CN111718387A - A Modular DNA Synthesis Method - Google Patents

Abstract

The present invention provides a method for synthesizing modular DNA, comprising the following steps: adopting a solid-phase synthesis method to synthesize DNA from raw materials comprising nucleoside modular units; wherein the nucleoside modular units are coupled by two or more deoxynucleotides. Link to get. The synthesis method of the invention improves the efficiency and fidelity of DNA long-chain synthesis, has certain broad-spectrum applicability, and is worthy of wide popularization and application.

Description

A Modular DNA Synthesis Method

technical field

The invention relates to the field of DNA synthesis, in particular to a modular DNA synthesis method.

Background technique

In recent years, with the development of synthetic biology, the requirements for the fidelity of DNA synthesis are getting higher and higher. The traditional single nucleoside step-by-step synthesis method has been unable to meet the needs. How to improve the efficiency and accuracy of DNA synthesis is the main field in today's field development direction.

Traditionally, DNA synthesis takes a single nucleoside as a single monomer, and adopts a 'four-step method' cycle mode of deprotection-coupling-capping-oxidation. Because it is based on a single monomer, when synthesizing long chains, Acid deprotection is required in each cycle, so a large number of acid deprotection processes will be experienced when synthesizing long chains. However, under acidic conditions, the purine bases on the nucleosides are unstable and fall off easily, resulting in the loss of a large number of bases in the synthesized long-chain DNA, reducing the accuracy of the long-chain DNA obtained, and the synthesis of the required amount of DNA. The cost of long DNA chains increases.

At the same time, due to the incomplete quantitative reaction in the process of deprotection, coupling, capping, etc., the by-product of single nucleoside deletion ((n-1)mer) will also be produced, which is difficult to separate and purify, which seriously affects the fidelity of DNA. Spend.

In addition, when synthesizing conventional long-chain DNA, the coupling efficiency of A, G, etc. is relatively low, which also affects the synthesis efficiency and accuracy of the synthesized long-chain DNA. Minimizing the number of coupling times of nucleoside monomers in the synthesis of long DNA chains can improve the synthesis efficiency and accuracy of the synthesized long-chain DNA. Taking the synthesis of 100nt DNA as an example, it only takes 50 cycles to synthesize the dimer module. Completed, it can reduce more than 50 deprotection, coupling and capping processes, cut the time in half, and also avoid the by-products of (n-1)mers that are difficult to purify, therefore, the efficiency and fidelity of DNA synthesis can be improved. .

In view of this, the present invention is proposed.

SUMMARY OF THE INVENTION

The purpose of the present invention is to provide a method for synthesizing DNA using modular deoxynucleotides. The synthesis method of the present invention fully improves the synthesis rate of long-fragment oligonucleotides, reduces the number of acid deprotection times to reduce depurination, etc. Synthetic side reactions, avoiding the problem of low A and G coupling efficiency and reducing the synthesis efficiency, have a very wide range of applicability.

In order to realize the above-mentioned purpose of the present invention, the following technical solutions are specially adopted:

The invention provides a kind of synthetic method of DNA, comprising the steps:

Use solid-phase synthesis to synthesize DNA from raw materials containing nucleoside modular units;

wherein the nucleoside modular unit is obtained by coupling two or more deoxynucleotides;

Preferably, the raw material also includes deoxynucleotide monomers.

In the above synthesis method, by using nucleoside modular units as raw materials to synthesize DNA, the synthesis efficiency is significantly improved, the high-fidelity synthesis of long-segment oligonucleotides is realized, and the consumption of synthetic raw materials and reagents is reduced on this basis. It can reduce the cost of DNA synthesis and improve the accuracy of DNA synthesis at the same time.

Preferably, as a further implementable solution, the bases in the nucleoside modular units for coupling are different bases or the same base.

Preferably, as a further implementable solution, the nucleoside modular unit is at least one of a dimer modular unit, a trimer modular unit and a tetrameric modular unit.

Preferably, as a further implementable solution, the nucleoside modular unit is a dimer modular unit.

Preferably, as a further possible embodiment, the solid phase synthesis is carried out on a DNA synthesizer.

Preferably, as a further implementable solution, the method for synthesizing the nucleoside modular unit includes:

(1) reacting the deoxynucleoside protected by the protective group with levulinic acid, under alkaline environment and catalytic conditions, to obtain the deoxynucleoside protected by the active group;

(2) Remove the protective group of its 5'-hydroxyl group, catalyze coupling with phosphoramidite nucleoside, and oxidize;

(3) remove the protecting group of its 3'-hydroxyl, connect phosphoramidite;

(4) when there are two or more bases in the nucleoside modular unit, repeat the above steps (2)-(3) to obtain the nucleoside modular unit;

Preferably, the protecting group is selected from one of a trityl group, a monomethoxytrityl group, and a dimethoxytrityl group.

Preferably, as a further implementable solution, the catalyst for catalyzing the coupling is one of 1H-tetrazole, 5-benzylthiotetrazole, and 4,5-dicyanoimidazole.

Preferably, as a further implementable solution, the catalyst for catalyzing the coupling is 4,5-dicyanoimidazole.

Preferably, as a further implementable scheme, reaction with a protonic acid is used to remove the protecting group of its 5'-hydroxyl group.

Preferably, the protic acid is selected from one of trichloroacetic acid and dichloroacetic acid.

Preferably, as a further implementable solution, hydrazine hydrate is catalyzed to remove the protecting group of its 3'-hydroxyl group.

Compared with the prior art, the beneficial effects of the present invention are:

1) The present invention uses modular deoxynucleotides as raw materials to synthesize long-chain oligonucleotides, thereby reducing the number of acid deprotection performed during the synthesis of oligonucleotide chains, and effectively preventing acid deprotection. The base of deoxynucleotide is unstable and easy to fall off under the conditions, and the synthesis steps can be reduced, thereby improving the synthesis efficiency and accuracy of the oligonucleotide chain;

2) The synthesis method of the present invention changes the original cycle mode of a single monomer, and changes the synthesis mode into a modular cycle mode, or a modular + monomer cycle mode, thus avoiding the low coupling efficiency of A and G. The problem of reducing synthesis efficiency has a very wide range of applicability.

Description of drawings

In order to illustrate the embodiments of the present invention or the technical solutions in the prior art more clearly, the following briefly introduces the accompanying drawings that are required to be used in the description of the embodiments or the prior art.

Fig. 1 is the synthetic route synoptic diagram of TC dimer in the embodiment of the present invention 1;

Fig. 2 is the mass spectrogram of the dimer TC dimer of the embodiment of the present invention 1;

Fig. 3 is the HPLC figure that adopts the dimer TC dimer of the embodiment of the present invention 1 to synthesize target primer E120R-44;

Fig. 4 is the HPLC chart of adopting deoxynucleoside monomer to synthesize primer E120R-44 in the embodiment of the present invention 2;

Fig. 5 is the HPLC figure that adopts the dimer TC dimer of the embodiment of the present invention 1 to synthesize target primer P5430-22;

Fig. 6 is the HPLC chart of adopting deoxynucleoside monomer to synthesize primer P5430-22 in the embodiment of the present invention 2;

Fig. 7 is the structural representation of the nucleoside modular unit of the present invention;

Figure 8 is a schematic diagram of the synthesis of the modular DNA of the present invention.

Detailed ways

The embodiments of the present invention will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. If the specific conditions are not indicated in the examples, it is carried out according to the conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments used without the manufacturer's indication are conventional products that can be purchased from the market.

The invention provides a kind of synthetic method of DNA, comprising the steps:

Use solid-phase synthesis to synthesize DNA from raw materials containing nucleoside modular units;

The nucleoside modular unit is obtained by coupling two or more deoxynucleotides.

Preferably, the raw material also includes deoxynucleotide monomers.

In the above synthesis method, by using nucleoside modular units as raw materials to synthesize DNA, the synthesis efficiency is significantly improved, the high-fidelity synthesis of long-segment oligonucleotides is realized, and the consumption of synthetic raw materials and reagents is reduced on this basis. It can reduce the cost of DNA synthesis and improve the accuracy of DNA synthesis at the same time.

The raw material can be directly selected from the modular nucleoside module unit, or the combination of modular and deoxynucleotide monomers can be selected, which can be flexibly selected according to the actual situation.

Preferably, as a further feasible solution, the bases in the nucleoside modular unit to be coupled are different bases or the same base, so the nucleoside modular unit itself contains various types of deoxynucleotides. Variously, A, G, C, T can be combined arbitrarily to form a nucleoside modular unit.

Preferably, as a further implementable solution, the nucleoside modular unit is at least one of a dimer coupling unit, a trimer coupling unit and a tetramer coupling unit.

Preferably, as a further feasible solution, the nucleoside modular unit is a dimer coupling unit, and the dimer coupling unit can be 16 combinations of AA, AG, AC, AT, GG, CT, TT, etc. .

Then, there are more combinations of the trimer coupling unit, which are not listed one by one. The specific structure of the nucleoside modular unit is shown in Figure 7, and the synthetic route of the modular DNA is shown in Figure 8.

Preferably, as a further implementable solution, the solid-phase synthesis method is performed on a DNA synthesizer.

More preferably, the long-chain oligonucleotide is synthesized by using a DNA synthesizer as a device and 4,5-dicyanoimidazole as a catalyst.

Preferably, as a further implementable solution, the method for synthesizing the nucleoside modular unit includes:

(1) reacting the deoxynucleoside protected by the protective group with levulinic acid, under alkaline environment and catalytic conditions, to obtain the deoxynucleoside protected by the active group;

(2) Remove the protective group of its 5'-hydroxyl group, catalyze coupling with phosphoramidite nucleoside, and oxidize;

(3) remove the protecting group of its 3'-hydroxyl, connect phosphoramidite;

(4) When there are two or more bases in the nucleoside modular unit, repeat the above steps (2)-(3) to obtain the nucleoside modular unit.

Preferably, the protecting group is selected from one of a trityl group, a monomethoxytrityl group, and a dimethoxytrityl group.

Preferably, as a further implementable solution, the catalyst for catalyzing the coupling is one of 1H-tetrazole, 5-benzylthiotetrazole, and 4,5-dicyanoimidazole.

Preferably, as a further implementable solution, the catalyst for catalyzing the coupling is 4,5-dicyanoimidazole.

Preferably, as a further implementable scheme, reaction with a protonic acid is used to remove the protecting group of its 5'-hydroxyl group.

Preferably, the protic acid is selected from one of trichloroacetic acid and dichloroacetic acid.

Preferably, as a further implementable solution, hydrazine hydrate is catalyzed to remove the protecting group of its 3'-hydroxyl group.

Specifically, taking the dimer as an example, the specific coupling method includes the following steps:

(1) The DMT-protected deoxynucleoside reacts with levulinic acid to generate 3'-Lev, 5'-DMTr-protected deoxynucleoside. The above reaction requires EDCI as a base, DMAP as a catalyst, and DCM as a solvent , at room temperature.

(2) dissolving the product obtained in (1) in dichloroacetic acid to deprotect the 5'-position DMTr to obtain a 3'-Lev-protected deoxynucleoside.

(3) Dissolving the product obtained in (2) in anhydrous dichloromethane, and reacting with phosphoramidite nucleoside under the catalysis of 1H-tetrazole to obtain a dimerized product.

(4) The product obtained in (3) is oxidized with an iodine oxidant to obtain an oxidized dimerized product.

(5) The product obtained in (4) is catalyzed by hydrazine hydrate to remove the protection of the 3'-position Lev.

(6) The product obtained in (5) is reacted with 2-cyanoethyl-bis(N,N-diisopropyl)phosphoramidite to introduce a phosphoramidite at the 3' position.

In the above-mentioned steps, after first protecting the hydroxy group at the 3' position with levulinic acid, then remove the DMTr protected by the hydroxyl group at the 5' position, in order to allow it to react with the phosphoramidite nucleoside, only take a product as The main product can effectively reduce or even avoid the appearance of by-products, which is more conducive to the separation and purification after the reaction.

Since deoxynucleosides have two exposed hydroxyl groups, which are located on the 3' carbon and the 5' carbon, respectively. If the hydroxyl group on the 3' carbon is not protected, the hydroxyl groups at these two positions on different deoxynucleosides can react, resulting in other dimers and affecting the reaction yield. At the same time, the 3'-protected acetylpropyl group will not be oxidized by the iodine oxidant used, and after the reaction, it is easily deprotected, so it is selected as a protecting group to protect the 3'-hydroxyl group.

In step (2), after the raw material is dissolved in dichloromethane, 5 times of dichloroacetic acid is added, and the reaction of removing DMTr is carried out at room temperature, when the color of the solution becomes wine red and no longer becomes lighter, Carry out TLC test. After the reactants are completely reacted, saturated aqueous sodium bicarbonate solution is added immediately to stop the reaction to prevent the deoxynucleosides from being exposed to strong acid conditions for a long time.

In step (3), after dissolving 1H-tetrazole and phosphoramidite deoxythymidine (dT) in anhydrous dichloromethane, then adding 3'-Lev protected deoxycytidine (dC), after the reaction, the The corresponding dimer modular product was obtained. Using anhydrous dichloromethane as the solvent can better ensure that the reaction system is anhydrous and prevent the phosphoramidite from decomposing in the presence of water. In addition to 1H-tetrazole, 5-benzylthiotetrazole and 4,5-dicyanoimidazole (DCI) were also used in this experiment. When 5-benzylthiotetrazole is used as the catalyst, it has no great influence on the reaction, but it is easy to cause serious emulsification during extraction and post-processing. When DCI is used as the catalyst, since DCI develops color under UV light, a DCI control is required for TLC. But because DCI can react with sodium bicarbonate aqueous solution, it can be washed off by sodium bicarbonate aqueous solution in the post-reaction treatment without affecting the product purity.

In step (4), the oxidizing agent is added to the raw material, and the oxidized product can be obtained after stirring. Since the oxidant has a darker color, as the reaction proceeds, the iodine gradually decreases, and the color of the solution will gradually become lighter. When the color no longer becomes lighter, it indicates that the reaction is complete and all phosphoramidites have been oxidized. After the aqueous solution terminates the reaction, the desired product can be obtained by processing the reaction solution.

In step (5), using hydrazine hydrate as a catalyst, it is dissolved in a newly configured solution (pyridine: glacial acetic acid = 3:2), and after it is completely dissolved, it is added to the reaction flask and added to the reaction solution Stir. After the completion of the reaction detected by TLC, the reaction flask was placed in an ice bath, and acetone was added to stir to destroy the hydrazine to terminate the reaction.

In step (6), due to the instability of phosphoramidite, the reaction must use anhydrous reagents, and at the same time, after the reaction is completed, the product needs to be placed in a refrigerator for freezing storage under nitrogen protection.

Due to the high polarity of the products in each step, during the synthesis, the TLC developing solvent of a mixture of dichloromethane and methanol was used. At the same time, when using a chromatographic column, the eluent was 0-10% methanol-dichloromethane. mixed liquid system.

In addition, each step of the reaction was carried out with stirring at room temperature. Except for step (3) phosphoramidite oxidation and step (5) de-Lev protection at 3' position, conventional treatment is adopted, that is, after extraction, saturated aqueous sodium bicarbonate solution, water, and saturated aqueous sodium chloride solution are used in order to wash, then use Dry over anhydrous magnesium sulfate and concentrate.

In step (3), after the extraction, it is necessary to first use saturated sodium thiosulfate to wash away the residual iodine, and then carry out conventional washing. In step (5), distill under reduced pressure at 40° C. to remove the extractant dichloromethane, then add toluene to the remaining solution and stir evenly, and then distill under reduced pressure at 50° C. to remove pyridine.

In step (3), there will be part of deoxycytidine (dC) after the reaction, which has similar polarity to TC dimer, and its position is very close in TLC, so it cannot be separated by chromatographic column method. However, the presence of deoxycytidine has no effect on subsequent oxidation and 3' deLev. Therefore, chromatographic column separation and purification can be performed after step (5) is deprotected at the 3' position, while chromatographic column separation and purification is not required after steps (3) and (4) are completed.

In each step of the reaction of the present invention, relatively mild reaction conditions are used, and the deoxynucleosides are decomposed as far as possible due to the shedding of bases or other conditions.

The scheme of the present invention is described below by specific embodiments:

Example 1

1) After dissolving EDCI (4.5 g, 23.7 mmol), DMAP (0.1 g, 7.9 mmol), levulinic acid 4 (2.75 g, 23.7 mmol) in dichloromethane (20 mL), add raw material 1 (5 g, 7.89 mmol) ) and continued stirring overnight. After TLC detected that the DMTr-dC reaction was complete, it was extracted with an aqueous saturated sodium bicarbonate solution, washed with water and saturated brine, dried, and concentrated to obtain a crude product 2 (7.37 g, yield 124%) ESI-MS m/ z[M+H] ⁺ =661.68;

2) After dissolving raw material 2 (1.8 g, 2.37 mmol) in anhydrous dichloromethane, dichloroacetic acid (0.98 mL, 11.85 mmol) was added. The reaction was carried out until no starting material remained in the TLC detection, and saturated aqueous sodium bicarbonate solution was added to terminate the reaction. It was extracted with DCM, washed, dried and concentrated. The solid precipitated by filtration was part of the product (0.3889g), the remaining filtrate was concentrated and purified by flash column (eluent: 0-10% MeOH/DCM) to obtain the second part of the product (0.59g), a total of 1.0g of product 3 was obtained , the yield was 96.4%. ESI-MS m/z[M+H] ⁺ =316.33;

3) After dissolving raw material 3 (6.35 g, 14.8 mmol) and 1H-tetrazole (1.04 g, 14.8 mmol) in dry DCM (70 mL), 5 (phosphoramidite dT) (10.5 g, 14.1 mmol) was dissolved in anhydrous DCM (70 mL). Add to reaction flask and stir overnight. When no 5 was present in TLC, saturated sodium hydroxide solution was added to terminate the reaction. Extracted with DCM, washed, dried and distilled under reduced pressure to obtain crude product 6 (16.82 g, yield 104%), ESI-MS m/z [M+H] ⁺ =1306.39;

4) The raw material 6 (the crude product of the purified product in the above step is the raw material, 3.19 g) was added to the reaction flask, and an oxidant (0.05M I2/pyridine, THF, H ₂ O, 71.3 mL) was added and stirred until no raw material remained in the TLC. , added saturated sodium thiosulfate solution to terminate the reaction, extracted with DCM, washed with saturated sodium thiosulfate aqueous solution, water, and saturated brine successively and dried, concentrated to obtain crude product 7 (3.235 g, yield 100%) ESI -MS m/z[M+H] ⁺ =1111.34;

5) 0.69 mL of hydrazine hydrate was dissolved in pyridine, and a mixed solution of glacial acetic acid (pyridine: glacial acetic acid = 12 mL: 8 mL) was used as a catalyst. Raw material 7 (100 mg, 0.092 mmol) was dissolved in 10 mL of pyridine, 2 mL of catalyst was added to it, and stirred at room temperature for 15 min. After TLC detected no raw material, the reaction flask was placed in an ice bath, and 2 mL of acetone was added to continue stirring for 10 min. After dilution with DCM, extraction with DCM, washing and drying. After concentration, toluene was added to remove pyridine azeotropically. Passing through column (DCM/MeOH 0～10%) gave product 8 (40 mg, yield 44%) ESI-MS m/z [M+H] ⁺ =1013.31;

6) Dissolve 2-cyanoethyl-bis(N,N-diisopropyl)phosphoramidite (9.6g, 31.64mmol) and 1H-tetrazole (0.5g, 7.12mmol) in 40mL of anhydrous DCM . After the solution was clear, reactant 8 (7.71 g, 7.91 mmol) was added and stirred overnight. The reaction was quenched by addition of saturated aqueous sodium bicarbonate solution, extracted with DCM, washed, dried and concentrated. Column passing (DCM/MeOH=0-10%) gave product 9 (2.8 g, yield 30%) ESI-MS m/z [M+H] ⁺ =1213.41.

Conclusion: The synthetic route of TC dimer (TC-dimer) is shown in Figure 1, and Figure 2 is the mass spectrum of the target compound synthesized in Example 1.

It can be seen from the mass spectrum of Fig. 2 that the desired synthetic TC dimer has been obtained. It is demonstrated that this experimental method can successfully synthesize the corresponding target compounds. By comparing with the single monomer DNA chain synthesis method, the feasibility of the method of modular + single monomer cycle synthesis of long DNA chains is confirmed.

Example 2

The TC dimer synthesized in Example 1 above was used to synthesize the actual DNA strand.

Two sets of DNA strands were synthesized, namely GAAGACCCGGACCCCTTGCTC and GCTAAGCTTAGTCTCTCATTACTAATGG. Each group was compared with TC dimer as raw material and DT and DC monomers as raw materials. As shown in Table 1-2 below, the machine used is the LK-48 DNA synthesis instrument, and the operation program is the operation program of the LK-48 DNA synthesis instrument.

Table 1 Primer sequences

P5430-22 GCTAAGCTTAGA "TC" "TC" "TC" ATTACTAATGG E120R-44 GAAGACCCGGACCCCTTGC "TC"

Table 2 The actual volume of each reagent in each step:

reagent Liquid volume (μL) catalyst 50.00 "TC" 40.00 dT 40.00 dA 40.00 dC 40.00 dG 40.00 CAP-B 40.00 CAP-A 40.00 OX-1 70.00 ACN 160.00

The E120R-44 primers use TC dimer (“TC”) as raw material and dT and dC monomers as raw materials respectively. Comparison of the conclusions: Figure 3 is the HPLC chart of the primers synthesized by TC dimer, and Figure 4 is the use of dT and dC monomers. HPLC profile of the synthesized primers.

In Figure 3, the retention time of the target product was 3.873 min, the peak area was 4466332, the peak area accounted for 91.06%, the peak height was 544440, and OD: 6.56.

In Figure 4, the retention time of the target product was 3.879 min, the peak area was 11407516, the peak area accounted for 86.77%, the peak height was 1376561, and OD: 16.8.

It can be seen from Figure 3-4 that the primers with TC dime at the 3' end are synthesized with good purity (because only the primers connected to TC dime can connect to the next monomer) but the OD value is low.

P5430-22 primers use TC dimer as raw materials and dT and dC monomers as raw materials respectively. Comparison of the conclusions: Figure 5 is the HPLC chart of the primers synthesized by TC dimer, and Figure 6 is the primers synthesized by using dT and dC monomers. HPLC chart.

In Figure 5, the retention time of the target product was 4.313 min, the peak area was 494923, the peak area accounted for 7.30%, the peak height was 55063, and the OD value was 0.6.

In Figure 6, the retention time of the target product was 4.330 min, the peak area was 8738890, the peak area accounted for 86.75%, the peak height was 1020156, and the OD value was 31.

In Figure 5, the peak with a retention time of 4.313 min is the target product. Although the yield is lower than that of the normally synthesized primers, the peak shape is symmetrical, and the content of by-products with similar retention times is low.

It can be seen from the above comparison that the synthesized deoxynucleotide modules can be used in the synthesis of DNA oligonucleotide chains and have certain effects.

Although specific embodiments of the present invention have been illustrated and described, it should be understood that various other changes and modifications can be made without departing from the spirit and scope of the invention. Therefore, it is intended that all such changes and modifications as fall within the scope of this invention be included in the appended claims.

Claims (10)

1. a synthetic method of modular DNA, is characterized in that, comprises the steps: Use solid-phase synthesis to synthesize DNA from raw materials containing nucleoside modular units; wherein the nucleoside modular unit is obtained by coupling two or more deoxynucleotides; Preferably, the raw material also includes deoxynucleotide monomers. 2 . The method for synthesizing DNA according to claim 1 , wherein the bases in the coupled nucleoside modular units are different bases or the same base. 3 . 3 . The method for synthesizing DNA according to claim 1 , wherein the nucleoside module unit is at least one of a dimer module unit, a trimer module unit and a tetramer module unit. 4 . 4. The method for synthesizing DNA according to claim 3, wherein the nucleoside modular unit is a dimer modular unit. 5. The method for synthesizing DNA according to any one of claims 1-4, wherein the solid-phase synthesis is performed on a DNA synthesizer. 6. The method for synthesizing DNA according to any one of claims 1-4, wherein the method for synthesizing the nucleoside modular unit comprises: (1) reacting the deoxynucleoside protected by the protective group with levulinic acid, under alkaline environment and catalytic conditions, to obtain the deoxynucleoside protected by the active group; (2) Remove the protective group of its 5'-hydroxyl group, catalyze coupling with phosphoramidite nucleoside, and oxidize; Preferably, the phosphorus ester group contained in the phosphoramidite nucleoside is selected from one of methyl, ethyl, propyl, and isopropyl; (3) remove the protecting group of its 3'-hydroxyl, connect phosphoramidite; (4) when there are two or more bases in the nucleoside modular unit, repeat the above steps (2)-(3) to obtain the nucleoside modular unit; Preferably, the protecting group is selected from one of a trityl group, a monomethoxytrityl group, and a dimethoxytrityl group. 7 . The method for synthesizing DNA according to claim 6 , wherein the catalyst for catalytic coupling is one of 1H-tetrazole, 5-benzylthiotetrazole, and 4,5-dicyanoimidazole. 8 . 8 . The method for synthesizing DNA according to claim 6 , wherein the catalyst for catalytic coupling is 4,5-dicyanoimidazole. 9 . 9. the synthetic method of DNA according to claim 6, is characterized in that, with protonic acid reaction to remove the protecting group of its 5'-hydroxyl; Preferably, the protic acid is selected from one of trichloroacetic acid and dichloroacetic acid. 10. The method for synthesizing DNA according to claim 6, wherein hydrazine hydrate catalyzes the removal of the protective group of its 3'-hydroxyl group.

Images