2；
pCEG7：pCDFDuet-1，PT7-AT-PT7-APS1；
pCEG8：pCDFDuet-1，PT7-AT-PT7-AIS1；
pCEG9：pCDFDuet-1，PT7-CAAT1-PT7-EGS1；
pCEG10：pCDFDuet-1，PT7-CAAT1-PT7-EGS2；
pCEG11：pCDFDuet-1，PT7-CAAT1-PT7-APS1；
pCEG12：pCDFDuet-1，PT7-CAAT1-PT7-AIS1。
example 4 construction of recombinant Escherichia coli and Synthesis of eugenol by bioconversion
1. Construction of recombinant Escherichia coli
The constructed recombinant expression vector is transformed into a host cell E.coli BL21(DE3) by electric shock to obtain a recombinant strain BEG1-BEG 12.
2. Bioconversion synthesis of eugenol by recombinant bacterium BEG1-BEG12
Inoculating the recombinant strain BEG1-BEG12 in LB culture medium, culturing at 37 deg.C and 220rpm with shaking for 12h, adding into fresh LB culture medium at an inoculum size of 1%, and culturing to OD600Adding 0.1mM IPTG when the concentration is about 1, continuously culturing for 5-6h, transferring to M9Y fermentation medium in equal proportion, adding 400mg/L coniferyl alcohol, fermenting at 30 deg.C and 220rpm for 12h, and converting to synthesize eugenol.
After fermentation, taking 50 mu L of organic phase, diluting to 10 times volume of ethyl acetate solvent, shaking and uniformly mixing for 2min, removing water, filtering with a 0.22 mu m microporous filter membrane, and detecting by a Gas Chromatography (GC) system. The gas chromatograph was an Agilent 7820A, the gas chromatograph column was HP-5(30m 0.25mm, 0.25 μm film thick ness), and the detector was a FID flame detector. The temperature raising program is that the initial temperature is 60 ℃, the temperature is kept for 1min, the temperature is raised to 240 ℃ at 20 ℃/min, the temperature is kept for 5min, then the temperature is raised to 280 ℃ at 10 ℃/min, and then the operation is carried out for 8min after the temperature is 320 ℃. The inlet temperature was 280 ℃ and the detector temperature was 320 ℃. The flow rate of nitrogen was 3mL/min and the split ratio was 10.
As shown in fig. 2, the gas phase detection shows a new peak with the same retention time as the eugenol standard. Further mass spectrometry analysis, as shown by the data in fig. 3, the newly synthesized product has the same ion spectrum as the eugenol standard (fig. 4), for which the newly synthesized product is eugenol. The calculated yield of eugenol synthesized by each strain is shown in table 1, and the yield of eugenol synthesized by the strain BEG1 is 207.32mg/L in 12 strains; secondly, BEG2 and BEG4 are adopted, and the yield of the eugenol is 196.30mg/L and 188.71mg/L respectively; the other strains are all low and are below 30 mg/L. The experimental data show that the combined expression of CFAT and eugenol synthetase EGS2 is more advantageous than other combinations, and the combined expression of coniferyl alcohol acyltransferase CFAT and eugenol synthetase APS1 and eugenol synthetase AIS1 is much higher than the combined expression of AT and CAAT1 and eugenol synthetase, which indicates that coniferyl alcohol acyltransferase CFAT is more suitable for the process of eugenol biosynthesis than AT and CAAT 1.
TABLE 1 fermentation results of the strains
The invention has been described in an illustrative manner, and it is to be understood that any simple variations, modifications or other equivalent changes which can be made by one skilled in the art without departing from the spirit of the invention fall within the scope of the invention.
<110> Tianjin university
<120> microbial synthesis method of eugenol
<160>11
<210>1
<211>454
<212>PRT
<213>Petunia x hybrida
<400>1
Met Gly Asn Thr Asp Phe His Val Thr Val Lys Lys Lys Glu Val Val
1 5 10 15
Ala Ala Val Leu Pro Met His His Glu His Trp Leu Pro Met Ser Asn
20 25 30
Leu Asp Leu Leu Leu Pro Pro Leu Asp Phe Gly Val Phe Phe Cys Tyr
35 40 45
Lys Arg Ser Lys Ile Asn Asn Asp Thr Lys Asp Asp Asp Glu Thr Ile
50 55 60
Lys Lys Ala Leu Ala Glu Thr Leu Val Ser Phe Tyr Ala Leu Ala Gly
65 70 75 80
Glu Val Val Phe Asn Ser Leu Gly Glu Pro Glu Leu Leu Cys Asn Asn
85 90 95
Arg Gly Val Asp Phe Phe His Ala Tyr Ala Asp Ile Glu Leu Asn Asn
100 105 110
Leu Asp Leu Tyr His Pro Asp Val Ser Val His Glu Lys Leu Ile Pro
115 120 125
Ile Lys Lys His Gly Val Leu Ser Val Gln Val Thr Gly Leu Lys Cys
130 135 140
Gly Gly Ile Val Val Gly Cys Thr Phe Asp His Arg Val Ala Asp Ala
145 150 155 160
Tyr Ser Ala Asn Met Phe Leu Val Ala Trp Ala Ala Ile Ala Arg Lys
165 170 175
Asp Asn Asn Ile Asn Thr Val Ile Pro Ser Phe Arg Arg Ser Leu Leu
180 185 190
Asn Pro Arg Arg Pro Pro Gln Phe Asp Asp Ser Phe Ile Asp Ser Thr
195 200 205
Tyr Val Phe Leu Ser Ser Pro Pro Lys Gln Pro Asn Asp Val Leu Thr
210 215 220
Ser Arg Val Tyr Tyr Ile Asn Ser Gln Glu Ile Asn Leu Leu Gln Ser
225 230 235 240
Gln Ala Thr Arg Asn Gly Ser Lys Arg Ser Lys Leu Glu Cys Phe Ser
245 250 255
Ala Phe Leu Trp Lys Thr Ile Ala Glu Gly Gly Ile Asp Asp Ser Lys
260 265 270
Arg Cys Lys Leu Gly Ile Val Val Asp Gly Arg Gln Arg Leu Arg His
275 280 285
Asp Ser Ser Thr Thr Met Lys Asn Tyr Phe Gly Asn Val Leu Ser Val
290 295 300
Pro Tyr Thr Glu Ala Ser Val Gly Gln Leu Lys Gln Thr Pro Leu Gly
305 310 315 320
Lys Val Ala Asp Leu Val His Thr Cys Leu Asp Asn Val Ala Asn Glu
325 330 335
His His Phe Pro Ser Leu Ile Asp Trp Val Glu Leu His Arg Pro Arg
340 345 350
Gln Ala Ile Val Lys Val Tyr Cys Lys Asp Glu Cys Asn Asp Glu Ala
355 360 365
Ala Ile Val Val Ser Ser Gly Leu Arg Phe Pro Leu Ser Gln Val Asn
370 375 380
Phe Gly Trp Gly Cys Pro Asp Phe Gly Ser Tyr Ile Phe Pro Trp Gly
385 390 395 400
Gly Gln Thr Gly Tyr Val Met Pro Met Pro Ser Pro Asn Lys Asn Gly
405 410 415
Asp Trp Ile Val Tyr Met His Leu Gln Lys Lys His Leu Asp Leu Val
420 425 430
Glu Thr Arg Ala Pro His Ile Phe His Pro Leu Thr Ala Cys Tyr Leu
435 440 445
Asp Leu Thr Ala Thr Tyr
450
<210>2
<211>1365
<212>DNA
<213> Artificial sequence
<400>2
atgggtaaca ccgatttcca cgtgaccgtg aagaagaaag aggtggttgc ggcggtgctg 60
ccgatgcacc acgaacactg gctgccgatg agcaacctgg atctgctgct gccgccgctg 120
gactttggcg ttttcttttg ctacaaacgt agcaagatca acaacgacac caaagacgat 180
gacgagacca ttaaaaaggc gctggcggaa accctggtga gcttctatgc gctggcgggt 240
gaggtggttt ttaacagcct gggcgagccg gaactgctgt gcaacaaccg tggtgttgat 300
ttctttcacg cgtacgcgga catcgagctg aacaacctgg atctgtatca cccggacgtg 360
agcgttcacg aaaaactgat cccgattaaa aagcacggtg tgctgagcgt gcaggttacc 420
ggcctgaagt gcggtggcat cgtggttggc tgcaccttcg atcaccgtgt ggcggacgcg 480
tacagcgcga acatgtttct ggttgcgtgg gcggcgattg cgcgtaaaga taacaacatc 540
aacaccgtga ttccgagctt ccgtcgtagc ctgctgaacc cgcgtcgtcc gccgcaattc 600
gatgacagct ttatcgatag cacctatgtt tttctgagca gcccgccgaa gcagccgaac 660
gatgtgctga ccagccgtgt ttactatatc aacagccaag agattaacct gctgcaaagc 720
caagcgaccc gtaacggtag caaacgtagc aagctggagt gcttcagcgc gtttctgtgg 780
aaaaccatcg cggaaggtgg cattgatgac agcaaacgtt gcaagctggg tattgtggtt 840
gatggccgtc agcgtctgcg tcacgacagc agcaccaccatgaagaacta cttcggtaac 900
gtgctgagcg ttccgtatac cgaagcgagc gttggtcagc tgaaacaaac cccgctgggc 960
aaggtggcgg atctggttca cacctgcctg gacaacgtgg cgaacgagca ccactttccg 1020
agcctgatcg attgggttga actgcaccgt ccgcgtcaag cgattgtgaa agtttactgc 1080
aaggatgagt gcaacgacga agcggcgatc gtggttagca gcggtctgcg tttcccgctg 1140
agccaggtga actttggttg gggctgcccg gacttcggta gctacatttt tccgtggggt 1200
ggccaaaccg gctatgttat gccgatgccg agcccgaaca agaacggcga ttggatcgtg 1260
tacatgcacc tgcaaaagaa gcacctggac ctggttgaaa cccgtgcgcc gcacattttc 1320
cacccgctga ccgcgtgcta cctggacctg accgcgacct attaa 1365
<210>3
<211>24
<212>DNA
<213> Artificial sequence
<400>3
catgccatgg gtaacaccga tttc 24
<210>4
<211>31
<212>DNA
<213> Artificial sequence
<400>4
cgcggatcct taataggtcg cgg 23
<210>5
<211>328
<212>PRT
<213>Gymnadenia x densiflora
<400>5
Met Ser Ser Gln Ile Met Thr Lys Ser Ala Ser Lys Val LeuVal Ile
1 5 10 15
Gly Ala Thr Gly Tyr Ile Gly Lys Tyr Leu Val Glu Ala Ser Val Lys
20 25 30
Leu Gly His Pro Thr Phe Ala Leu Val Arg Ser Pro Val Ile Ala Ala
35 40 45
Ser His Pro Asp Thr His Arg Ala Asp Glu Glu Gly Arg Asn Asn Leu
50 55 60
Ile Gln Ser Phe His Asn Ala Gly Val His Val Leu Phe Gly Asp Val
65 70 75 80
Asn Asp Arg Glu Val Leu Val Gly Ala Met Lys Lys Val Asp Val Val
85 90 95
Tyr Ser Ala Leu Ala His His Pro Cys Lys Leu Leu Glu Gln Gln Thr
100 105 110
His Ile Ile Ala Ala Ile Lys Gln Ala Gly Asn Ile Lys Arg Phe Phe
115 120 125
Pro Ser Glu Phe Gly Phe Asp Ile Glu Arg Gly Gln Phe Leu Glu Pro
130 135 140
Leu Lys Ser Val Leu Ala Glu Lys Ile Lys Ile Arg Glu Ala Val Arg
145 150 155 160
Lys Glu Gly Ile Pro Phe Thr Phe Val Ser Ser Asn Phe Gly Ala Thr
165 170 175
Tyr Phe Leu Ser Arg Leu Ala Gln Val Glu Ala Asp Gly Ile Pro Asp
180 185 190
Ser Thr Val Ser Ile Ile Gly Asp Gly Asn Pro Lys Ala Ile His Val
195 200 205
Asp Glu Arg Asp Ile Ala Thr Tyr Ser Ile Lys Ala Ala Asp Asp Glu
210 215 220
Arg Thr Leu Asn Lys Ile Leu Tyr Ile Arg Pro Pro Ala Asn Ile Tyr
225 230 235 240
Ser Val Asn Glu Leu Val Ser Leu Trp Glu Thr Lys Thr Asn Lys Thr
245 250 255
Leu Glu Arg Ile Tyr Val Ser Glu Glu Glu Val Leu Lys Lys Ile Asn
260 265 270
Glu Ser Pro Gly Gln Leu Pro Phe Phe Tyr Ala Val Ala Tyr Ala Gly
275 280 285
Phe Ile Lys Gly Leu Thr Thr Asn Phe Asp Ile Asp Pro Ser Ile Gly
290 295 300
Val Glu Ala Ser Ile Leu Tyr Pro Asp Val Glu Tyr Thr Thr Val Glu
305 310 315 320
Lys Phe Met Asp Arg Phe Leu
325
<210>6
<211>984
<212>DNA
<213> Artificial sequence
<400>6
atgagttctc agattatgac taaaagtgcg agcaaggtgt tggttattgg agccaccgga 60
tacatcggaa agtacctcgt ggaggctagc gttaagctgg gccaccctac cttcgccctg 120
gtgaggtcgc cggtcatcgc cgccagtcat cccgacactc accgcgccga cgaggagggc 180
aggaacaacc tcatacaatc atttcacaac gctggtgttc atgtcctatt cggtgatgtg 240
aatgatcgtg aagtgctggt tggtgcgatg aagaaggtgg atgttgtgta ctcggctttg 300
gctcatcatc cctgcaaact gcttgagcag cagactcaca tcatagctgc aattaaacag 360
gctggaaata tcaagagatt cttcccatcc gagttcggat ttgatatcga aaggggccag 420
tttctggaac ctttgaaaag cgtgttggcg gagaagataa agataagaga ggctgtgagg 480
aaggaaggca ttcccttcac tttcgtctcc tccaacttcg gagccaccta ctttctttcc 540
aggcttgcgc aggtggaagc cgacgggatt ccggactcca ccgtctccat tattggagat 600
ggaaacccta aagccataca tgtggacgag cgtgacattg ccacatattc catcaaggcg 660
gcagacgatg aaaggactct gaacaaaata ttatacataa ggccgcccgc caacatctac 720
tccgtcaatg aactcgtgtc gctttgggag acgaagacga acaaaacact cgaaagaata 780
tatgtttccg aagaagaagt cttgaaaaag ataaatgaat ctcctgggca actgcctttc 840
ttttacgcag tcgcgtatgc cggattcatc aagggactaa cgacaaattt cgacatagat 900
ccatcaatcg gagtcgaggc ctccatcctc tacccagatg tcgaatacac taccgtcgag 960
aagtttatgg accgctttct ataa 984
<210>7
<211>27
<212>DNA
<213> Artificial sequence
<400>7
ggaattccat atgagcagcc agatcat 27
<210>8
<211>30
<212>DNA
<213> Artificial sequence
<400>8
ggggtacctt acagaaaacg atccatgaat 30
<210>9
<211>927
<212>DNA
<213> Artificial sequence
<400>9
atggcacaga agagcaagat tttgatcatt ggaggcactg gctatattgg caaattcgtt 60
gttgaagcaa gcgctaaggc tggccgtcct acctttgcat tagttagaga aagcactgtt 120
tctgaccctg ttaaaggaaa gcttattgca aacttcaaga atttgggtgt caatattctc 180
catggagatc tcaatgatca cgagagctta gtgaaggcaa ttaagaaggt ggatgtggtc 240
atttctacag taggcaactt tcagatagct gatcaagtca agattattgc tgctatcaaa 300
gcggctggaa atgtcaagag atttttccct tcagaatttg gaaacgacgt tgaccgaacc 360
catgctgtgg aaccagcaaa atctacattt gaaatgaagg ctcaactccg cagaactatt 420
gaggcagaag ggatccctta cacttatgtg tcgtccaatt tctttgccgg ttatttcttg 480
cctgtattgg gacaggtagg agtcactgct ccccctagag acaaagtcac cattttaggg 540
gatgggaatc aaaaggctgt tttcaacaag gaagatgata ttggaacata cacaatccga 600
gctgctgatg atccaagaac attgaataag atcctttaca ttaggcctcc tcggaatacc 660
tactcaatga atgagcttgt tgccctgtgg gagaagaaaa ttggcaaaac tcttgaaaag 720
acttacgttc cagaggagca gcttctaaag aacattcaag aggccgaaat accatggaat 780
gttgtgttag caatcaacca ttccgtcttt gtaaagggtg atcataccaa cttcgcgatc 840
aaaccatctt tcggcgtcga ggcctccgag ctttatcccg atgtcaagta taccactgtt 900
gaggagtacc ttagtcagtt tgtttaa 927
<210>10
<211>324
<212>PRT
<213>Pimpinella anisum
<400>10
Met Gly Ser Ile Glu Gln Lys Ser Arg Ile Leu Val Phe Gly Gly Thr
1 5 10 15
Gly Tyr Ile Gly Asn Phe Ile Val Lys Ala Cys Val Ala Ala Gly His
20 25 30
Pro Thr Tyr Val Tyr Val Arg Pro Met Lys Pro Asp His Asn Pro Ser
35 40 45
Lys Leu Asp Val Leu Asn Glu Tyr Lys Ser Leu Gly Val Thr Ile Phe
50 55 60
Glu Gly Glu Leu Asp Glu His Glu Lys Leu Val Asp Val Leu Arg Gln
65 70 75 80
Val Asp Ile Val Ile Val Thr Leu Ala Ile Pro Gln Cys His Glu Gln
85 90 95
His Lys Ile Ile Glu Ala Met Lys Glu Ala Gly Asn Ile Lys Arg Phe
100 105 110
Ile Pro Ser Glu Phe Gly Asn Asp Val Asp Arg Ile Ser Pro Leu Pro
115 120 125
Pro Phe Gln Glu Gly Val Cys Lys Ile Lys Lys Gly Val Arg Arg Ala
130 135 140
Ala Glu Lys Ser Gly Ile Pro Tyr Thr Phe Val Ser Ser Asn Ser Cys
145 150 155 160
Gly Ala Tyr Phe Val Asn Phe Leu Leu Arg Pro Ser Asp Glu Lys Leu
165 170 175
Arg Lys Val Thr Val Tyr Gly Thr Gly Glu Ala Lys Phe Pro Leu Asn
180 185 190
Tyr Glu Lys Asp Ile Ala Glu Tyr Thr Leu Arg Leu Ala Thr Asp Pro
195 200 205
Arg Ala Ala Asn Ser Leu Val Phe Tyr Arg Pro Pro Lys Asn Ile Val
210 215 220
Ser Gln Leu Asp Leu Ile Ser Ser Trp Glu LysLys Thr Gly Arg Thr
225 230 235 240
Leu Glu Lys Thr Tyr Val Ser Glu Glu Glu Ile Ile Lys Leu Ser Gln
245 250 255
Thr Ala Ser Thr Val Gln Asp Ala Val Gly Thr Ser Ile Leu His Ser
260 265 270
Ile Phe Val Lys Gly Glu Gln Met Asn Phe Glu Leu Lys Glu Asp Glu
275 280 285
Leu Glu Val Ser Lys Leu Tyr Pro Asp Tyr Lys Tyr Thr Ser Val Asp
290 295 300
Glu Leu Leu Asp Ile Phe Leu Val Asp Pro Pro Lys Pro Ala Ser Ala
305 310 315 320
Ala Phe Gly
<210>11
<211>972
<212>DNA
<213> Artificial sequence
<400>11
atgggttcta ttgagcagaa aagcaggata cttgtatttg gaggaaccgg ttatattggt 60
aatttcatag taaaagcatg cgttgcagct ggtcatccaa cttatgttta tgttcgtccg 120
atgaaacctg atcataatcc ctccaagtta gacgttctca acgaatataa atcccttgga 180
gttaccattt tcgagggaga actcgatgaa catgagaagc tcgtggatgt gctccgtcag 240
gtagacatcg ttattgtgac attagcaata cctcaatgcc atgaacaaca caaaataata 300
gaagccatga aagaagctgg caacataaag agatttattc cttcagaatt tggaaatgac 360
gtggatagga ttagtccatt gccaccgttt caagaagggg tctgtaaaat caagaaagga 420
gtcagaaggg ccgctgaaaa atctggaata ccttacactt ttgtttcctc aaactcatgt 480
ggagcatatt ttgttaattt cttgcttcgt ccctctgatg aaaagctccg caaagttact 540
gtctatggga ctggtgaagc taaatttccg ttgaactacg aaaaagacat agctgaatat 600
acactgaggc tcgcaacaga tccacgagca gcaaatagct tggttttcta caggcctcca 660
aagaatatag tctcacagtt agatttgatt tcaagctggg agaaaaaaac tggacgtact 720
ctggaaaaga catacgtctc tgaggaagaa atcatcaagc tctctcagac ggcctctact 780
gtgcaggatg ctgtggggac atccatactt catagcattt tcgtaaaagg tgagcagatg 840
aattttgagc tgaaagagga tgagttagaa gtatctaagc tttatccaga ctacaagtat 900
acatcagttg atgaacttct tgatattttt ctggttgatc caccaaaacc agcatcagct 960
gctttcgggt ag 972
Claims (7)
1. A microbial synthesis method of eugenol is characterized in that coniferyl alcohol acyltransferase CFAT and eugenol synthetase EGS2 are expressed in a combined mode, and the coniferyl alcohol is used as a substrate to directly synthesize the eugenol.
2. The microbial synthesis method of eugenol according to claim 1, wherein the amino acid sequence and gene sequence of coniferyl alcohol acyltransferase CFAT are shown as SEQ ID No.1 and SEQ ID No.2, respectively, and the amino acid sequence and gene sequence of eugenol synthase EGS2 are shown as SEQ ID No.5 and SEQ ID No.6, respectively.
3. A microbial synthesis method of eugenol is characterized in that coniferyl alcohol acyltransferase CFAT and eugenol synthetase APS1 are expressed in a combined mode, and the coniferyl alcohol is used as a substrate to directly synthesize the eugenol.
4. The microbial synthesis method of eugenol according to claim 3, wherein the amino acid sequence and gene sequence of coniferyl alcohol acyltransferase CFAT are shown as SEQ ID No.1 and SEQ ID No.2, respectively, and the gene sequence of eugenol synthase APS1 is shown as SEQ ID No. 9.
5. A microbial synthesis method of eugenol is characterized in that coniferyl alcohol acyltransferase CFAT and eugenol synthetase AIS1 are expressed in a combined mode, and the coniferyl alcohol is used as a substrate to directly synthesize the eugenol.
6. The microbial synthesis method of eugenol according to claim 5, wherein the amino acid sequence and the gene sequence of coniferyl alcohol acyltransferase CFAT are shown as SEQ ID No.1 and SEQ ID No.2, respectively, and the amino acid sequence and the gene sequence of eugenol synthase AIS1 are shown as SEQ ID No.10 and SEQ ID No.11, respectively.
7. The coniferyl alcohol acyltransferase CFAT is combined with eugenol synthetase EGS2 or APS1 or AIS1, coniferyl alcohol is used as a substrate, and the application in the synthesis of eugenol is realized.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010524389.5A CN111718966A (en) | 2020-06-10 | 2020-06-10 | Microbial synthesis method of eugenol |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010524389.5A CN111718966A (en) | 2020-06-10 | 2020-06-10 | Microbial synthesis method of eugenol |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111718966A true CN111718966A (en) | 2020-09-29 |
Family
ID=72566371
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010524389.5A Pending CN111718966A (en) | 2020-06-10 | 2020-06-10 | Microbial synthesis method of eugenol |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111718966A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100031398A1 (en) * | 2006-07-07 | 2010-02-04 | Washington State University | Genes encoding chavicol/eugenol synthase from the creosote bush larrea tridentata |
-
2020
- 2020-06-10 CN CN202010524389.5A patent/CN111718966A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100031398A1 (en) * | 2006-07-07 | 2010-02-04 | Washington State University | Genes encoding chavicol/eugenol synthase from the creosote bush larrea tridentata |
Non-Patent Citations (10)
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8703454B2 (en) | Method for producing (+)-zizaene | |
| CN112795551B (en) | High Wen Ni-resistant transcriptase mutant and application thereof | |
| CN112176000A (en) | Process for producing aromatic alcohols | |
| CN110283805B (en) | Monascus purpureus ester synthetase LIP05, encoding gene and application thereof | |
| CN112795546B (en) | High-temperature-resistant reverse transcriptase mutant with high reverse transcription efficiency and application thereof | |
| CN113652385B (en) | Construction method and application of microorganism for high-yield lactoyl-N-tetraose | |
| CN109852644B (en) | Method for preparing intermediate of brivaracetam | |
| CN113136373A (en) | Novel carbon glycoside glycosyltransferase and application thereof | |
| KR101521045B1 (en) | Recombinant microorganisms for producing organic acids | |
| JPWO2005105991A1 (en) | AMP deaminase derived from actinomycete and use thereof | |
| KR20200134333A (en) | Biosynthetic pathway engineered for histamine production by fermentation | |
| CN110283806B (en) | Monascus purpureus ester synthetase LIP05-50, encoding gene and application thereof | |
| TWI500767B (en) | Isopropyl alcohol-producing bacterium with high productivity | |
| MXPA01011766A (en) | Mutant 1,3-propanediol dehydrogenase. | |
| CN111718966A (en) | Microbial synthesis method of eugenol | |
| CN114480337B (en) | Reverse transcriptase mutant and reverse transcription method | |
| CN114174506B (en) | Linalool synthase | |
| CN112795549B (en) | Reverse transcriptase mutant | |
| CN114908129A (en) | Dehydrogenase for preparing (R) -4-chloro-3-hydroxybutanoate ethyl ester | |
| KR20220126740A (en) | Biosynthetic Platform for Production of Olivetolic Acid and Olivetolic Acid Analogs | |
| WO2005123921A1 (en) | Novel glycerol dehydrogenase, gene therefor, and method of utilizing the same | |
| CN113502278A (en) | Enzyme composition and application thereof in naringenin biosynthesis | |
| JP6989746B2 (en) | Mutant 2-deoxy-scyllo-inosource synthase | |
| CN113122563A (en) | Method for constructing R-3-aminobutyric acid production strain | |
| EP1080205B1 (en) | Guava (psidium guajava)) 13-hydroperoxide lyase and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20200929 |
|
| WD01 | Invention patent application deemed withdrawn after publication |