CN111718931B

CN111718931B - Label and method for simultaneously visualizing DNA, mRNA and protein of gene in living cell

Info

Publication number: CN111718931B
Application number: CN202010553835.5A
Authority: CN
Inventors: 陈宝惠; 徐海月; 邹炜
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2020-06-17
Filing date: 2020-06-17
Publication date: 2021-12-07
Anticipated expiration: 2040-06-17
Also published as: CN111718931A

Abstract

The invention discloses a triple label and a method for simultaneously visualizing DNA, mRNA and protein of a gene in a living cell. The label comprises a CRISPR-Tag DNA sequence consisting of 12 TS1 repeated units, an MS2 DNA sequence consisting of 12 MS2V5 unit sequences and a blue fluorescent protein sequence containing an intron. The DNA sequence is short in length and can be inserted into the N end or the C end of the target protein coding gene in a CRISPR-Cas9 mediated gene recombination mode; the preparation method comprises the steps of firstly preparing a TriTag label, constructing a visual stable cell line, then constructing a visual system of a target endogenous gene, transfecting and sorting, and finally realizing dynamic imaging of living cells. The TriTag can be labeled, realizes the dynamic imaging of chromatin, can visually visualize the chromatin dynamics and gene expression of endogenous specific target genes, is favorable for the integration and analysis of data, and helps to analyze the dynamic regulation mechanism of gene expression.

Description

Label and method for simultaneously visualizing DNA, mRNA and protein of gene in living cell

Technical Field

The invention relates to a method for establishing a TriTag marker imaging system in the field of biotechnology, in particular to a label and a method for simultaneously visualizing DNA, mRNA and protein of a gene in a living cell, and realizes real-time imaging and analysis of gene expression regulation.

Background

Gene expression is the process of transmitting genetic information from gene to protein, transcription and translation are two key steps of gene expression, and the whole process is tightly regulated. However, few studies have visualized the entire gene expression regulation process: that is, in living cells, DNA, mRNA and protein of the gene are visualized simultaneously, and the expression level of the gene is controlled at the chromatin level, so that the spatiotemporal control of the protein expression level is realized.

There has been much work done to visualize RNA in living cells. In these works, the MS2 phage capsid protein binding site (MS2) was localized to either the 5 'noncoding region or the 3' noncoding region of the gene, both locations enabling visualization of mature mRNA and nascent RNA simultaneously. However, work has shown that the insertion of the MS2 sequence into the 5' non-coding region of a gene affects gene expression to some extent. Therefore, in combination with the above two aspects, the prior art cannot intuitively and objectively capture the dynamic change of the gene transcription level in real time.

One published work has used exogenous reporter gene systems to visualize the entire gene expression regulation process in living cells: i.e. visualizing DNA, mRNA and protein of the gene simultaneously. The exogenous reporter gene is connected with 3 elements in series: (1)256 copies of LacO sequence to visualize the DNA of the gene; (2)24 copies of the MS2 sequence to visualize the mRNA; (3) cyan Fluorescent Protein (CFP) to visualize the protein of interest. This work visualizes both mature mRNA and nascent RNA, and therefore does not clearly capture the production of nascent RNA and quantitatively analyze transcriptional dynamics. In addition, the total length of DNA of 3 elements of the report system reaches 20kb, and the report system can only be used as an exogenous report gene, thereby limiting the application of the technology to a certain extent.

Therefore, the prior art lacks a living cell imaging technology which can be widely used and can realize the visualization of DNA, mRNA and protein of genes, and lacks a gene visualization tool which can better study the expression regulation of endogenous genes and provide powerful research work for disease pathology, regenerative medicine and the like.

Disclosure of Invention

In order to solve the bottlenecks and problems of the background art, the present invention aims to provide a label and an imaging method that can be widely used and can simultaneously visualize DNA, mRNA and protein of an endogenous gene. The invention is mainly applied to the visualization work of gene expression regulation.

Therefore, the technical scheme adopted by the invention is as follows:

a TriTag label for simultaneously visualizing DNA, mRNA and protein of a gene in a living cell is composed of three parts of DNA sequences:

for gene visualizationThe CRISPR-Tag DNA sequence of (1), TS1 consisting of 12 TS1 repeating units_12xA DNA sequence, such as SEQ ID No.1, as a CRISPR-Tag DNA sequence for assembling a Tritag label; the CRISPR-Tag DNA sequence for gene visualization is a living cell gene visualization label by combining dCas9-GFP_14xThe fluorescent fusion protein realizes gene visualization.

The MS2 DNA sequence for RNA visualization consists of 12 MS2V5 unit sequences, such as SEQ ID No.2, as the MS2 DNA sequence for assembling a TriTag label;

the blue fluorescent protein sequence containing the intron, such as SEQ ID No.5, used for protein visualization is formed by inserting a segment of intron sequence, such as SEQ ID No.4, into the blue fluorescent protein sequence, such as SEQ ID No.3, and can visualize the nascent RNA generated by the target endogenous gene.

The TriTag label is a DNA/RNA double-visualized sequence formed by alternately inserting 12 TS1 repetitive unit sequences and 12 MS2V5 unit sequences into a sequence of SEQ ID No.6, and then the double-visualized sequence is inserted into an intron in a blue fluorescent protein sequence containing the intron by an enzyme digestion connection method to form the TriTag label of SEQ ID No. 7.

Secondly, a method for simultaneously visualizing DNA, mRNA and protein of genes in living cells:

(ii) (a) preparing a TriTag tag constructed according to any one of claims 1-2;

and (II) simultaneously visualizing the DNA, mRNA and protein of the target endogenous gene in the living cell by adopting the TriTag label.

(1) Constructing a visual stable cell line:

(1.1) on the day, culturing HEK293T cells by using a PS-free culture medium and paving the cells into a 12-well plate to form a first cell culture medium, wherein the HEK293T cells are added at a concentration which enables the cell density on the next day to be more than 80%;

(1.2) the following day, lentivirus packaging was performed: 750ng of each dCas9-GFP were pre-mixed with 75. mu.l of serum-reduced medium (Opti-medium)_14xThe virus expression plasmid and stdMCP-tdTomato virus expression plasmid, 705ng pCMV-dR8.91 plasmid and 87ng PMD2.G plasmid were added, and 4.5. mu.l Fugene transientForming liposome by using a transfection reagent (Promega), dripping the liposome into the supernatant of a first cell culture medium, and performing transient transfection on HEK293T cells in the first cell culture medium to prepare cells containing virus particles;

(1.3) after 12 hours of transient transfection in step (1.2), aspirating the first cell culture medium supernatant and replacing the first cell culture medium with fresh medium;

(1.4) culturing the cells to be infected 48 hours after transient transfection in the step (1.2) and paving the cells to be infected into a 24-well plate to form a second cell culture medium, wherein the concentration of the cells to be infected can enable the next day cell density to reach about 60%;

(1.5) after 24 hours of forming the second cell culture medium, sucking the first cell culture medium supernatant obtained by replacing the fresh culture medium in the step (1.3), then placing the first cell culture medium supernatant into a centrifuge for 8 minutes at the rotating speed of 800g, taking the supernatant after centrifugation, and extracting the cell supernatant containing viruses;

(1.6) preparing a PS-free culture medium containing a gene transfection enhancer (polybrene) with the concentration of 5 mug/mL as a third culture medium to replace a second cell culture medium, so that the cells to be infected are cultured and transferred to the third culture medium, and then taking 30-90 mul of cell supernatant containing viruses to be dripped into the third culture medium supernatant of the cells to be infected to obtain infected cells; the cells to be infected are cells to be infected by virus, and are experimental samples in specific experiments, and human HeLa cells are adopted as the experimental samples in the experiments.

(1.7) after 12 hours of infection in the step (1.6), replacing a fresh culture medium for the third culture medium of the infected cells, continuing culturing until the third culture medium can be passaged to an 8-well plate for microscope imaging observation, screening a cell infected population according to the fluorescence intensity and the infection efficiency, and separating single cell clones of a 96-well plate;

the screening of the single cell clone specifically screens out cell infected groups with proper fluorescence intensity and higher infection efficiency: selecting cells in a single hole of the pore plate with the reserved fluorescence intensity smaller than the first fluorescence intensity threshold, and otherwise, removing the cells; and meanwhile, selecting the cells in a single hole of the pore plate with the reserved infection efficiency larger than the infection efficiency threshold, and otherwise, removing the cells. The infection efficiency threshold is typically 30-40%.

(1.8) when the cells in the single hole of the 96-hole plate grow to a cell group state, observing the fluorescence intensity under a microscope, and screening single-cell clone;

and specifically, screening the cells in the single hole of the pore plate with the retained fluorescence intensity larger than the second fluorescence intensity threshold, and otherwise, removing the cells.

(2) Constructing a target endogenous gene visualization system in a stable cell line, and carrying out transfection and sorting;

(3) simultaneously visualizing the DNA, mRNA and protein of the target endogenous gene and live cell dynamic imaging.

The step (one) is as follows:

s1, designing and constructing a blue fluorescent protein sequence containing an intron:

adopting the 4 th intron sequence of the human HSPA5 gene, adding BstXI restriction enzyme cutting sites in the intron sequence, and directly synthesizing by a nucleic acid synthesis mode;

s2, designing and synthesizing a DNA/RNA double visualization sequence:

alternately interleaving 12 TS1 repeating unit sequences and 12 MS2V5 unit sequences for 12 times by means of nucleic acid synthesis;

s3, building a TriTag label: and (3) inserting the DNA/RNA double-visual sequence into an intron of a blue protein sequence containing the intron by using an enzyme digestion connection method to obtain a TriTag label, and particularly inserting the TriTag label into a BstXI enzyme digestion site of the intron sequence. Under the condition that the TriTag label obtained by the assembly is fused and expressed with a target endogenous gene protein, the chromatin dynamics and the transcription level change of the target endogenous gene can be visualized.

The step (2) is specifically as follows:

(2.1) according to the condition of a target endogenous gene, designing and constructing a HDR repair template plasmid which is specific in gene and contains a TriTag label and an sgRNA expression plasmid for targeting the target endogenous gene to carry out knock-in editing of cells, and inserting the TriTag label into the N end or the C end of the target endogenous gene through knock-in editing;

(2.2) culturing the cell to be edited by using a PS-free culture medium and paving the cell to a 24-well plate to form a fourth cell culture medium, wherein the adding concentration of the cell can enable the cell density of the next day to reach more than 80%;

(2.3) on the day after 24 hours from the start of the culturing in step (2.2), premixing 500ng of sgRNA expression plasmid for targeting the target endogenous gene, 100ng of Cas9 protein expression plasmid and 400ng of HDR repair template plasmid with 40 μ l of serum-reduced medium (Opti-medium), adding 2.4 μ l of Fugene transient transfection reagent (Promega) to form liposomes, slowly adding dropwise to the supernatant of the fourth cell culture medium, and transiently transfecting the cells to be knottin-editing;

(2.4) performing cell flow sorting after the transient transfection for 96 hours, recovering the BFP fluorescence expression positive cells during the cell flow sorting, continuously culturing, and discarding the rest. I.e., cell retention in the cell channel that exhibits a fluorescent blue color.

The cell to be knock-in edited refers to a working cell of a visualization system.

The specific construction method and process of the HDR repair template plasmid are as follows:

(1) selecting the N end or the C end of the protein as an insertion site of a TriTag label through protein structure prediction;

(2) extracting a human HeLa cell genome, amplifying homologous arm sequences at two sides of an N end or a C end of a human target gene by using a PCR (polymerase chain reaction) method, namely a5 'homologous arm sequence and a 3' homologous arm sequence, wherein the length of the homologous arm sequences is about 500bp, and then inserting a TriTag label between the homologous arm sequences at two sides in a homologous recombination mode to form a tandem sequence of the 5 'homologous arm sequence-TriTag label-3' homologous arm sequence as an HDR (high-density lipoprotein lipase) repair template plasmid. The result after preparation is shown in SEQ ID No. 8.

The step (3) is specifically as follows:

(3.1) culturing the cells obtained by sorting in the step (2) by using a PS-free culture medium and paving the cells into an 8-well plate to form a fifth cell culture medium, wherein the adding concentration of the cells can enable the cell density of the next day to reach about 60%;

(3.2) on the day after 24 hours from the start of the culture in step (3.1), 500ng of TS1-sgRNA expression plasmid was premixed with 25. mu.l of serum-reduced medium (Opti-medium), and after liposome formation with the addition of 1.2. mu.l of Fugene transient transfection reagent (Promega), cells were transiently transfected by slowly dropping into the fifth cell culture supernatant;

(3.3) after 24 hours from the completion of step (3.2), the cells obtained in step (3.2) were placed in a microscope, the microscope was adjusted to specific environmental conditions, and the imaging parameters of the microscope were set for live cell imaging visualization.

In a specific implementation, the microscope live cell workstation settings were adjusted to a temperature of 37 ℃ and contained 5% by volume CO₂。

The microscope comprises a microscope living cell workstation, a microscope light source and an imaging camera, the microscope living cell workstation is adjusted to a specific environmental condition, and living cell imaging visualization is carried out by setting and adjusting the laser intensity of the microscope light source and the exposure time of the imaging camera.

In the step (3.3), the DNA of the target endogenous gene itself is displayed in green, mRNA produced by transcription of the target endogenous gene is displayed in red, and protein produced by translation of the target endogenous gene is displayed in blue.

Therefore, the invention can observe the transcriptional dynamic regulation of the gene in real time in a living cell state through the fusion of the TriTag label and the target endogenous gene.

The DNA sequence of the tag of the invention is about 1.5kb in length, and can be inserted into the N-terminal or C-terminal of a specific protein encoding gene through a CRISPR-Cas9 mediated gene recombination mode. The label is small and relatively easy to handle. At the DNA level, TriTag can be labeled with dCas9-GFP14x, thereby enabling dynamic imaging of chromatin. The target gene is transcribed into new mRNA, and can be recorded in real time through an MCP-FP system; mRNA is translated into fluorescent fusion protein, so that subcellular localization imaging of the target protein is facilitated. Therefore, the invention can visually visualize the chromatin dynamics and the gene expression of the endogenous specific target gene, is beneficial to the integration and analysis of data and helps to analyze the dynamic regulation and control mechanism of the gene expression.

Compared with the prior art, the invention has the beneficial effects that:

1. the TriTag label with shorter length is beneficial to the occurrence of a knock-in editing process mediated by a CRISPR-Cas9 system, so that the visualization of DNA, mRNA and protein of an endogenous gene is realized, an exogenous reporter gene system is developed to the endogenous gene, and the application range of a visualization system is expanded;

2. after the intron of the nascent RNA is removed by an RNA shearing mechanism, mature mRNA is formed by a subsequent processing process. The MS2 DNA sequence is placed in an intron of TriTag, so that the nascent RNA can be visualized intuitively, and the quantification of transcription level change is more accurate;

3. the design and use strategy of the TriTag label does not obviously influence the expression of the protein of the gene product, so that the gene regulation process can be visualized under the condition of not influencing the normal expression of the gene;

4. the DNA, mRNA and protein of the gene are visualized simultaneously, the gene expression regulation and control process can be observed and researched more carefully, and an important technical method is established for analyzing the relationship between chromatin dynamics and gene expression regulation and control.

Drawings

Fig. 1 is a schematic diagram of the design and construction of a TriTag tag. Subfigure 1(a) inserting the 4 th intron sequence of the human HSPA5 gene into the blue fluorescent protein sequence by nucleic acid synthesis to obtain the blue fluorescent protein sequence containing intron for protein visualization; subgraph 1(b) the TS112x sequence for gene DNA visualization and the MS2V512x sequence for RNA visualization were assembled into a DNA/RNA double visualization sequence by nucleic acid synthesis; subgraph 1(c) inserts a DNA/RNA double visualization sequence into an intron region in a blue fluorescent protein sequence containing an intron by enzyme digestion ligation to obtain a TriTag tag.

FIG. 2 is a technical route for simultaneously visualizing target endogenous gene DNA, mRNA and protein in living cells by using TriTag tags. Sub-figure 2(a) obtains virus particles in HEK293T cells by lentivirus packaging, and then obtains a stable cell line capable of expressing dCas9-GFP14x and stdMCP-tdTomato by lentivirus infection and screening of single cell clones; FIG. 2(b) is a schematic diagram of HDR repair template plasmid containing TriTag tag; sub-graph 2(c) constructs a target endogenous gene visualization system in a stable cell line by knock-in editing and cell flow sorting, namely positive cells obtained after TriTag label knock-in editing is carried out on the target endogenous gene; panel 2(d) transient transfection and microscopic imaging of the TS1-sgRNA expression plasmid, while visualizing DNA, mRNA and protein of the endogenous gene of interest and live cell dynamic imaging.

Fig. 3 is a result of simultaneously visualizing DNA, mRNA, and protein of the human histone H2B gene and the nuclear membrane protein LMNA gene using a visualization system. FIG. 3(a) is a schematic diagram of HDR repair template containing TriTag label, specific to H2B gene and LMNA gene; subgraph 3(b) is the visualization result of two genes; FIG. 3(c), is a diagram showing the co-localization analysis of mRNA (red) and gene DNA (green) signals in FIG. 3 (b); panel (d) is a cell flow analysis of protein expression in two gene-visualized cell lines.

Fig. 4 is an analysis of the transcriptional burst pattern of the human histone H2B gene and the nuclear membrane protein LMNA gene using the TriTag system, and an example graph is drawn for both transcriptional patterns. FIG. 4(a) shows the result of mRNA imaging of the human histone H2B gene and the nuclear membrane protein LMNA gene.

FIG. 5 is a TriTag system used for simultaneously visualizing human nuclear membrane protein LMNA gene DNA, mRNA and protein, and then performing correlation analysis on transcription level and movement state of chromatin region where gene locus is located. Subgraph 5(a) is the visualization result of the human nuclear membrane protein LMNA gene; sub-diagram 5(b) is the motion trail of two gene loci obtained after a pair of LMNA allelic gene loci at different transcription levels are tracked for a short time; sub-graph 5(c) is two MSD curves obtained after analyzing the motion trajectories of a plurality of pairs of LMNA allelic loci under different transcription levels; subfigure 5(d) is two parameters obtained after performing motion state analysis on multiple pairs of LMNA allelic sites at different transcription levels: comparative analysis of the macroscopic diffusion coefficient (D) with the confined area (A).

FIG. 6 is a TriTag system used to visualize DNA, mRNA and protein of the human heat shock protein HSPA1A gene and to correlate the transcription level with the open status of the chromatin region in which the locus is located. FIG. 6(a) is a schematic diagram of a specific HDR repair template containing a TriTag tag of the HSPA1A gene; FIG. 6(b) is the result of visualizing the human heat shock protein HSPA1A gene at different heat shock durations of 42 ℃; panel 6(c) is a statistic of the fluorescence intensity of the mRNA (red) signal and the area of the DNA (green) signal at the gene locus generated by the human heat shock protein HSPA1A gene at different heat shock durations of 42 ℃.

Detailed Description

The invention is further illustrated by the following figures and examples.

The examples of the invention are as follows:

example 1:

extracting human HeLa cell genome, and obtaining a blue fluorescent protein sequence containing an intron by adopting a nucleic acid synthesis mode, as shown in figure 1 (a);

s2, TS1 screened from nematode genome capable of being efficiently targeted and edited_12xMS2V5 with reduced sequence and repeatability_12xThe sequence is formed by the way of nucleic acid synthesis, and the TS1 repeating unit and the MS2V5 repeating unit are alternately connected with each other to form a DNA/RNA double visualization sequence, as shown in figure 1 (b);

s3, building a TriTag label: the double-visualized sequence is inserted into the intron region in the blue fluorescent protein sequence containing the intron by using an enzyme digestion ligation method to obtain a TriTag tag, as shown in FIG. 1(c), specifically inserted into a BstxI restriction enzyme site of the intron sequence.

Example 2

(1) Constructing a visual stable cell line as shown in fig. 2 (a):

(1.2) the following day, lentivirus packaging was performed: 750ng of each dCas9-GFP were pre-mixed with 75. mu.l of serum-reduced medium (Opti-medium)_14xAfter the virus expression plasmid and stdMCP-tdTomato virus expression plasmid, 705ng of pCMV-dR8.91 plasmid and 87ng of PMD2.G plasmid, 4.5. mu.l of plasmid was addedForming a liposome by a Fugene transient transfection reagent (Promega), dripping the liposome into the supernatant of a first cell culture medium, and performing transient transfection on HEK293T cells in the first cell culture medium to prepare cells containing virus particles;

(1.5) on the day after 24 hours of forming the second cell culture medium, sucking the first cell culture medium supernatant obtained by replacing the fresh culture medium in the step (1.3), then placing the first cell culture medium supernatant into a centrifuge for 8 minutes at the rotating speed of 800g, taking the supernatant after centrifugation, and extracting the cell supernatant containing the virus;

(1.6) preparing a PS-free culture medium containing a gene transfection enhancer (polybrene) with the concentration of 5 mu g/mL as a third culture medium to replace a second cell culture medium, so that a cell to be infected by adopting a human HeLa cell is cultured and transferred to the third culture medium, and then 30 mu l-90 mu l of cell supernatant containing the virus is taken and dripped into the third culture medium supernatant of the cell to be infected to obtain an infected cell;

the screening of the single cell clone specifically screens out cell infected groups with proper fluorescence intensity and higher infection efficiency: selecting cells in a single hole of the pore plate with the reserved fluorescence intensity smaller than the first fluorescence intensity threshold, and otherwise, removing the cells; meanwhile, selecting the cells in a single hole of the pore plate with the preserved infection efficiency of more than 30-40%, and otherwise, removing the cells.

(1.8) when the cells in the single well of the 96-well plate grow to the state of cell groups, observing the fluorescence intensity under a microscope, and screening the single-cell clone.

(2) Constructing a target endogenous gene visualization system in a stable cell line, and carrying out transfection and sorting, as shown in FIG. 2 (c):

(2.3) on the day 12 hours after the start of the culture in step (2.2), premixing 500ng of sgRNA expression plasmid for targeting the target endogenous gene, 100ng of Cas9 protein expression plasmid and 400ng of HDR repair template plasmid with 40 μ l of serum-reduced medium (Opti-medium), adding 2.4 μ l of Fugene transient transfection reagent (Promega) to form liposomes, slowly adding dropwise to the supernatant of the fourth cell culture medium, and transiently transfecting the cells to be knottin-editing;

The cells to be knotted-in edited in this example were visualized cell lines stably expressing dCas9-GFP14x and stdMCP-tdTomato obtained by screening.

The specific construction method and process of the HDR repair template plasmid are as shown in FIG. 2 (b): and selecting the N end or the C end of the protein as an insertion site of the TriTag label through protein structure prediction.

Extracting human HeLa cell genome, and amplifying homologous arm sequences (namely 5 'homologous arm sequence and 3' homologous arm sequence) at two sides of N end (or C end) of a human target gene by using a PCR method, wherein the length of the homologous arm sequences is about 500 bp. And then inserting the TriTag tag between the homologous arm sequences on two sides by adopting a homologous recombination mode to form a series sequence of a5 'homologous arm sequence-TriTag tag-3' homologous arm sequence.

The result after preparation is shown in SEQ ID No. 8.

(3) Simultaneously visualizing DNA, mRNA and protein of the target endogenous gene and performing live cell dynamic imaging, as shown in fig. 2 (d):

(3.3) on the day 24 hours after completion of step (3.2), the cells obtained in step (3.2) were placed in a live microscope cell station set to a temperature of 37 ℃ and containing a volume fraction of 5% CO₂。

And the microscope also comprises a microscope light source and an imaging camera, and live cell imaging visualization is carried out by setting and adjusting the laser intensity of the microscope light source and the exposure time of the imaging camera.

Finally, the target endogenous gene DNA itself appears green, mRNA produced by the target endogenous gene appears red, and protein produced by the target endogenous gene appears blue.

Example 3

(1) Constructing a target endogenous gene (human histone H2B gene and nuclear membrane protein LMNA gene) visual system in a stable cell line, and carrying out transfection and sorting:

(1.1) according to the protein structure prediction of target endogenous gene products H2B histone and LMNA nuclear membrane protein, inserting a TriTag label into the C end of human histone H2B gene, and inserting the TriTag label into the N end of human nuclear membrane protein LMNA gene. Extracting human HeLa cell genome, respectively amplifying homologous arm sequences (5 'homologous arm sequence and 3' homologous arm sequence) at both sides of C end of H2B gene or N end of LMNA gene, wherein the length of the homologous arm sequences is about 500 bp. And constructing an HDR repair template of the 5 'homologous arm sequence-TriTag tag-3' homologous arm sequence by adopting a homologous recombination mode. As shown in fig. 3 (a).

(1.2) Tritag tag knock-in editing was performed on the human histone H2B gene and the nuclear membrane protein LMNA gene as in the steps (2.2) to (2.4) in example 2, and BFP fluorescent protein expression positive cells were sorted by cell flow.

(2) Simultaneously visualizing the DNA, mRNA and protein of the target endogenous gene and performing dynamic imaging of living cells:

(2.1) culturing and paving the cells (positive cells obtained after Tritag label knock-in editing of human histone H2B gene and nuclear membrane protein LMNA gene) obtained by sorting in the step (1) into an 8-hole plate by using a PS-free culture medium to form a fifth cell culture medium, wherein the adding concentration of the cells can enable the cell density of the next day to reach about 60%;

(2.2) on the day after 24 hours from the start of the culture in step (2.1), 500ng of TS1-sgRNA expression plasmid was premixed with 25. mu.l of serum-reduced medium (Opti-medium), and after liposome formation with the addition of 1.2. mu.l of Fugene transient transfection reagent (Promega), cells were transiently transfected by slowly dropping into the fifth cell culture supernatant;

(2.3) on the day 24 hours after completion of step (2.2), the cells obtained in step (2.2) were placed in a live microscope cell station set to a temperature of 37 ℃ and containing a volume fraction of 5% CO₂. For the human histone H2B gene, 561 laser intensity was set to 10%, exposure time was 100ms, 488 laser intensity was set to 20%, exposure time was 100ms, 405 laser intensity was set to 10%, exposure time was 100 ms; for the human nuclear membrane protein LMNA gene, 561 laser intensity is set as 10%, and exposure time isThe laser intensity was set at 20% for 100ms and 488, the exposure time was 100ms, the laser intensity was set at 10% for 405, and the exposure time was 100 ms. The results are shown in FIG. 3 (b). In the figure, the DNA of the target endogenous gene itself is shown in green, the mRNA produced by the target endogenous gene is shown in red, and the protein produced by the target endogenous gene is shown in blue.

(2.4) the co-localization analysis of the DNA and mRNA signals of the endogenous gene of the cell shown in FIG. 3(b) was carried out by ImageJ analysis software, and the results are shown in FIG. 3 (c). The figure shows that the green color displayed by DNA can co-localize with the red color displayed by mRNA: the fluorescence intensity peaks at the same position.

(3) The visualization system establishes comparative analysis of gene protein expression conditions in cells:

and (3) collecting the cells obtained by sorting in the step (1) (positive cells obtained after Tritag label knock-in editing of human histone H2B gene and nuclear membrane protein LMNA gene) and performing flow cytometry analysis, as shown in figure 3 (d). The figure shows that the insertion of TriTag has no influence on gene expression.

Therefore, the invention can observe the transcriptional dynamic regulation of the gene in real time under the condition of not influencing the gene expression by fusing the TriTag label and the target endogenous gene.

Example 4

(1) Visualization of target endogenous gene mRNA and live cell dynamic imaging:

(1.1) culturing the positive cells obtained by sorting in the step (1) in the above example 3, paving the cells on an 8-well plate, and paving the plates the next day to obtain dynamic images of living cells for a long time so as to visualize the mRNA production and change conditions of two genes in the long time: the microscope live cell workstation settings were adjusted to a temperature of 37 ℃ and to contain 5% by volume of CO₂(ii) a For human histone H2B gene, 561 laser intensity is set as 10%, exposure time is 100ms, total shooting time is 2 hours, and shooting interval is 1 minute; for the human nuclear membrane protein LMNA gene, 561 laser intensity is set as 10%, exposure time is 100ms, total shooting time is 3 hours, and shooting interval is 2 minutes.

(1.2) As shown in FIG. 4(a), the fluorescence intensity of the mRNA signal at each time point in the long-term imaging process is plotted as a line graph which changes with time, and thus the transcription dynamics of the two genes can be quantified. As shown, both genes, although housekeeping, are transcribed in an intermittent burst mode: i.e., alternating transcription-non-transcription patterns.

The result shows that the TriTag visualization system can realize simultaneous marking of the DNA, mRNA and protein of the endogenous gene without influencing the gene expression, can visually present the transcription dynamics of the endogenous gene, and is more favorable for analyzing the transcription burst mode of the gene and the transcription regulation mechanism of the gene.

Example 5

(1) A visual system of an endogenous gene of interest (human nuclear membrane protein LMNA gene) was constructed in a stable cell line and sorted by transfection as in (1) in example 3.

(2) Simultaneously visualizing target endogenous gene DNA, mRNA and protein and performing live cell dynamic imaging:

(2.1) culturing the cells obtained by sorting in the step (1) (positive cells obtained after Tritag label knock-in editing of human nuclear membrane protein LMNA genes) by using a PS-free culture medium and paving the cells into an 8-hole plate to form a fifth cell culture medium, wherein the addition concentration of the cells can enable the cell density of the next day to reach about 60%;

(2.3) on the day 24 hours after completion of step (2.2), the cells obtained in step (2.2) were placed in a live microscope cell station set to a temperature of 37 ℃ and containing a volume fraction of 5% CO₂. For the human nuclear membrane protein LMNA gene, 561 laser intensity was set to 10%, exposure time was 100ms, 488 laser intensity was set to 20%, exposure time was 100ms, 405 laser intensity was set to 10%, and exposure time was 100 ms. The results are shown in FIG. 5 (a). It is shown that in this cell, the two allelic positions of the human nuclear membrane protein LMNA geneThe dots are all visualized and displayed as green; the nascent RNA produced by the LMNA gene is shown in red, the two allelic loci are shown in different transcription states (i.e., not transcribed; ii.e., transcribed), and the nuclear membrane protein produced by the LMNA gene is shown in blue.

(2.4) setting the 488 laser intensity as 40%, setting the exposure time as 100ms, turning off 561, 405 laser light source, and shooting two allelic loci of the cell human nuclear membrane protein LMNA gene in short time and without interval: the total shooting time is 1 minute and 33 seconds, the shooting interval is 0.25 seconds, and 400 frames are shot in total. The green signals displayed by the two allelic loci are tracked and analyzed by an Object Tracking module of CellSens software (Olympus), and the locus motion tracks under different transcription states are obtained. As shown in fig. 5(b), the locus of the gene in the transcribed state has a compact motion trajectory and a small motion range compared to the untranscribed locus.

(2.5) tracking the human nuclear membrane protein LMNA gene allelic locus in a plurality of cells by the imaging and analyzing method to 44 pairs of allelic loci, analyzing the obtained plurality of tracks in MatLab software to obtain two Mean Square Displacement (MSD) curves in the transcription and non-transcription states, and comparing with the untranscribed loci, the locus in the transcription state has slower movement speed and smaller movement range as shown in figure 5 (c).

(2.6) analyzing the resulting plurality of traces in MatLab software by fitting the following functions:

MSD(t)＝A(1-e^-t/τ)+4D_macrot+v²t²

wherein MSD (t) represents mean square displacement, A represents the area size of the locus movement track, t represents time difference, tau represents the characteristic time constant of microscopic diffusion, and D_macroRepresents the maximum diffusion coefficient, v represents the speed of movement of the locus, and e represents the base of the natural logarithm.

Obtaining the parameters related to the movement of the gene locus under two states of transcription and non-transcription: macroscopic diffusion coefficient (D)_macro) Numerical distribution with restricted area (A), as shown in FIG. 5(d), compared to untranscribedThe gene locus in the transcription state has slow motion speed and small motion range.

The result shows that the movement state of the chromatin region where the gene locus in different transcription states is located can be observed through a TriTag visualization system, so that observation and analysis of the correlation between chromatin dynamics and transcription regulation are enriched, and the regulation mechanism of chromatin space-time dynamics change on gene expression is further understood.

Example 6

(1) Constructing a target endogenous gene (human heat shock protein HSPA1A gene) visualization system in a stable cell line and carrying out transfection and sorting:

(1.1) As shown in FIG. 6(a), the TriTag tag is selectively inserted into the C-terminal of the human heat shock protein HSPA1A gene according to the structural prediction of the target endogenous gene product HSPA1A heat shock protein. Extracting a human HeLa cell genome, respectively amplifying homologous arm sequences (5 'homologous arm sequence and 3' homologous arm sequence) on two sides of the C end of the human heat shock protein gene HSPA1A gene, and constructing an HDR repair template of the 5 'homologous arm sequence-TriTag tag-3' homologous arm sequence by adopting a homologous recombination mode.

(1.2) TriTag tag knock-in editing of the human heat shock protein HSPA1A gene was performed as in step (2) in example 2, and positive cells expressing BFP fluorescent protein were sorted by cell flow.

(2.1) culturing and paving the cells (positive cells obtained after Tritag label knock-in editing of human heat shock protein HSPA1A gene) obtained by sorting in the step (1) into an 8-hole plate by using a PS-free culture medium to form a fifth cell culture medium, wherein the addition concentration of the cells can enable the cell density of the next day to reach about 60%;

(2.3) completion of step (2.2)The day 24 hours later, the cells obtained in step (2.2) were pretreated in a 42 ℃ water bath for 30 minutes, and then placed in a microscope live cell workstation, which was set to a temperature of 42 ℃ and CO was turned off₂The supply of (2). For the human heat shock protein HSPA1A gene, 561 laser intensity was set to 10%, exposure time was 100ms, 488 laser intensity was 20%, exposure time was 100ms, 405 laser intensity was 10%, and exposure time was 100 ms. Carrying out long-time visualization: the total photographing time was 4 hours, and the photographing interval was 20 minutes. The results are shown in FIG. 6 (b). In this cell, the DNA of the human heat shock protein HSPA1A gene is shown in green, the nascent RNA produced by the HSPA1A gene is shown in red, and the HSPA1A heat shock protein produced by the HSPA1A gene is shown in blue. During the heat shock, the red signal is increased from zero to zero, and the green signal is changed from compact to loose.

(2.4) a total of 3 cells were followed by the above imaging and analysis method, and time-dependent line graphs were made for both the fluorescence intensity of the red signal visualized by the nascent RNA and the area of the green signal visualized by the gene DNA at 5 time points of 0 hour, 1 hour, 2 hours, 3 hours and 4 hours of the heat shock process. As shown in fig. 6 (c). The line chart shows that the fluorescence intensity of the red signal representing the new RNA is increased from zero to zero in the heat shock process, and the area of the green signal representing the chromatin DNA is increased from small to large, which indicates the opening of the chromatin structure state.

The result shows that the structure openness degree of the chromatin region where the gene locus is located can be directly observed when the gene locus is in different transcription levels through a TriTag visualization system, and can be associated with the corresponding transcription levels, so that the transcription regulation and control can be more carefully, comprehensively and deeply analyzed.

The nucleotide and amino acid sequences involved in the invention are as follows:

SEQ ID No.1：

name: CRISPR-Tag DNA sequence

The source is as follows: artificial Sequence (Artificial Sequence)

gcaccgatgctctccgaggaggcgtgaccgcaccgatgctctccgaggaggagcaagcaccgatgctctccga ggaggcagctgtgcaccgatgctctccgaggaggcacgggctaattcactcccaacgagcaagcaccgatgctctccga ggaggcgtgaccgcaccgatgctctccgaggaggagcaagcaccgatgctctccgaggaggcagctgtgcaccgatg ctctccgaggaggcacccttgatctgtggatctaccagaacgcaccgatgctctccgaggaggcgtgaccgcaccgatg ctctccgaggaggagcaagcaccgatgctctccgaggaggcagctgtgcaccgatgctctccgaggaggcac

SEQ ID No.2：

Name: MS2 DNA sequence

The source is as follows: artificial Sequence (Artificial Sequence)

ccggtaacctacaaacgggtggaggatcaccccacccgacacttcacaatcaaggggtacaatacacaagggtg gaggaacaccccaccctccagacacattacacagaaatccaatcaaacagaagcaccatcagggcttctgctaccaaattt atctcaaaaaactacaacaaggaatcaccatcagggattccctgtgcaatatacgtcaaacgagggccacgacgggagg acgatcacgcctcccgaatatcggcatgtctggctttcgaattcagtgcgtggagcatcagcccacgcagccaatcagagt cgaatacaagtcgactttcgcgaagagcatcagccttcgcgccattcttacacaaaccacactctcccctacaggaacagc atcagcgttcctgcccagtacccaactcaagaaaatttatgtccccatgcagcatcagcgcatgggccccaagaatacatc cccaacaaaatcacatccgagcaccaacagggctcggagtgttgtttcttgtccaactggacaaaccctccatggaccatc aggccatggactctcaccaacaagacaaaaactactcttctcgaagcagcatcagcgcttcgaaacactcgagcatacatt gtgcctatttcttgggtggac

SEQ ID No.3：

Name: blue fluorescent protein sequence

The source is as follows: artificial Sequence (Artificial Sequence)

Atgagcgagctgattaaggagaacatgcacatgaagctgtacatggagggcaccgtggacaaccatcacttcaa gtgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgagaatcaaggtggtcgagggcggccctc tccccttcgccttcgacatcctggctactagcttcctctacggcagcaagaccttcatcaaccacacccagggcatccccga cttcttcaagcagtccttccctgagggcttcacatgggagagagtcaccacatacgaagacgggggcgtgctgaccgcta cccaggacaccagcctccaggacggctgcctcatctacaacgtcaagatcagaggggtgaacttcacatccaacggccc tgtgatgcagaagaaaacactcggctgggaggccttcaccgagacgctgtaccccgctgacggcggcctggaaggcag aaacgacatggccctgaagctcgtgggcgggagccatctgatcgcaaacatcaagaccacatatagatccaagaaaccc gctaagaacctcaagatgcctggcgtctactatgtggactacagactggaaagaatcaaggaggccaacaacgagacct acgtcgagcagcacgaggtggcagtggccagatactgcgacctccctagcaaactggggcacaagcttaattaa

SEQ ID No.4：

Name: intron sequence

The source is as follows: artificial Sequence (Artificial Sequence)

gtaagtatgaaattcagggatacggccaccttgttggcatatttgccaaatagtggaaatgtgaagtactgacaaaac ttttccctttttcaatctaatag

SEQ ID No.5：

Name: intron-containing blue fluorescent protein sequence

The source is as follows: artificial Sequence (Artificial Sequence)

atgagcgagctgattaaggagaacatgcacatgaagctgtacatggagggcaccgtggacaaccatcacttcaag tgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgagaatcaaggtggtcgagggcggccctct ccccttcgccttcgacatcctggctactagcttcctctacggcagcaagaccttcatcaaccacacccagggcatccccga cttcttcaagcagtccttccctgagggcttcacatgggagagagtcaccacatacgaagacgggggcgtgctgaccgcta cccaggacaccagcctccaggacgtaagtatgaaattcagggatacggccaccttgttggcatatttgccaaatagtggaa atgtgaagtactgacaaaacttttccctttttcaatctaatagggctgcctcatctacaacgtcaagatcagaggggtgaactt cacatccaacggccctgtgatgcagaagaaaacactcggctgggaggccttcaccgagacgctgtaccccgctgacgg cggcctggaaggcagaaacgacatggccctgaagctcgtgggcgggagccatctgatcgcaaacatcaagaccacata tagatccaagaaacccgctaagaacctcaagatgcctggcgtctactatgtggactacagactggaaagaatcaaggagg ccaacaacgagacctacgtcgagcagcacgaggtggcagtggccagatactgcgacctccctagcaaactggggcaca agcttaattaagcggccgcgactctag

SEQ ID No.6：

Name: DNA/RNA double visualization sequence

The source is as follows: artificial Sequence (Artificial Sequence)

ccggtaacctacaaacgggtggaggatcaccccacccgacacgcaccgatgctctccgaggaggcacaagggt ggaggaacaccccaccctccaggcaccgatgctctccgaggaggcaaacagaagcaccatcagggcttctgctacgca ccgatgctctccgaggaggaacaaggaatcaccatcagggattccctgtggcaccgatgctctccgaggaggacgacg ggaggacgatcacgcctcccgaatagcaccgatgctctccgaggaggtcagtgcgtggagcatcagcccacgcagcca gcaccgatgctctccgaggaggctttcgcgaagagcatcagccttcgcgccatgcaccgatgctctccgaggaggccta caggaacagcatcagcgttcctgcccagcaccgatgctctccgaggaggtgtccccatgcagcatcagcgcatgggccc cgcaccgatgctctccgaggaggcacatccgagcaccaacagggctcggagtgtgcaccgatgctctccgaggaggac cctccatggaccatcaggccatggactctgcaccgatgctctccgaggaggcttctcgaagcagcatcagcgcttcgaaa cagcaccgatgctctccgaggaggttct

SEQ ID No.7：

Name: TriTag label

The source is as follows: artificial Sequence (Artificial Sequence)

atgagcgagctgattaaggagaacatgcacatgaagctgtacatggagggcaccgtggacaaccatcacttcaag tgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgagaatcaaggtggtcgagggcggccctct ccccttcgccttcgacatcctggctactagcttcctctacggcagcaagaccttcatcaaccacacccagggcatccccga cttcttcaagcagtccttccctgagggcttcacatgggagagagtcaccacatacgaagacgggggcgtgctgaccgcta cccaggacaccagcctccaggacgtaagtatgaaattcagggatacggccaccttgttggccggtaacctacaaacgggt ggaggatcaccccacccgacacgcaccgatgctctccgaggaggcacaagggtggaggaacaccccaccctccaggc accgatgctctccgaggaggcaaacagaagcaccatcagggcttctgctacgcaccgatgctctccgaggaggaacaa ggaatcaccatcagggattccctgtggcaccgatgctctccgaggaggacgacgggaggacgatcacgcctcccgaat agcaccgatgctctccgaggaggtcagtgcgtggagcatcagcccacgcagccagcaccgatgctctccgaggaggct ttcgcgaagagcatcagccttcgcgccatgcaccgatgctctccgaggaggcctacaggaacagcatcagcgttcctgcc cagcaccgatgctctccgaggaggtgtccccatgcagcatcagcgcatgggccccgcaccgatgctctccgaggaggc acatccgagcaccaacagggctcggagtgtgcaccgatgctctccgaggaggaccctccatggaccatcaggccatgg actctgcaccgatgctctccgaggaggcttctcgaagcagcatcagcgcttcgaaacagcaccgatgctctccgaggag gttctccaccttgttggcatatttgccaaatagtggaaatgtgaagtactgacaaaacttttccctttttcaatctaatagggctg cctcatctacaacgtcaagatcagaggggtgaacttcacatccaacggccctgtgatgcagaagaaaacactcggctggg aggccttcaccgagacgctgtaccccgctgacggcggcctggaaggcagaaacgacatggccctgaagctcgtgggc gggagccatctgatcgcaaacatcaagaccacatatagatccaagaaacccgctaagaacctcaagatgcctggcgtcta ctatgtggactacagactggaaagaatcaaggaggccaacaacgagacctacgtcgagcagcacgaggtggcagtggc cagatactgcgacctccctagcaaactggggcacaagcttaattaa

SEQ ID No.8：

Name: HDR repair template plasmid sequences

The source is as follows: artificial Sequence (Artificial Sequence)

gaggctgtcccaggctggatcacggccgcgactgcgagggacgccaaggagtcctctttcccctggccgcagg cgtgcgccttcgcagcccatctggcaccgcagatgccggtcgccggggtcagcggcgaagcccgaacccatgcggcc gggaggggacgcccacaaacccctgcccgccggccgggaagcgctcctacgggaccccagccccgttggggaggc ggggcggccacgcgggttccaccaatcagcggccaatgttcgaattcgcgtcctggcgcggccaatggcgggtcccgg agcaggcggggagggcgtggagggcggtaaatgaggcgagcacagggcgggacatgggcggggccggcggcgg cccccccgggcaggccaatgggagggccgggtgcgtttgaaaactggggtgggcggcggggcggggtctgcgcctg cgcgagggctacgcgcgctccggccggggcgcgggcgcgctctcaggcgggctccggcggcagcgacgcgagcg cggcgggatcgggtggtaccagtggcatgagcgagctgattaaggagaacatgcacatgaagctgtacatggagggca ccgtggacaaccatcacttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgagaatca aggtggtcgagggcggccctctccccttcgccttcgacatcctggctactagcttcctctacggcagcaagaccttcatcaa ccacacccagggcatccccgacttcttcaagcagtccttccctgagggcttcacatgggagagagtcaccacatacgaag acgggggcgtgctgaccgctacccaggacaccagcctccaggacgtaagtatgaaattcagggatacggccaccttgtt ggccggtaacctacaaacgggtggaggatcaccccacccgacacgcaccgatgctctccgaggaggcacaagggtgg aggaacaccccaccctccaggcaccgatgctctccgaggaggcaaacagaagcaccatcagggcttctgctacgcacc gatgctctccgaggaggaacaaggaatcaccatcagggattccctgtggcaccgatgctctccgaggaggacgacggg aggacgatcacgcctcccgaatagcaccgatgctctccgaggaggtcagtgcgtggagcatcagcccacgcagccagc accgatgctctccgaggaggctttcgcgaagagcatcagccttcgcgccatgcaccgatgctctccgaggaggcctaca ggaacagcatcagcgttcctgcccagcaccgatgctctccgaggaggtgtccccatgcagcatcagcgcatgggccccg caccgatgctctccgaggaggcacatccgagcaccaacagggctcggagtgtgcaccgatgctctccgaggaggaccc tccatggaccatcaggccatggactctgcaccgatgctctccgaggaggcttctcgaagcagcatcagcgcttcgaaaca gcaccgatgctctccgaggaggttctccaccttgttggcatatttgccaaatagtggaaatgtgaagtactgacaaaacttttc cctttttcaatctaatagggctgcctcatctacaacgtcaagatcagaggggtgaacttcacatccaacggccctgtgatgca gaagaaaacactcggctgggaggccttcaccgagacgctgtaccccgctgacggcggcctggaaggcagaaacgaca tggccctgaagctcgtgggcgggagccatctgatcgcaaacatcaagaccacatatagatccaagaaacccgctaagaa cctcaagatgcctggcgtctactatgtggactacagactggaaagaatcaaggaggccaacaacgagacctacgtcgag cagcacgaggtggcagtggccagatactgcgacctccctagcaaactggggcacaagcttaatggaaccggtgctggat ccggtgggagcggcggcggtgagtgcggggcgatgtccgctggtttctgccccacaccccttctgcctgccctgcgggg cggacggtgggtcccgcgggaggggaggccctggcggcctgaagagggctggctcgagctctttaacccggggcgg atgtcgcgtcccgcgcagggagccccggcggccgggcgcgcggtttaaatgcccggcgggcgcccgagcccctcgg agccttcccccgcggcgacgttttccggccctttcctggggcaacgatcgggtcccggggcagcgatccggcgatcggg tcccggggcggcgatcgggtctcggggagccaaacaccagcgcctcctggtcggggaaagggctgcggagcgcgtg ggggcgaagcgatcccgcagcccggccgggccctgaccgagcctcagtccagcggggccgtggacctagctctgtgg aaagcagcgttcggccccgcgcgcgttgaggcacaggaaacacgaactgtggtttcagctattatcatagtatctgtcctg gagcc。

Sequence listing

<110> Zhejiang university

<120> Label and method for simultaneously visualizing DNA, mRNA and protein of Gene in Living cell

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 380

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcaccgatgc tctccgagga ggcgtgaccg caccgatgct ctccgaggag gagcaagcac 60

cgatgctctc cgaggaggca gctgtgcacc gatgctctcc gaggaggcac gggctaattc 120

actcccaacg agcaagcacc gatgctctcc gaggaggcgt gaccgcaccg atgctctccg 180

aggaggagca agcaccgatg ctctccgagg aggcagctgt gcaccgatgc tctccgagga 240

ggcacccttg atctgtggat ctaccagaac gcaccgatgc tctccgagga ggcgtgaccg 300

caccgatgct ctccgaggag gagcaagcac cgatgctctc cgaggaggca gctgtgcacc 360

gatgctctcc gaggaggcac 380

<210> 2

<211> 660

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccggtaacct acaaacgggt ggaggatcac cccacccgac acttcacaat caaggggtac 60

aatacacaag ggtggaggaa caccccaccc tccagacaca ttacacagaa atccaatcaa 120

acagaagcac catcagggct tctgctacca aatttatctc aaaaaactac aacaaggaat 180

caccatcagg gattccctgt gcaatatacg tcaaacgagg gccacgacgg gaggacgatc 240

acgcctcccg aatatcggca tgtctggctt tcgaattcag tgcgtggagc atcagcccac 300

gcagccaatc agagtcgaat acaagtcgac tttcgcgaag agcatcagcc ttcgcgccat 360

tcttacacaa accacactct cccctacagg aacagcatca gcgttcctgc ccagtaccca 420

actcaagaaa atttatgtcc ccatgcagca tcagcgcatg ggccccaaga atacatcccc 480

aacaaaatca catccgagca ccaacagggc tcggagtgtt gtttcttgtc caactggaca 540

aaccctccat ggaccatcag gccatggact ctcaccaaca agacaaaaac tactcttctc 600

gaagcagcat cagcgcttcg aaacactcga gcatacattg tgcctatttc ttgggtggac 660

<210> 3

<211> 702

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgagcgagc tgattaagga gaacatgcac atgaagctgt acatggaggg caccgtggac 60

aaccatcact tcaagtgcac atccgagggc gaaggcaagc cctacgaggg cacccagacc 120

atgagaatca aggtggtcga gggcggccct ctccccttcg ccttcgacat cctggctact 180

agcttcctct acggcagcaa gaccttcatc aaccacaccc agggcatccc cgacttcttc 240

aagcagtcct tccctgaggg cttcacatgg gagagagtca ccacatacga agacgggggc 300

gtgctgaccg ctacccagga caccagcctc caggacggct gcctcatcta caacgtcaag 360

atcagagggg tgaacttcac atccaacggc cctgtgatgc agaagaaaac actcggctgg 420

gaggccttca ccgagacgct gtaccccgct gacggcggcc tggaaggcag aaacgacatg 480

gccctgaagc tcgtgggcgg gagccatctg atcgcaaaca tcaagaccac atatagatcc 540

aagaaacccg ctaagaacct caagatgcct ggcgtctact atgtggacta cagactggaa 600

agaatcaagg aggccaacaa cgagacctac gtcgagcagc acgaggtggc agtggccaga 660

tactgcgacc tccctagcaa actggggcac aagcttaatt aa 702

<210> 4

<211> 101

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtaagtatga aattcaggga tacggccacc ttgttggcat atttgccaaa tagtggaaat 60

gtgaagtact gacaaaactt ttcccttttt caatctaata g 101

<210> 5

<211> 819

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgagcgagc tgattaagga gaacatgcac atgaagctgt acatggaggg caccgtggac 60

aaccatcact tcaagtgcac atccgagggc gaaggcaagc cctacgaggg cacccagacc 120

atgagaatca aggtggtcga gggcggccct ctccccttcg ccttcgacat cctggctact 180

agcttcctct acggcagcaa gaccttcatc aaccacaccc agggcatccc cgacttcttc 240

aagcagtcct tccctgaggg cttcacatgg gagagagtca ccacatacga agacgggggc 300

gtgctgaccg ctacccagga caccagcctc caggacgtaa gtatgaaatt cagggatacg 360

gccaccttgt tggcatattt gccaaatagt ggaaatgtga agtactgaca aaacttttcc 420

ctttttcaat ctaatagggc tgcctcatct acaacgtcaa gatcagaggg gtgaacttca 480

catccaacgg ccctgtgatg cagaagaaaa cactcggctg ggaggccttc accgagacgc 540

tgtaccccgc tgacggcggc ctggaaggca gaaacgacat ggccctgaag ctcgtgggcg 600

ggagccatct gatcgcaaac atcaagacca catatagatc caagaaaccc gctaagaacc 660

tcaagatgcc tggcgtctac tatgtggact acagactgga aagaatcaag gaggccaaca 720

acgagaccta cgtcgagcag cacgaggtgg cagtggccag atactgcgac ctccctagca 780

aactggggca caagcttaat taagcggccg cgactctag 819

<210> 6

<211> 651

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccggtaacct acaaacgggt ggaggatcac cccacccgac acgcaccgat gctctccgag 60

gaggcacaag ggtggaggaa caccccaccc tccaggcacc gatgctctcc gaggaggcaa 120

acagaagcac catcagggct tctgctacgc accgatgctc tccgaggagg aacaaggaat 180

caccatcagg gattccctgt ggcaccgatg ctctccgagg aggacgacgg gaggacgatc 240

acgcctcccg aatagcaccg atgctctccg aggaggtcag tgcgtggagc atcagcccac 300

gcagccagca ccgatgctct ccgaggaggc tttcgcgaag agcatcagcc ttcgcgccat 360

gcaccgatgc tctccgagga ggcctacagg aacagcatca gcgttcctgc ccagcaccga 420

tgctctccga ggaggtgtcc ccatgcagca tcagcgcatg ggccccgcac cgatgctctc 480

cgaggaggca catccgagca ccaacagggc tcggagtgtg caccgatgct ctccgaggag 540

gaccctccat ggaccatcag gccatggact ctgcaccgat gctctccgag gaggcttctc 600

gaagcagcat cagcgcttcg aaacagcacc gatgctctcc gaggaggttc t 651

<210> 7

<211> 1466

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgagcgagc tgattaagga gaacatgcac atgaagctgt acatggaggg caccgtggac 60

aaccatcact tcaagtgcac atccgagggc gaaggcaagc cctacgaggg cacccagacc 120

atgagaatca aggtggtcga gggcggccct ctccccttcg ccttcgacat cctggctact 180

agcttcctct acggcagcaa gaccttcatc aaccacaccc agggcatccc cgacttcttc 240

aagcagtcct tccctgaggg cttcacatgg gagagagtca ccacatacga agacgggggc 300

gtgctgaccg ctacccagga caccagcctc caggacgtaa gtatgaaatt cagggatacg 360

gccaccttgt tggccggtaa cctacaaacg ggtggaggat caccccaccc gacacgcacc 420

gatgctctcc gaggaggcac aagggtggag gaacacccca ccctccaggc accgatgctc 480

tccgaggagg caaacagaag caccatcagg gcttctgcta cgcaccgatg ctctccgagg 540

aggaacaagg aatcaccatc agggattccc tgtggcaccg atgctctccg aggaggacga 600

cgggaggacg atcacgcctc ccgaatagca ccgatgctct ccgaggaggt cagtgcgtgg 660

agcatcagcc cacgcagcca gcaccgatgc tctccgagga ggctttcgcg aagagcatca 720

gccttcgcgc catgcaccga tgctctccga ggaggcctac aggaacagca tcagcgttcc 780

tgcccagcac cgatgctctc cgaggaggtg tccccatgca gcatcagcgc atgggccccg 840

caccgatgct ctccgaggag gcacatccga gcaccaacag ggctcggagt gtgcaccgat 900

gctctccgag gaggaccctc catggaccat caggccatgg actctgcacc gatgctctcc 960

gaggaggctt ctcgaagcag catcagcgct tcgaaacagc accgatgctc tccgaggagg 1020

ttctccacct tgttggcata tttgccaaat agtggaaatg tgaagtactg acaaaacttt 1080

tccctttttc aatctaatag ggctgcctca tctacaacgt caagatcaga ggggtgaact 1140

tcacatccaa cggccctgtg atgcagaaga aaacactcgg ctgggaggcc ttcaccgaga 1200

cgctgtaccc cgctgacggc ggcctggaag gcagaaacga catggccctg aagctcgtgg 1260

gcgggagcca tctgatcgca aacatcaaga ccacatatag atccaagaaa cccgctaaga 1320

acctcaagat gcctggcgtc tactatgtgg actacagact ggaaagaatc aaggaggcca 1380

acaacgagac ctacgtcgag cagcacgagg tggcagtggc cagatactgc gacctcccta 1440

gcaaactggg gcacaagctt aattaa 1466

<210> 8

<211> 2580

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaggctgtcc caggctggat cacggccgcg actgcgaggg acgccaagga gtcctctttc 60

ccctggccgc aggcgtgcgc cttcgcagcc catctggcac cgcagatgcc ggtcgccggg 120

gtcagcggcg aagcccgaac ccatgcggcc gggaggggac gcccacaaac ccctgcccgc 180

cggccgggaa gcgctcctac gggaccccag ccccgttggg gaggcggggc ggccacgcgg 240

gttccaccaa tcagcggcca atgttcgaat tcgcgtcctg gcgcggccaa tggcgggtcc 300

cggagcaggc ggggagggcg tggagggcgg taaatgaggc gagcacaggg cgggacatgg 360

gcggggccgg cggcggcccc cccgggcagg ccaatgggag ggccgggtgc gtttgaaaac 420

tggggtgggc ggcggggcgg ggtctgcgcc tgcgcgaggg ctacgcgcgc tccggccggg 480

gcgcgggcgc gctctcaggc gggctccggc ggcagcgacg cgagcgcggc gggatcgggt 540

ggtaccagtg gcatgagcga gctgattaag gagaacatgc acatgaagct gtacatggag 600

ggcaccgtgg acaaccatca cttcaagtgc acatccgagg gcgaaggcaa gccctacgag 660

ggcacccaga ccatgagaat caaggtggtc gagggcggcc ctctcccctt cgccttcgac 720

atcctggcta ctagcttcct ctacggcagc aagaccttca tcaaccacac ccagggcatc 780

cccgacttct tcaagcagtc cttccctgag ggcttcacat gggagagagt caccacatac 840

gaagacgggg gcgtgctgac cgctacccag gacaccagcc tccaggacgt aagtatgaaa 900

ttcagggata cggccacctt gttggccggt aacctacaaa cgggtggagg atcaccccac 960

ccgacacgca ccgatgctct ccgaggaggc acaagggtgg aggaacaccc caccctccag 1020

gcaccgatgc tctccgagga ggcaaacaga agcaccatca gggcttctgc tacgcaccga 1080

tgctctccga ggaggaacaa ggaatcacca tcagggattc cctgtggcac cgatgctctc 1140

cgaggaggac gacgggagga cgatcacgcc tcccgaatag caccgatgct ctccgaggag 1200

gtcagtgcgt ggagcatcag cccacgcagc cagcaccgat gctctccgag gaggctttcg 1260

cgaagagcat cagccttcgc gccatgcacc gatgctctcc gaggaggcct acaggaacag 1320

catcagcgtt cctgcccagc accgatgctc tccgaggagg tgtccccatg cagcatcagc 1380

gcatgggccc cgcaccgatg ctctccgagg aggcacatcc gagcaccaac agggctcgga 1440

gtgtgcaccg atgctctccg aggaggaccc tccatggacc atcaggccat ggactctgca 1500

ccgatgctct ccgaggaggc ttctcgaagc agcatcagcg cttcgaaaca gcaccgatgc 1560

tctccgagga ggttctccac cttgttggca tatttgccaa atagtggaaa tgtgaagtac 1620

tgacaaaact tttccctttt tcaatctaat agggctgcct catctacaac gtcaagatca 1680

gaggggtgaa cttcacatcc aacggccctg tgatgcagaa gaaaacactc ggctgggagg 1740

ccttcaccga gacgctgtac cccgctgacg gcggcctgga aggcagaaac gacatggccc 1800

tgaagctcgt gggcgggagc catctgatcg caaacatcaa gaccacatat agatccaaga 1860

aacccgctaa gaacctcaag atgcctggcg tctactatgt ggactacaga ctggaaagaa 1920

tcaaggaggc caacaacgag acctacgtcg agcagcacga ggtggcagtg gccagatact 1980

gcgacctccc tagcaaactg gggcacaagc ttaatggaac cggtgctgga tccggtggga 2040

gcggcggcgg tgagtgcggg gcgatgtccg ctggtttctg ccccacaccc cttctgcctg 2100

ccctgcgggg cggacggtgg gtcccgcggg aggggaggcc ctggcggcct gaagagggct 2160

ggctcgagct ctttaacccg gggcggatgt cgcgtcccgc gcagggagcc ccggcggccg 2220

ggcgcgcggt ttaaatgccc ggcgggcgcc cgagcccctc ggagccttcc cccgcggcga 2280

cgttttccgg ccctttcctg gggcaacgat cgggtcccgg ggcagcgatc cggcgatcgg 2340

gtcccggggc ggcgatcggg tctcggggag ccaaacacca gcgcctcctg gtcggggaaa 2400

gggctgcgga gcgcgtgggg gcgaagcgat cccgcagccc ggccgggccc tgaccgagcc 2460

tcagtccagc ggggccgtgg acctagctct gtggaaagca gcgttcggcc ccgcgcgcgt 2520

tgaggcacag gaaacacgaa ctgtggtttc agctattatc atagtatctg tcctggagcc 2580

Claims

1. A TriTag label for simultaneously visualizing DNA, mRNA and protein of a gene in a living cell is characterized in that: consists of three parts of DNA sequence:

CRISPR-Tag DNA sequence of TS1 consisting of 12 TS1 repeating units_12xDNA sequence as SEQ ID No. 1;

MS2 DNA sequence consisting of 12 MS2V5 unit sequences as shown in SEQ ID No. 2;

the blue fluorescent protein sequence containing an intron, such as SEQ ID No.5, is formed by inserting a segment of intron sequence, such as SEQ ID No.4, into the blue fluorescent protein sequence, such as SEQ ID No. 3;

the TriTag label is formed by alternately inserting 12 TS1 repetitive unit sequences and 12 MS2V5 unit sequences to form a DNA/RNA double-visual sequence shown as SEQ ID No.6, and then inserting the double-visual sequence into an intron in a blue fluorescent protein sequence containing the intron by an enzyme digestion connection method to form the TriTag label shown as SEQ ID No. 7.

2. A method for simultaneously visualizing DNA, mRNA and protein of a gene in a living cell, comprising:

preparing and constructing a TriTag tag of claim 1;

(II) adopting a TriTag label to visualize DNA, mRNA and protein of a target endogenous gene in a living cell simultaneously;

(1) constructing a visual stable cell line:

(1.1) on the day, HEK293T cells were cultured with PS-free medium and plated into 12-well plates to form a first cell culture medium;

(1.2) the following day, lentivirus packaging was performed: 750ng of each dCas9-GFP were premixed with 75. mu.l of serum-reduced medium, Opti-medium_14xAfter virus expression plasmid and stdMCP-tdTomato virus expression plasmid, 705ng pCMV-dR8.91 plasmid and 87ng PMD2.G plasmid, adding 4.5 mul Fugene transient transfection reagent Promega to form liposome, dripping into the supernatant of the first cell culture medium, and carrying out transient transfection on HEK293T cells in the first cell culture medium;

(1.4) culturing the cells to be infected 48 hours after transient transfection in the step (1.2) and spreading the cells into a 24-well plate to form a second cell culture medium;

(1.6) preparing a PS-free culture medium containing a gene transfection enhancer polybrene with the concentration of 5 mug/mL as a third culture medium to replace a second cell culture medium, transferring the cell culture to be infected to the third culture medium, and then dropwise adding 30-90 mul of cell supernatant containing viruses into the third culture medium supernatant of the cell to be infected;

(1.7) after 12 hours of infection in the step (1.6), replacing a fresh culture medium for the third culture medium, continuously culturing until the third culture medium can be passaged to an 8-well plate for microscope imaging observation, screening out a cell infection population according to fluorescence intensity and infection efficiency, and separating single cell clones of a 96-well plate;

(2) constructing a target endogenous gene visualization system containing a TriTag label in the stable cell line, and carrying out transfection and sorting;

3. The method for simultaneously visualizing DNA, mRNA and protein of a gene in a living cell as claimed in claim 2, wherein: the step (one) is as follows:

s2, designing and synthesizing a DNA/RNA double visualization sequence: alternately interleaving 12 TS1 repeating unit sequences and 12 MS2V5 unit sequences for 12 times by means of nucleic acid synthesis;

s3, building a TriTag label: and inserting the DNA/RNA double visualization sequence into an intron of a blue protein sequence containing the intron by using an enzyme digestion connection method to obtain the TriTag label.

4. The method for simultaneously visualizing DNA, mRNA and protein of a gene in a living cell as claimed in claim 2, wherein:

the step (2) is specifically as follows:

(2.1) designing and constructing HDR repair template plasmids and sgRNA expression plasmids which are specific in genes and contain TriTag labels according to the condition of target endogenous genes so as to edit knock-in of cells;

(2.2) culturing the cell to be knotted-in edited by using the PS-free culture medium and paving the cell to a 24-well plate to form a fourth cell culture medium;

(2.3) on the day after 24 hours from the start of the culturing in step (2.2), premixing 500ng of sgRNA expression plasmid, 100ng of Cas9 protein expression plasmid and 400ng of HDR repair template plasmid with 40. mu.l of serum-reduced medium Opti-medium, adding 2.4. mu.l of Fugene transient transfection reagent Promega to form liposomes, and adding dropwise into the supernatant of the fourth cell culture medium to transiently transfect the cells to be transfected-in edited;

(2.4) performing cell flow sorting after the transient transfection for 96 hours, recovering the BFP fluorescence expression positive cells during the cell flow sorting, continuously culturing, and discarding the rest.

5. The method for simultaneously visualizing DNA, mRNA and protein of a gene in a living cell as claimed in claim 4, wherein: the specific construction method and process of the HDR repair template plasmid are as follows:

(2) extracting a human HeLa cell genome, amplifying homologous arm sequences on two sides of the N end or the C end of a human target gene by using a PCR (polymerase chain reaction) method, and then inserting a TriTag label between the homologous arm sequences on two sides by using a homologous recombination mode to form a series sequence of a5 'homologous arm sequence-TriTag label-3' homologous arm sequence as an HDR (high-density lipoprotein receptor) repair template plasmid.

6. The method for simultaneously visualizing DNA, mRNA and protein of a gene in a living cell as claimed in claim 2, wherein: the step (3) is specifically as follows:

(3.1) culturing the cells sorted in the step (2) by using a PS-free culture medium and paving the cells into an 8-well plate to form a fifth cell culture medium;

(3.2) on the day after 24 hours from the start of the culture in step (3.1), 500ng of the TS1-sgRNA expression plasmid was premixed with 25. mu.l of the serum-reduced medium Opti-medium, and after liposome formation with the addition of 1.2. mu.l of Fugene transient transfection reagent Promega, the mixture was added dropwise to the supernatant of the fifth cell culture medium to transiently transfect the cells;