CN111714510B - Application of long-chain non-coding RNA SNHG12 inhibitor in preparation of anti-osteoporosis drugs - Google Patents

Abstract

The invention belongs to the field of biomedicine, and particularly relates to application of a long-chain non-coding RNASNHG12 inhibitor in preparation of a drug for resisting osteoporosis. The invention relates to a siRNA inhibitor composition which utilizes siRNA as an RNASNNHG 12 inhibitor, wherein the siRNA inhibitor composition comprises one or more of sequences shown as SEQ ID No. 2-3, SEQ ID No. 4-5 and SEQ ID No. 6-7, the sequences are synthesized by designing the siRNA of a targeted SNHG12 gene, and after in vitro efficacy evaluation, the SNHG12 inhibitor is found to remarkably promote the osteogenic differentiation process of stem cells and show the potential of preparing a new medicament for treating osteoporosis.

Description

Application of long-chain non-coding RNA SNHG12 inhibitor in preparation of anti-osteoporosis drugs

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to an application of a long-chain non-coding RNA SNHG12 inhibitor in preparation of a drug for resisting osteoporosis.

Background

Osteoporosis is a systemic bone disease characterized mainly by decreased bone mass and collapse of bone structure, which in turn leads to increased bone fragility, decreased bone strength, and increased risk of fracture. The world health organization has listed osteoporosis, diabetes and cardiovascular diseases as three major killers harming the health of the elderly. Recent epidemiological reports show that the population growth rate of osteoporosis of men and women in China is 15% and 20% respectively every decade, about 1.4 hundred million osteoporosis patients exist in China at present, and the number of osteoporosis patients in China is more than 2 hundred million and is estimated to account for more than half of the osteoporosis patients in the world in 2020. Osteoporosis and fractures caused by osteoporosis are one of the main causes of disability and death of the old. The survey shows that in 2010, 233 thousands of people in China have osteoporotic fracture, and the medical cost is 94.5 hundred million dollars. This figure is expected to double by 2035 years, and by 2050, osteoporotic fractures in our population will increase to 599 million people per year, costing medical costs as much as $ 254.3 million. The medical treatment and nursing of the hospitalized patients caused by osteoporosis and osteoporotic fracture need to invest a large amount of resources, which causes heavy burden to families and society. At present, the common drugs for treating osteoporosis in clinic are mainly drugs for inhibiting bone resorption such as bisphosphonates, estrogen and the like, while the drugs for promoting bone formation are only clinically applied to parathyroid hormone analogues, but the parathyroid hormone analogues have a dosage window period of 2 years, so that the clinical curative effect of the parathyroid hormone analogues is limited, the parathyroid hormone analogues are expensive, and the clinical application of the parathyroid hormone analogues is further limited. Therefore, the search for new drug targets for promoting bone formation and the development of new drugs for promoting bone formation are urgently needed.

Osteoblasts are the basic functional unit for bone formation and are important functional cells in the process of continuous self-renewal of bones. The dynamic balance maintained between osteoblast-dominated bone formation and osteoclast-dominated bone resorption is the basis for the maintenance of normal bone mass. Osteoblasts are derived from bone marrow mesenchymal stem cells, mature osteoblasts do not undergo cell division any more when entering a bone secreting stage, and osteoblasts which proliferate to a certain amount enter a differentiation stage and can undergo mineralization after differentiation and maturation. Therefore, deepening the molecular biological mechanism of osteoblast differentiation and mineralization process provides important clues for finding the bone formation promoting drug target and screening safer and more effective therapeutic drugs.

Long non-coding RNA (lncRNA) is a class of RNA molecules that are 200 bases or more in length and generally do not have a protein coding function. The lncRNA is an important regulatory molecule in a genome, can play a role in biological functions in multiple aspects of gene transcription, protein translation and post-translational modification, epigenetics and the like, has been reported by multiple researches to have an important regulating and controlling effect on osteogenic differentiation and bone formation processes, and shows that the lncRNA is an ideal target spot for treating osteoporosis. At present, the research aiming at the long-chain non-coding RNA SNHG12 mainly focuses on the research of tumors, and the research and the report on the effects of the long-chain non-coding RNA SNHG12 in the processes of osteoblast differentiation and bone formation and in the diagnosis and treatment of bone system diseases such as osteoporosis are not found.

Disclosure of Invention

Aiming at the defects generally existing in the prior art, the invention provides a siRNA inhibitor composition and application thereof. The expression level of SNHG12 before and after osteogenic differentiation of human bone marrow mesenchymal stem cells is detected for the first time through Q-PCR, the fact that the expression of SNHG12 is obviously reduced in the osteogenic differentiation process is confirmed, and the siRNA composition capable of specifically reducing the expression level of cell SNHG12 genes is obtained through designing and chemically synthesizing an siRNA sequence of specifically targeting SNHG12 genes and is used for preparing a new medicine for inhibiting osteoporosis.

In order to achieve the purpose, the invention adopts the technical scheme that:

an siRNA inhibitor composition comprises one or more of siRNA-1, siRNA-2 and siRNA-3 sequences.

Preferably, the sequences of the siRNA-1, the siRNA-2 and the siRNA-3 are all a section of siRNA sequence in the SNHG12 gene.

Preferably, the nucleotide sequence information of the SNHG12 gene is shown as SEQ ID NO. 1.

CTTTCTCCCCGCCGCATTCCCGGTGTCGACTTACTAGCTGCAAGCCTCTGCCTGCCTTCCTGCGCGCCGTTCCCCGCTAGTCGCTGCTGCTGGCGCGCACTCGCCGGGTTTTTCCTCCCACGGCCTCGAGATGGTGGTGAATGTGGCACGGAGGAGCCGGGCCTTCCAACCCGGTGGGCCCGAGCTCCGAAAGGCCCCCTCGGCAGTGAGAGGGGCGGGAGCCCGCGGGGGCCGCGCCCTTCTCTCGCTTCGGACTGCGCAACGCTGCGCTCTGGGCTGACAGGCGGATAAAACGGTCCCATCAAGACTGAGAAAAAGCACACCAGCTATTGGCACAGCGTGGGCAGTGGGGCCTACAGGATGACTGACTTAGTCTACAGAGATCCCGGCGTACTTAAGCAGATGAAGACTCTTAAGATGACAGAAGGTGATTTTTCTGGTGATCGAGGACTTCCGGGGTAATGACAGTGATGAAATGCAGGGGACCTGGTTGCCCCCAAGTTTCCTGGCAGTGTGTGATACTGAGGAGGTGAGCTTGTTTCTGGAGCTGTGCTTTAAGATTCATGTTACATGTAAAGCTGTCCTCATTTGTGACTATGGACCTATGGAGTTGGGACAATCTCTATGGGAAGCAGAAGGCAAGGACCCCGGTCATTTTAGGTAGAAACAACAGCATGCTAATGCAAAAAATTATGCAGTGTGCTACTGAACTTCAGAGGTGATCAATAAAAGAAGAATAAAAAGACTAATAAAAGTA(SEQ ID NO.1)；

Preferably, the forward nucleotide sequence information of the siRNA-1 is shown as SEQ ID NO.2, and the reverse nucleotide sequence information is shown as SEQ ID NO. 3; the forward nucleotide sequence information of the siRNA-2 is shown as SEQ ID NO.4, and the reverse nucleotide sequence information is shown as SEQ ID NO. 5; the forward nucleotide sequence information of the siRNA-3 is shown as SEQ ID NO.6, and the reverse nucleotide sequence information is shown as SEQ ID NO. 7.

Sense：5'-UCUUAAGAGUCUUCAUCUGCU-3'(SEQ ID NO.2)

Antisense：5'-CAGAUGAAGACUCUUAAGAUG-3'(SEQ ID NO.3)

Sense：5'-AUUUCAUCACUGUCAUUACCC-3'(SEQ ID NO.4)

Antisense：5'-GUAAUGACAGUGAUGAAAUGC-3'(SEQ ID NO.5)

Sense：5'-AUUAGUCUUUUUAUUCUUCUU-3'(SEQ ID NO.6)

Antisense：5'-GAAGAAUAAAAAGACUAAUAA-3'(SEQ ID NO.7)

Preferably, the siRNA inhibitor composition can also comprise an RNA molecule obtained by chemical modification on the basis of the siRNA molecule; or a recombinant vector encoding the siRNA sequence molecule in vivo.

Preferably, the recombinant vector may be one of a plasmid, adenovirus, lentivirus, adeno-associated virus.

The invention also provides application of the siRNA inhibitor composition in preparing a novel medicine for inhibiting osteoporosis.

In the invention, by designing a specific primer sequence of SNHG12 and detecting the expression level of SNHG12 before and after osteogenic differentiation of human bone marrow mesenchymal stem cells through Q-PCR, the expression of SNHG12 is proved to be obviously reduced in the osteogenic differentiation process. Further designing an siRNA sequence specifically targeting SNHG12 gene and carrying out chemical synthesis to obtain the siRNA inhibitor composition capable of specifically reducing the expression level of SNHG12 gene of cells.

The siRNA inhibitor composition is transfected into the human mesenchymal stem cells and is subjected to osteogenic differentiation induction, and the siRNA inhibitor composition is found to remarkably promote osteogenic differentiation of the stem cells. The siRNA inhibitor composition provided by the invention provides a new way for enhancing bone formation and resisting osteoporosis, and can be used for preparing a new medicament for inhibiting osteoporosis.

Compared with the prior art, the siRNA inhibitor composition and the application thereof provided by the invention have the advantages that: according to the invention, by designing and synthesizing the SNHG12 gene-targeted siRNA and forming the SNHG12 inhibitor composition, the in vitro efficacy evaluation shows that the SNHG12 inhibitor can remarkably promote the osteogenic differentiation process of stem cells, and the potential of preparing a new medicament for treating osteoporosis is shown.

Drawings

FIG. 1 shows the expression levels of the SNHG12 gene at different stages during the osteogenic differentiation of human bone marrow mesenchymal stem cells;

FIG. 2 is a result of measuring the inhibition efficiency of the siRNA inhibitor composition on the expression level of the SNHG12 gene after transfecting the human mesenchymal stem cells;

FIG. 3 shows the expression of marker genes after transfection of human mesenchymal stem cells with siRNA inhibitor compositions;

FIG. 4 is a graph showing the effect of siRNA inhibitor on the osteogenic differentiation process after transfection of human mesenchymal stem cells.

Detailed Description

The therapeutic properties of the present invention are further illustrated by the following examples. The methods involved are technical means that can be grasped and utilized by those skilled in the art. However, the description of the embodiments should not be construed as limiting the claims of the present invention in any way. In addition, it should be noted that the siRNA sequences of the present invention are only representative sequences capable of inhibiting expression of SNHG12, and any potential siRNA sequences targeting SNHG12 gene predicted by bioinformatics are within the scope of the present invention.

Example 1 culture of human mesenchymal Stem cells

Human mesenchymal stem cells (Cat. HUXMA-01001) and complete culture medium (Cat. HUXMA-90011) were purchased from Guangzhou Seisakusho Biotech Co., Ltd. Cell passaging is performed when cells grow above 90% confluence. The cells were washed once with sterile PBS, cell digestion was performed by adding pancreatin containing EDTA, room temperature digestion was performed for 2min, after which 2mL complete medium was added to stop digestion, cell transfer was performed by pipetting into 15mL centrifuge tubes, and cells were collected by centrifugation at 1000 rpm/min. Add 5mL of complete medium to resuspend the cells and adjust the cell density to 1X 10⁵Cells/ml, subcultured, digested typically once in 2 days.

Example 2 extraction of Total RNA from cells

The extraction of total RNA from cells was carried out according to TRNzol Universal Total RNA extraction reagent (DP424) of Tiangen Biochemical technology (Beijing) Ltd. Cells were lysed by adding 1mL Trizol per well of a 6-well plate and repeatedly pipetting with a pipette tip for 5 minutes at room temperature. Transferring the lysate into a 1.5mL centrifuge tube, adding 200. mu.L chloroform, covering the tube cap tightly, vortexing, standing at room temperature for 3 minutes, and centrifuging at 12000g/min for 15 minutes at 4 ℃. The upper aqueous phase was transferred to a new 1.5mL centrifuge tube, 500. mu.L of isopropanol was added, vortexed, mixed, allowed to stand at room temperature for 10 minutes, and centrifuged at 12000g/min for 10 minutes at 4 ℃. The supernatant was pipetted and discarded, leaving a white bottom precipitate. 1mL of 75% ethanol (prepared in DEPC water) was added, and the white precipitate was gently flicked by hand and then centrifuged at 7500g/min for 5 minutes at 4 ℃. The supernatant is discarded, the mixture is dried for 10 to 15 minutes at room temperature, 30 to 40 mu L of DEPC water is added for redissolving, and the RNA is stored in a refrigerator at the temperature of minus 80 ℃ or is directly used.

EXAMPLE 3 reverse transcription experiment of Total RNA

The extracted 1000ng of total RNA was reverse transcribed into cDNA using a reverse transcription kit (TaKaRa, cat No. RR047A) according to the protocol of the kit. The specific process is as follows: (1) after the concentration of RNA is determined, calculating the volume of RNA and DEPC water to be added according to the amount of 500ng of total RNA added into a 10 mu l reverse transcription system; (2) DEPC water, total RNA and 5 XPrimeScriptTM RT Master Mix (TaKaRa, cat No. RR047A) were added to the PCR tube in this order and mixed well; (3) performing reverse transcription amplification on a PCR instrument according to the procedures of reaction at 37 ℃ for 15min, reaction at 85 ℃ for 5sec and storage at 4 ℃; (4) the amplified cDNA is diluted 30-50 times with sterilized triple distilled water for fluorescent quantitative PCR amplification or stored at-20 deg.c for long term.

EXAMPLE 4 fluorescent quantitative PCR amplification (Q-PCR)

The expression level of the gene was detected by performing a Q-PCR experiment using GAPDH as an internal reference gene by referring to the kit instructions (TaKaRa, cat # RR820A) using a real-time fluorescent quantitative PCR technique. The specific process is as follows:

(1) preparing detection primers before experiment, sterilizing triple distilled water, carrying out 96-hole PCR (polymerase chain reaction) plate, and carrying out fluorescent quantitative reagent;

(2) allocating the specific position of the reaction product in a 96-well PCR plate according to the number of the genes to be detected;

(3) three per sample per gene to be detectedPreparing a reaction solution according to the proportion of the composite pores: mu.L of cDNA template contained in the reaction system of 20. mu.L,

premix Ex TaqTM II (TAKARA) reagent 10. mu.L, upstream primer (10. mu.M) 1. mu.L, downstream primer (10. mu.M) 1. mu.L, triple distilled water 6. mu.L;

(4) adding all reaction solution into corresponding holes, sealing the 96-hole PCR plate by using a special sealing membrane, and centrifuging at 2500rpm for 3 min;

(5) after centrifugation, the mixture is subjected to computer detection on a CFX96 touch fluorescent quantitative PCR detection system of BIO-RAD company, and the reaction program is as follows: A. pre-denaturation at 95 ℃ for 30 sec; B. and (3) PCR reaction: reading the plate at 95 ℃ for 5sec and 60 ℃ for 30sec, and circulating for 40 times; C. fitting a curve and reading the plate;

(6) and after the reaction is finished, carrying out data analysis by using system self-contained analysis software, excluding numerical values with the difference of CT values larger than 0.5 in 3 multiple wells, and calculating the relative expression level of each detection gene according to the internal reference gene. The Q-PCR primers are listed below:

example 5siRNA Synthesis

Sending each siRNA sequence of the designed targeted SNHG12 gene to the Shanghai Ebos organism for chemical synthesis, subpackaging by 1O/tube, and storing the siRNA powder in a refrigerator at the temperature of-20 ℃. When in use, the siRNA powder is taken out from a refrigerator at the temperature of-20 ℃, centrifuged for 1min by a centrifugal machine, dissolved into 20 mu M mother liquor by DEPC water in a super clean bench according to the instruction, split-packaged according to the small amount of 20 mu L, frozen and stored in the refrigerator at the temperature of-20 ℃, and repeatedly frozen and thawed for no more than 3 times.

Example 6 osteogenic differentiation model

Culturing human bone marrow mesenchymal stem cells to the optimum state, treating the cells according to a normal digestion and passage strategy, and adjusting the cell density to 2 x 10⁵Cells/ml. Cells were plated in 12-well plates at 1 ml/well for alkaline phosphatase staining and alizarin red staining, and 6-well plates at 2 ml/well for gene expression level analysis. Culturing the above cells overnight toAnd (3) in a monolayer state, completely absorbing and discarding the growth solution, adding an osteogenic induced differentiation solution for culturing, and changing the cell solution every 3 days. The formula of the osteogenic differentiation inducing liquid comprises: DMEM high-sugar medium +10^-7M dexamethasone +10mM sodium beta-glycerophosphate + 50. mu.M ascorbic acid + 10% FBS + double antibody.

The results of the analysis of the expression levels of the SHG12 gene on days 7, 14 and 21 are shown in fig. 1, fig. 1 shows that the expression level of the SNHG12 gene is at different stages in the osteogenic differentiation process of human bone marrow mesenchymal stem cells, and the results show that the SNHG12 gene is significantly down-regulated in the osteogenic differentiation process.

Example 7 cellular siRNA transfection

Cells to be transfected are inoculated in a culture plate at a certain density, and the cell density during transfection is ensured to reach about 70%. Opti-MEM medium was dispensed into inlet EP tubes at 125. mu.L/tube (6 well plates per well). Add 7.5 μ l sirna stock solutions to EP tubes separately and vortex to mix well. 7.5. mu.L of the suspension

The RNAimax reagent is added to another EP tube and vortexed to mix well, if multi-well transfection is desired, dilution of the transfection reagent can be performed in the same EP tube. The siRNA inhibitor composition and transfection reagent were allowed to stand at room temperature for 5 min. siRNA inhibitor composition and transfection reagent dilutions were mixed according to 1: mixing at a ratio of 1, blowing, stirring, and standing at room temperature for 5 min. The siRNA inhibitor composition and transfection reagent complex were slowly dropped into the plate (250. mu.L per well of 6-well plate), the plate was shaken back and forth and mixed well, and the culture was continued in the incubator. According to the difference of the sensitivity degree of the cells, the liquid can be changed 6-24h after transfection, and RNA can be taken 24-72 h after transfection to detect the expression level condition of the SNHG12 gene; meanwhile, a diluent containing only the transfection reagent is set as a control group, and the expression level of the SNHG12 gene is detected.

The results are shown in fig. 2, and the results of the detection of the inhibition efficiency of the siRNA inhibitor composition on the expression level of the SNHG12 gene after transfecting the human bone marrow mesenchymal stem cells show that the siRNA inhibitor can significantly inhibit the expression of the SNHG12 gene in the cells.

By using the method of example 6, after the siRNA inhibitor composition is transfected into the human mesenchymal stem cells, the expression levels of the marker genes RUNX2, ALP, OCN associated with osteogenic differentiation are detected on the 7 th day of osteogenic differentiation of the cells by the Q-PCR experimental method shown in example 4, and the specific test results are shown in fig. 3, and thus, it can be seen that the siRNA inhibitor composition can significantly promote the expression of RUNX2, ALP, OCN.

Example 8 alkaline phosphatase staining

Taking cells on day 7 of osteogenic differentiation to detect ALP activity staining analysis, taking out the cells to be stained from an incubator, carefully sucking and discarding the culture medium, washing the cells 3 times with PBS solution, 3min each time, fixing the cells with 4% paraformaldehyde at room temperature for 20min, sucking and discarding the fixing solution, washing the cells 3 times with PBS, 3min each time, preparing a staining buffer solution (basic phosphatase chromogenic buffer solution: BCIP solution: NBT solution:. about.3 mL: 10. mu.L: 20. mu.L) with reference to the specification of a BCIP/NBT basic phosphatase chromogenic kit (Biyun day), after washing, adding the staining solution into a 12-well plate according to the proportion of 500. mu.L/well for staining, and incubating at room temperature in dark place for a proper time until the cells are developed to the expected dark and light, generally 5-30 min. After the staining was completed, the staining solution was aspirated and the cells were washed 3 times with triple-distilled water for 3min each time. And (4) carrying out microscopic observation on the dyed culture plate and obtaining an image, wherein the culture plate can be stored for a long time after being air-dried.

Example 9 alizarin red staining

Cells were taken on day 21 of osteogenic differentiation for alizarin red staining analysis, cells to be stained were removed from the incubator, and the medium was carefully discarded. Cells were washed 3 times with PBS solution for 3min each time. Cells were fixed with 4% paraformaldehyde at room temperature for 30 min. The fixative was aspirated off and the cells were washed 3 times with PBS, 3min each time. After the completion of washing, alizarin red staining solution was added to a 12-well plate at a rate of 500. mu.L/well for staining. Incubate for 30min at room temperature in the dark. After the staining was completed, the staining solution was aspirated and the cells were washed with triple-distilled water for 5 times, each for 3 min. And (4) carrying out microscopic observation on the dyed culture plate and obtaining an image, wherein the culture plate can be stored for a long time after being air-dried.

The results of the experiment after the siRNA inhibitor composition was stained with alkaline phosphatase and alizarin red before and after transfecting the human mesenchymal stem cells are shown in fig. 4, and thus it can be known that the siRNA inhibitor composition can significantly accelerate the osteogenic differentiation process.

Finally, it should be noted that the above-mentioned embodiments are merely illustrative of the principles of the present invention and its efficacy, and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

Sequence listing

<110> Beijing university of aerospace

Application of long-chain non-coding RNA SNHG12 inhibitor in preparation of anti-osteoporosis drugs

<130> 2020.5.11

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 757

<212> DNA

<213> nucleotide sequence of SNHG12 Gene (SNHG12 gene nucleotide sequence)

<400> 1

ctttctcccc gccgcattcc cggtgtcgac ttactagctg caagcctctg cctgccttcc 60

tgcgcgccgt tccccgctag tcgctgctgc tggcgcgcac tcgccgggtt tttcctccca 120

cggcctcgag atggtggtga atgtggcacg gaggagccgg gccttccaac ccggtgggcc 180

cgagctccga aaggccccct cggcagtgag aggggcggga gcccgcgggg gccgcgccct 240

tctctcgctt cggactgcgc aacgctgcgc tctgggctga caggcggata aaacggtccc 300

atcaagactg agaaaaagca caccagctat tggcacagcg tgggcagtgg ggcctacagg 360

atgactgact tagtctacag agatcccggc gtacttaagc agatgaagac tcttaagatg 420

acagaaggtg atttttctgg tgatcgagga cttccggggt aatgacagtg atgaaatgca 480

ggggacctgg ttgcccccaa gtttcctggc agtgtgtgat actgaggagg tgagcttgtt 540

tctggagctg tgctttaaga ttcatgttac atgtaaagct gtcctcattt gtgactatgg 600

acctatggag ttgggacaat ctctatggga agcagaaggc aaggaccccg gtcattttag 660

gtagaaacaa cagcatgcta atgcaaaaaa ttatgcagtg tgctactgaa cttcagaggt 720

gatcaataaa agaagaataa aaagactaat aaaagta 757

<210> 2

<211> 21

<212> RNA

<213> siRNA-1-sense

<400> 2

ucuuaagagu cuucaucugc u 21

<210> 3

<211> 21

<212> RNA

<213> siRNA-1-Antisense

<400> 3

cagaugaaga cucuuaagau g 21

<210> 4

<211> 21

<212> RNA

<213> siRNA-2-sense

<400> 4

auuucaucac ugucauuacc c 21

<210> 5

<211> 21

<212> RNA

<213> siRNA-2-Antisense

<400> 5

guaaugacag ugaugaaaug c 21

<210> 6

<211> 21

<212> RNA

<213> siRNA-3-sense

<400> 6

auuagucuuu uuauucuucu u 21

<210> 7

<211> 21

<212> RNA

<213> siRNA-3-Antisense

<400> 7

gaagaauaaa aagacuaaua a 21

<210> 8

<211> 20

<212> DNA

<213> Human SNHG12-QPCR-F

<400> 8

ggtttttcct cccacggcct 20

<210> 9

<211> 21

<212> DNA

<213> Human SNHG12-QPCR-R

<400> 9

gggaccgttt tatccgcctg t 21

<210> 10

<211> 20

<212> DNA

<213> Human RUNX2-QPCR-F

<400> 10

tggcagcacg ctattaaatc 20

<210> 11

<211> 20

<212> DNA

<213> Human RUNX2-QPCR-R

<400> 11

tctgccgcta gaattcaaaa 20

<210> 12

<211> 22

<212> DNA

<213> Human ALP-QPCR-F

<400> 12

tgctctgcgc aggattggaa ca 22

<210> 13

<211> 22

<212> DNA

<213> Human ALP-QPCR-R

<400> 13

aggcaggtgc caatggccag ta 22

<210> 14

<211> 20

<212> DNA

<213> Human OCN-QPCR-F

<400> 14

aagagaccca ggcgctacct 20

<210> 15

<211> 21

<212> DNA

<213> Human OCN-QPCR-R

<400> 15

aactcgtcac agtccggatt g 21

<210> 16

<211> 22

<212> DNA

<213> Human GAPDH-QPCR-F

<400> 16

agcctcaaga tcatcagcaa tg 22

<210> 17

<211> 24

<212> DNA

<213> Human GAPDH-QPCR-R

<400> 17

cacgatacca aagttgtcat ggat 24

Claims (7)

1. An siRNA inhibitor composition, which is characterized by comprising one or more sequences of siRNA-1, siRNA-2 and siRNA-3; the forward nucleotide sequence information of the siRNA-1 is shown as SEQ ID NO.2, and the reverse nucleotide sequence information is shown as SEQ ID NO. 3; the forward nucleotide sequence information of the siRNA-2 is shown as SEQ ID NO.4, and the reverse nucleotide sequence information is shown as SEQ ID NO. 5; the forward nucleotide sequence information of the siRNA-3 is shown as SEQ ID NO.6, and the reverse nucleotide sequence information is shown as SEQ ID NO. 7.

2. The siRNA inhibitor composition of claim 1, wherein said siRNA-1, siRNA-2, siRNA-3 sequences are siRNA sequences targeting the SNHG12 gene.

3. The siRNA inhibitor composition of claim 2, wherein the nucleotide sequence information of said SNHG12 gene is set forth in SEQ ID No. 1.

4. The siRNA inhibitor composition of claim 1, further comprising an RNA molecule modified by chemical modification on the basis of said siRNA molecule; or a recombinant vector comprising a molecule encoding said siRNA sequence in vivo.

5. The siRNA inhibitor composition of claim 4, wherein said recombinant vector is a plasmid.

6. The siRNA inhibitor composition of claim 4, wherein said recombinant vector is one of an adenovirus, a lentivirus, and an adeno-associated virus.

7. Use of the siRNA inhibitor composition of claim 1 for the preparation of a novel medicament for inhibiting osteoporosis.

Images