CN111718387A

CN111718387A - Method for synthesizing modular DNA

Info

Publication number: CN111718387A
Application number: CN201910222602.4A
Authority: CN
Inventors: 王升启; 何小羊
Original assignee: Institute of Pharmacology and Toxicology of AMMS
Current assignee: Institute of Pharmacology and Toxicology of AMMS; Academy of Military Medical Sciences AMMS of PLA
Priority date: 2019-03-22
Filing date: 2019-03-22
Publication date: 2020-09-29

Abstract

The invention provides a method for synthesizing modular DNA, which comprises the following steps: synthesizing DNA from a raw material containing a nucleoside module unit by a solid phase synthesis method; wherein the nucleoside module unit is obtained by coupling more than two deoxynucleotides. The synthesis method of the invention improves the efficiency and fidelity of DNA long chain synthesis, has certain broad-spectrum applicability and is worthy of wide popularization and application.

Description

Method for synthesizing modular DNA

Technical Field

The invention relates to the field of DNA synthesis, in particular to a modular DNA synthesis method.

Background

In recent years, with the development of synthetic biology, the requirement for fidelity of DNA synthesis is higher and higher, the traditional single nucleoside gradual synthesis method is difficult to meet the requirement, and how to improve the efficiency and accuracy of DNA synthesis is a main research and development direction in the present field.

Conventionally, DNA is synthesized by taking a single nucleoside as a single monomer and adopting a 'four-step method' cycle mode of deprotection-coupling-capping-oxidation, and since acid deprotection is required in each cycle when a long chain is synthesized based on the single monomer, a large number of acid deprotection processes are performed when the long chain is synthesized. However, under acidic conditions, purine bases on nucleosides are unstable and easily fall off, so that a large amount of bases of long-chain DNA are lost, the accuracy of the obtained long-chain DNA is reduced, and the cost for synthesizing a required amount of long-chain DNA is increased.

Meanwhile, because complete quantitative reaction cannot be carried out in the processes of deprotection, coupling, capping and the like, a byproduct of mononucleoside deletion ((n-1) mer) is generated, and the product is difficult to separate and purify, thereby seriously influencing the fidelity of DNA.

In addition, when synthesizing conventional long-chain DNA, the coupling efficiency of A, G and the like is relatively low, and the synthesis efficiency and accuracy of the synthesized long-chain DNA are also affected. The coupling times of nucleoside monomers in the synthesis of a DNA long chain are reduced as much as possible, the synthesis efficiency and the accuracy of the synthesized long-chain DNA can be improved, for example, 100ntDNA is synthesized, the dimer module synthesis can be completed by only 50 cycles, the deprotection, coupling and capping processes can be reduced by more than 50 times, the time is shortened by half, and meanwhile, byproducts of (n-1) mers which are difficult to purify are also avoided, so that the efficiency and the fidelity of the DNA synthesis can be improved. .

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a method for synthesizing DNA by adopting modular deoxynucleotide, which fully improves the synthesis rate of long-fragment oligonucleotide, reduces the acid deprotection times to reduce the synthesis side reactions such as depurination and the like, avoids the problem that A, G coupling efficiency is low to reduce the synthesis efficiency, and has very wide applicability.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

the invention provides a DNA synthesis method, which comprises the following steps:

synthesizing DNA from a raw material containing a nucleoside module unit by a solid phase synthesis method;

wherein the nucleoside modular unit is obtained by coupling more than two deoxynucleotides;

preferably, the raw material further comprises deoxynucleotide monomers.

In the synthesis method, the nucleoside module unit is used as a raw material to synthesize the DNA, so that the synthesis efficiency is obviously improved, the high-fidelity synthesis of the long-fragment oligonucleotide is realized, the consumption of the synthesis raw material and reagents is reduced on the basis, the DNA synthesis cost is comprehensively reduced, and the DNA synthesis accuracy is improved.

Preferably, as a further implementable aspect, the bases in the nucleoside module units undergoing coupling are different bases or the same base.

Preferably, as a further implementable aspect, the nucleoside modular unit is at least one of a dimer modular unit, a trimer modular unit, and a tetramer modular unit.

Preferably, as a further implementable aspect, the nucleoside modular unit is a dimer modular unit.

Preferably, as a further implementable variant, the solid phase synthesis is carried out on a DNA synthesizer.

Preferably, as a further implementable aspect, the method for synthesizing the nucleoside modular unit comprises:

(1) reacting deoxynucleoside protected by a protective group with levulinic acid to obtain deoxynucleoside protected by an active group in an alkaline environment under a catalytic condition;

(2) removing the protecting group of 5' -hydroxyl, catalytically coupling with phosphoramidite nucleoside, and oxidizing;

(3) removing the protecting group of the 3' -hydroxyl group, and connecting phosphoramidite;

(4) repeating the above steps (2) - (3) to obtain the nucleoside modular unit when the number of bases in the nucleoside modular unit is two or more;

preferably, the protecting group is selected from one of trityl group, monomethoxytrityl group and dimethoxytrityl group.

Preferably, as a further implementable variant, the catalyst for the catalytic coupling is one of 1H-tetrazole, 5-benzylthiotetrazole, 4, 5-dicyanoimidazole.

Preferably, as a further implementable variant, the catalyst catalyzing the coupling is 4, 5-dicyanoimidazole.

Preferably, as a further implementable variant, a protonic acid is reacted to remove the protecting group of its 5' -hydroxyl group.

Preferably, the protonic acid is selected from one of trichloroacetic acid and dichloroacetic acid.

Preferably, as a further implementable option, hydrazine hydrate catalyzes the removal of the protecting group of its 3' -hydroxyl group.

Compared with the prior art, the invention has the beneficial effects that:

1) according to the invention, the synthesis of the long-chain oligonucleotide is carried out by adopting the modular deoxynucleotide as a raw material, so that the number of times of acid deprotection carried out during the synthesis of the oligonucleotide chain can be reduced, the problems that the base of the deoxynucleotide is unstable and is easy to fall off under an acidic condition can be effectively prevented, and the synthesis steps can be reduced, thereby improving the synthesis efficiency and accuracy of the oligonucleotide chain;

2) the synthesis method changes the original single monomer circulation mode, changes the synthesis mode into the modularized circulation mode or the modularized + monomer circulation mode, thereby avoiding the problem that the A, G coupling efficiency is low to reduce the synthesis efficiency, and having very wide applicability.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 is a schematic diagram of the synthesis route of TC dimer in example 1 of the present invention;

FIG. 2 is a mass spectrum of dimer TC dimer of example 1 of the present invention;

FIG. 3 is an HPLC chart of the synthesis of target primer E120R-44 using dimer TC dimer of example 1 of the present invention;

FIG. 4 is a HPLC chart showing the synthesis of primers E120R-44 using deoxynucleoside monomers in example 2 of the present invention;

FIG. 5 is an HPLC chart of the synthesis of target primers P5430-22 using dimer TC dimer of example 1 of the present invention;

FIG. 6 is an HPLC chart for synthesizing primers P5430-22 using deoxynucleoside monomers in example 2 of the present invention;

FIG. 7 is a schematic structural view of a nucleoside module unit of the present invention;

FIG. 8 is a schematic diagram of the synthesis of modular DNA of the present invention.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

wherein the nucleoside module unit is obtained by coupling more than two deoxynucleotides.

Preferably, the raw material further comprises deoxynucleotide monomers.

The modularized nucleoside module unit can be directly selected from raw materials, or the combination mode of the modularization and the deoxynucleotide monomer can be selected, and the flexible selection can be carried out according to the actual situation.

Preferably, as a further practical embodiment, the bases in the nucleoside modular units to be coupled are different bases or the same base, so that the types of deoxynucleotides contained in the nucleoside modular units themselves are also various, and A, G, C, T can be arbitrarily combined to form the nucleoside modular units.

Preferably, as a further implementable aspect, the nucleoside modular unit is at least one of a dimer coupling unit, a trimer coupling unit, and a tetramer coupling unit.

Preferably, as a further practical scheme, the nucleoside modular unit is a dimer coupling unit, and the dimer coupling unit can be 16 combinations of AA, AG, AC, AT, GG, CT, TT and the like.

The trimeric coupling units are then more involved in the combination, not to be enumerated. The specific structure of the nucleoside module unit is shown in FIG. 7, and the synthetic route of the modular DNA is shown in FIG. 8.

Preferably, as a further implementable solution, the solid phase synthesis is performed on a DNA synthesizer.

More preferably, the long-chain oligonucleotide is synthesized by taking a DNA synthesizer as equipment and 4, 5-dicyanoimidazole as a catalyst.

(4) when the number of bases in the nucleoside modular unit is two or more, repeating the above steps (2) to (3) to obtain the nucleoside modular unit.

Specifically, taking the dimer as an example, the specific coupling method comprises the following steps:

(1) DMT-protected deoxynucleosides are reacted with levulinic acid (levulinic acid) to produce 3 '-Lev, 5' -DMTr-protected deoxynucleosides, which are carried out at room temperature using EDCI as a base, DMAP as a catalyst, and DCM as a solvent.

(2) Dissolving the product obtained in the step (1) in dichloroacetic acid to remove the DMTr protection at the 5 'position, and obtaining the 3' -Lev protected deoxynucleoside.

(3) Dissolving the product obtained in the step (2) in anhydrous dichloromethane, and reacting with phosphoramidite nucleoside under the catalysis of 1H-tetrazole to obtain a dimeric product.

(4) And (4) oxidizing the product obtained in the step (3) by using an iodine oxidizing agent to obtain an oxidized dimerization product.

(5) And (4) catalyzing the product obtained in the step (4) to remove the protection of Lev at the 3' position by using hydrazine hydrate.

(6) Reacting the product obtained in (5) with 2-cyanoethyl-bis (N, N-diisopropyl) phosphoramidite to introduce phosphoramidite at the 3' position.

In each step, firstly, the hydroxyl at the 3 'position is protected by levulinic acid, and then the DMTr protected by the hydroxyl at the 5' position is removed, so that when the DMTr reacts with phosphoramidite nucleoside, only one product is taken as a main product, the occurrence of byproducts can be effectively reduced, even avoided, and the DMTr is more beneficial to separation and purification after the reaction is finished.

Because deoxynucleosides have two naked hydroxyl groups, located on the 3 'and 5' carbons, respectively. If the protection of the hydroxyl group on the 3' carbon is not performed, the hydroxyl groups at these two positions on different deoxynucleosides can react, thereby producing additional dimers, affecting reaction yields. Meanwhile, the 3 '-protected acetylpropyl group is not oxidized by the iodine oxidizer used and, after the reaction, is easily deprotected, and thus is selected as a protecting group to protect the 3' -hydroxyl group.

In the step (2), the raw material is dissolved in dichloromethane, 5 times of dichloroacetic acid is added, the reaction of DMTr removal is carried out at room temperature, TLC detection is carried out when the color of the solution becomes wine red and does not become lighter any more, and after the reaction products are completely reacted, saturated sodium bicarbonate aqueous solution is added immediately to stop the reaction so as to prevent the base of the deoxynucleoside from dropping under the strong acid condition for a long time.

In step (3), the 1H-tetrazole and phosphoramidite deoxythymidine (dT) are dissolved in anhydrous dichloromethane, and then 3' -Lev protected deoxycytidine (dC) is added to react to obtain the corresponding dimer module product. The anhydrous dichloromethane is used as a solvent, so that the anhydrous reaction system can be better ensured, and the phosphoramidite is prevented from being decomposed in the presence of water. In addition to 1H-tetrazole, 5-benzylthiotetrazole and 4, 5-Dicyanoimidazole (DCI) were used in this experiment. When 5-benzylthiotetrazole is used as a catalyst, the reaction is not greatly influenced, and only serious emulsification is easily caused during extraction and post-treatment. When DCI is used as the catalyst, a control of DCI is required for TLC because DCI develops under an ultraviolet lamp. However, because DCI can react with the aqueous solution of sodium bicarbonate, DCI can be washed away by the aqueous solution of sodium bicarbonate in the post-reaction treatment without affecting the purity of the product.

In the step (4), an oxidant is added into the raw materials, and an oxidized product can be obtained after stirring. The oxidant has darker color, the iodine is gradually reduced along with the reaction, the color of the solution is gradually lightened, when the color is not lightened any more, the reaction is finished, all the phosphoramidite is oxidized, the saturated sodium thiosulfate aqueous solution is used for stopping the reaction, and the required product can be obtained by treating the reaction solution.

In the step (5), hydrazine hydrate is used as a catalyst, and is dissolved in a newly prepared solution (pyridine: glacial acetic acid ═ 3:2), and after completely dissolved, the solution is added into a reaction bottle, added into the reaction solution, and stirred. After completion of the TLC detection reaction, the reaction flask was placed in an ice bath, and acetone was added and stirred to destroy hydrazine to terminate the reaction.

In step (6), due to the instability of phosphoramidite, anhydrous reagent is required for the reaction, and after the reaction is finished, the product is put into a refrigerator for freezing storage under the protection of nitrogen.

Because the polarity of the product in each step is larger, TLC developing agent of mixed solution of dichloromethane and methanol is adopted in the synthesis, and meanwhile, when a chromatographic column is used, a 0-10% methanol-dichloromethane mixed solution system is adopted as eluent.

Further, each reaction was carried out at room temperature with stirring. Except for the phosphoramidite oxidation in the step (3) and the Lev protection removal at the 3' position in the step (5), the conventional treatment is adopted, namely after extraction, saturated sodium bicarbonate aqueous solution, water and saturated sodium chloride aqueous solution are used for washing in sequence, and then anhydrous magnesium sulfate is used for drying and concentration.

After the extraction in the step (3), the residual iodine needs to be washed away by using saturated sodium thiosulfate and then the conventional washing is carried out. And (5) distilling under reduced pressure at 40 ℃ to remove an extractant dichloromethane, adding toluene into the residual solution, uniformly stirring, and distilling under reduced pressure at 50 ℃ to remove pyridine.

In step (3), some deoxycytidine (dC) is present after the reaction, which is similar in polarity to TC dimer and is very close in position in TLC and cannot be separated by column chromatography. However, the presence of deoxycytidine does not have an effect on the subsequent oxidation and 3' de-Lev. Therefore, the 3' position protection can be removed in the step (5) and then the separation and purification can be carried out on the chromatographic column, and the separation and purification on the chromatographic column is not needed after the steps (3) and (4) are finished.

In each step of the reaction, mild reaction conditions are used, and the condition that the deoxynucleoside is decomposed due to base drop or other conditions is avoided as much as possible.

The solution of the invention is illustrated below by means of specific embodiments:

example 1

1) EDCI (4.5g,23.7mmol), DMAP (0.1g,7.9mmol), levulinic acid 4(2.75g,23.7mmol) were dissolved in dichloromethane (20mL), starting material 1(5g,7.89mmol) was added and stirring continued overnight. After the completion of the DMTr-dC reaction by TLC detection, extraction is carried out, and saturated aqueous sodium bicarbonate solution is used in turnWater, brine wash, dry and concentrate to give crude product 2(7.37g, 124% yield) ESI-MS M/z [ M + H ]]⁺＝661.68；

2) Starting material 2(1.8g, 2.37mmol) was dissolved in anhydrous dichloromethane and dichloroacetic acid (0.98mL, 11.85mmol) was added. The reaction was terminated by adding saturated aqueous sodium bicarbonate until no starting material remained upon TLC detection. Extracted with DCM, washed, dried and concentrated. The solid was isolated by filtration as a portion of product (0.3889g) and the remaining filtrate was concentrated and purified using flash column (eluent: 0-10% MeOH/DCM) to give a second portion of product (0.59g) which was concentrated to give product 3 totaling 1.0g, 96.4% yield. ESI-MS M/z [ M + H ]]⁺＝316.33；

3) After dissolving raw material 3(6.35g, 14.8mmol) and 1H-tetrazole (1.04g, 14.8mmol) in dry DCM (70mL), 5 (phosphoramidite dT) (10.5g, 14.1mmol) was added to the reaction flask and stirred overnight. When no 5 was present in the TLC, the reaction was terminated by addition of saturated sodium hydroxide solution. Extraction with DCM, washing, drying and distillation under reduced pressure gave crude 6(16.82g, 104% yield), ESI-MS M/z [ M + H ]]⁺＝1306.39；

4) Adding raw material 6 (crude product of the previous step is used as raw material, 3.19g) into a reaction flask, adding oxidant (0.05M I2/pyridine, THF, H)₂O, 71.3mL) was stirred continuously until no starting material remained in TLC, saturated sodium thiosulfate solution was added to terminate the reaction, after extraction with DCM, the product was washed successively with saturated aqueous sodium thiosulfate solution, water, saturated brine and dried to give crude product 7(3.235g, 100% yield) ESI-MS M/z [ M + H ] after concentration]⁺＝1111.34；

5) 0.69mL of hydrazine hydrate was dissolved in a mixed solution of pyridine and glacial acetic acid (pyridine: glacial acetic acid 12 mL: 8mL) was used as the catalyst. Dissolving raw material 7(100mg, 0.092mmol) in 10mL pyridine, adding 2mL catalyst, stirring at room temperature for 15min, detecting no raw material by TLC, placing the reaction flask in ice bath, adding 2mL acetone, and stirring for 10 min. After dilution with DCM, it was extracted with DCM, washed and dried. After concentration, pyridine was removed by azeotropic distillation with toluene. Column chromatography (DCM/MeOH 0-10%) afforded the product 8(40mg, 44% yield) ESI-MS M/z [ M + H ]]⁺＝1013.31；

6) 2-cyanoethyl-bis (N, N-diisopropyl) phosphoramidite (9.6g, 31.64mmol), 1H-tetrazole (0.5g, 7.12mmol) was dissolved in 40mL anhydrous DCM. After the solution was clear, reaction 8(7.71g, 7.91mmol) was added and stirred overnight. The reaction was quenched by addition of saturated aqueous sodium bicarbonate, extracted with DCM, washed, dried and concentrated. Column chromatography (DCM/MeOH 0-10%) afforded the product 9(2.8g, 30% yield) ESI-MS M/z [ M + H ]]⁺＝1213.41。

And (4) conclusion: the synthetic route of TC dimer (TC-dimer) is shown in figure 1, and figure 2 is a mass spectrum diagram of the target compound synthesized in example 1.

As can be seen from the mass spectrum of FIG. 2, the desired synthesized TC dimer has been obtained. The experimental method can successfully synthesize corresponding target compounds, and compared with a single monomer DNA chain synthesis method, the experimental method proves the feasibility of the method for synthesizing the long DNA chain by the module + single monomer circulation.

Example 2

The TC dimer synthesized in example 1 was used for the synthesis of the actual DNA strand.

Two sets of DNA strands were co-synthesized, GAAGACCCGGACCCCTTGCTC and GCTAAGCTTAGTCTCTCATTACTAATGG, respectively. Each group was run in comparison with TC dimer as the starting material and DT and DC monomers as the starting materials. As shown in the following Table 1-2, the machine used was an LK-48DNA synthesizer, and the operation program was an LK-48DNA synthesizer operation program.

TABLE 1 primer sequences

P5430-22	GCTAAGCTTAGA“TC”“TC”“TC”ATTACTAATGG
		E120R-44	GAAGACCCGGACCCCTTGC“TC”

Table 2 actual liquid dosage per step for each reagent:

reagent	Amount of liquid (μ L)
		Catalyst and process for preparing same	50.00
“TC”	40.00
		dT	40.00
dA	40.00
		dC	40.00
dG	40.00
		CAP-B	40.00
CAP-A	40.00
		OX-1	70.00
ACN	160.00

Conclusion of comparison of E120R-44 primers using TC dimer ("TC") as the starting material and dT and dC monomers as the starting materials, respectively: FIG. 3 is an HPLC chart of primers synthesized from TCdimer, and FIG. 4 is an HPLC chart of primers synthesized from dT and dC monomers.

In FIG. 3, the retention time of the target product was 3.873min, the peak area was 4466332, the peak area ratio was 91.06%, the peak height was 544440, and the OD was 6.56.

In FIG. 4, the retention time of the target product is 3.879min, the peak area is 11407516, the peak area ratio is 86.77%, the peak height is 1376561, and the OD is 16.8.

As can be seen from FIGS. 3-4, the primer with TC dime at the 3' end has better purity (because only the primer with TC dime can be connected with the next monomer) but has lower OD value.

The P5430-22 primer adopts TC dimer as a raw material and dT and dC monomers as a comparative conclusion: FIG. 5 is an HPLC chart of a primer synthesized from TC dimer, and FIG. 6 is an HPLC chart of a primer synthesized from dT and dC monomers.

In FIG. 5, the retention time of the target product is 4.313min, the peak area is 494923, the peak area accounts for 7.30%, the peak height is 55063, and the OD value is 0.6.

In FIG. 6, the retention time of the target product is 4.330min, the peak area is 8738890, the peak area ratio is 86.75%, the peak height is 1020156, and the OD value is 31.

In FIG. 5, the peak with a retention time of 4.313min is the target product, and although the yield is low compared to the normal synthesized primer, the peak shape is symmetrical, and the content of byproducts with similar retention time is low.

As can be seen from the above comparison, the synthesized deoxynucleotide module can be applied to the synthesis of a DNA oligonucleotide chain and has a certain effect.

While particular embodiments of the present invention have been illustrated and described, it would be obvious that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.

Claims

1. A method for synthesizing modular DNA, which is characterized by comprising the following steps:

preferably, the raw material further comprises deoxynucleotide monomers.

2. The method for synthesizing DNA according to claim 1, wherein the bases in the nucleoside module units to be coupled are different bases or the same base.

3. The method for synthesizing DNA according to claim 1, wherein the nucleoside modular unit is at least one of a dimer modular unit, a trimer modular unit, and a tetramer modular unit.

4. The method for synthesizing DNA according to claim 3, wherein the nucleoside module unit is a dimer module unit.

5. The method for synthesizing DNA according to any one of claims 1 to 4, wherein the solid phase synthesis is performed on a DNA synthesizer.

6. The method for synthesizing DNA according to any one of claims 1 to 4, wherein the method for synthesizing the nucleoside module unit comprises:

preferably, the phosphoramidite nucleoside contains a phosphate ester group selected from one of methyl, ethyl, propyl and isopropyl;

7. The method for synthesizing DNA according to claim 6, wherein the catalyst for catalytic coupling is one of 1H-tetrazole, 5-benzylthiotetrazole, and 4, 5-dicyanoimidazole.

8. The method for synthesizing DNA according to claim 6, wherein the catalyst for catalytic coupling is 4, 5-dicyanoimidazole.

9. The method for synthesizing DNA according to claim 6, wherein the protecting group of 5' -hydroxyl group is removed by reacting with protonic acid;

10. The method for synthesizing DNA according to claim 6, wherein hydrazine hydrate is catalyzed to remove a protecting group of the 3' -hydroxyl group.