CN111705164A

CN111705164A - HIV-1 viral load real-time fluorescent quantitative PCR detection specific primer pair and kit

Info

Publication number: CN111705164A
Application number: CN202010558549.8A
Authority: CN
Inventors: 于斌; 姜淼
Original assignee: Beijing Liangxin Biotechnology Development Co ltd
Current assignee: Beijing Liangxin Biotechnology Development Co ltd
Priority date: 2020-06-18
Filing date: 2020-06-18
Publication date: 2020-09-25
Also published as: WO2021254109A1

Abstract

The invention relates to the field of biomolecule detection, in particular to a specific primer pair and a kit for real-time fluorescent quantitative PCR detection of HIV-1 viral load. The invention provides a specific primer pair for accurately, simply and conveniently quantitatively detecting the RNA of human immunodeficiency virus type I (HIV-1). The HIV-1 viral load is detected by using a one-step fluorescent quantitative RT-PCR technology. The operation ensures the accuracy and sensitivity of the amplification result, shortens the time, reduces the pollution, improves the simplicity of the fluorescent quantitative PCR detection method, can be used for HIV-1 quantitative detection, and can be used as an auxiliary diagnosis method for HIV-1 infection and a monitoring means for clinical treatment effect.

Description

HIV-1 viral load real-time fluorescent quantitative PCR detection specific primer pair and kit

Technical Field

The invention relates to the field of biomolecule detection, in particular to a specific primer pair and a kit for real-time fluorescent quantitative PCR detection of HIV-1 viral load.

Background

Human Immunodeficiency Virus (HIV) is the major pathogen inducing Acquired Immunodeficiency Syndrome (AIDS) in humans and belongs, in taxonomy, to the family of Retroviridae (Retroviridae) Lentivirus genus (Lentivirus). HIV can be divided into two types, depending on the genotype: HIV-1 and HIV-2. HIV-1 has M, N, O, P four distinct groups (groups), each group resulting from independent cross-species transmission. HIV-1 has higher virulence and is more easily transmitted, and causes most HIV infections in the world.

Of all HIV-1 infections worldwide, subtype C accounts for 46.6%. Subtype B caused 12.1% of infections, followed by subtype A, CRF02_ AG, CRF01_ AE, subtype G, subtype D. F. The H, J, K subtype totaled 0.9% of the infections. Other prevalent recombination types (CRFs) account for 3.7%.

The change of the viral load after HIV-1 infection has close correlation with the pathogenesis process of AIDS, and the detection of the viral load of HIV-1 can predict the occurrence, development and prognosis of AIDS. The anti-HIV-1 virus drugs mainly inhibit virus replication and reduce virus load, so that if the anti-HIV drugs have effects, the virus amount in infected persons is reduced. Therefore, the detection of the viral load has important significance for monitoring diseases, preventing the mother-infant transmission and observing the curative effect of antiviral drugs.

Nucleic acid detection has become the development direction of HIV laboratory diagnosis, and in recent years, nucleic acid detection technology has developed rapidly, mainly by adopting various amplification technologies to improve detection sensitivity. With the maturity of amplification technology, low-copy target sequences can be amplified in a logarithmic mode, meanwhile, a non-radioactive detection system (such as an electrochemical luminescence system and the like) which is more sensitive than a radioactive probe is adopted, the sensitivity of nucleic acid detection is obviously improved, and pollution of radioactive substances is reduced.

SYBR Green I is a dye with a Green excitation wavelength that binds to all dsDNA double helix minor groove regions and does not bind to single stranded DNA strands. In the free state, SYBR Green I emits weak fluorescence, which is greatly enhanced once bound to double-stranded DNA. Therefore, in the PCR system, with the exponential amplification of the specific PCR product, the dye is doped into the double-stranded DNA in each cycle of the extension phase, the fluorescence signal intensity of the dye is in positive correlation with the quantity of the PCR product, and the quantity of the double-stranded DNA existing in the PCR system can be detected according to the fluorescence signal. SYBR Green I has a maximum absorption wavelength of about 497nm and an emission wavelength of about 520 nm. The SYBR Green I fluorescent dye method has the following advantages: can be used to monitor the amplification of any double stranded DNA sequence. The signal-to-noise ratio is high, the fluorescence signal of the sample is strong, and the background signal is low; the use is convenient, and the effect of other modification enzymes is not influenced; the price is cheap, does not need the probe, has reduced the setting and the running cost of detection.

Although the sequences of each subtype of HIV-1 virus are disclosed, the sequence changes are very large for individual infected persons, so that primers designed based on the conserved sequences of HIV-1 virus obtained only based on the disclosed data information are difficult to be widely applied, and are particularly not suitable for detecting HIV-1 infected persons peculiar to China.

Disclosure of Invention

The present invention has been made to solve the above problems.

The application aims to provide a specific primer pair for real-time fluorescent quantitative PCR detection of HIV-1 viral load.

It is still another object of the present invention to provide a kit for real-time fluorescent quantitative PCR detection of HIV-1 viral load.

The embodiment of the invention provides a specific primer pair for HIV-1 viral load real-time fluorescent quantitative PCR detection, which comprises a primer pair 1 and a primer pair 2, wherein,

primer pair 1 included the following primers:

primer 1: 5 'AGTGGGGGGACAYCARGCAGC 3' (SEQ ID No:1),

primer 2: 5 'TACTAGTAGTTCCTGCTATRTCACTTCC 3' (SEQ ID No: 2);

the primer pair 2 comprises the following primers:

primer 3: 5 'GACAGCAGAGAYCCAMTTTGG 3' (SEQ ID No:3),

primer 4: 5 'TGCCCCTTCACCTTTCCA 3' (SEQ ID No: 4).

The embodiment of the invention provides a real-time fluorescent quantitative PCR detection kit for HIV-1 viral load, which comprises a primer pair 1 and a primer pair 2, wherein,

primer pair 1 included the following primers:

primer 1: 5 'AGTGGGGGGACAYCARGCAGC 3' of the composition,

primer 2: 5 'TACTAGTAGTTCCTGCTATRTCACTTCC 3';

the primer pair 2 comprises the following primers:

primer 3: 5 'GACAGCAGAGAYCCAMTTTGG 3' of the composition,

primer 4: 5 'TGCCCCTTCACCTTTCCA 3'.

The technical scheme of the invention has the beneficial effects that:

1. the primer pair of the invention can detect the RNA of human immunodeficiency virus type I (HIV-1) by one-step fluorescent quantitative RT-PCR technology, thereby having simple operation, shortening detection time and reducing pollution.

2. The primer pair has high specificity, high sensitivity and good repeatability, and the detection threshold of the sensitivity and the specificity of the primer is 4 × 10¹～1×10⁸copies/mL。

3. Can be used for HIV-1 quantitative detection, and can be used as an auxiliary diagnosis method for HIV-1 infection and a monitoring means for clinical treatment effect.

2. The primer design of the invention is based on the gene positions of two HIV genes, gag and pol, and can reflect the real virus load level more accurately.

Drawings

The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this application, illustrate embodiment(s) of the application and together with the description serve to explain the application and not to limit the application. In the drawings:

FIG. 1 is a graph showing an amplification curve when amplification is performed using primer set 1 according to an embodiment of the present invention, in which Δ Rn represents an increase in fluorescence, i.e., an increase in amplification product, and Ct value represents the number of cycles.

FIG. 2 is a standard curve for amplification using primer pair 1 according to an embodiment of the present invention, wherein the abscissa represents the log value of the viral load and the ordinate represents the Ct value, indicating the number of cycles.

FIG. 3 is an amplification curve of a standard in amplification using primer set 2 according to an embodiment of the present invention, in which Δ Rn represents the increase in fluorescence, i.e., the increase in amplification product, and Ct represents the cycle number.

FIG. 4 is a standard curve for amplification using primer pair 2 according to an embodiment of the present invention, wherein the abscissa represents the log value of the viral load and the ordinate represents the Ct value, indicating the number of cycles.

FIG. 5 shows the comparison of the virus load of 16 samples tested by the present invention and the similar products in the market.

FIG. 6 shows the results of the primer sensitivity verification test, in which Δ Rn represents the fluorescence increment, i.e., the amplification product increment, and Ct values represent the cycle numbers

FIG. 7 shows the first test result of the primer stability verification test, in which Δ Rn represents the fluorescence increase, i.e., the increase of amplification product, and Ct value represents the cycle number.

FIG. 8 shows the results of the second test of the primer stability verification test, in which Δ Rn represents the fluorescence increase, i.e., the increase of the amplification product, and Ct represents the cycle number

FIG. 9 shows the third test result of the primer stability verification test, in which Δ Rn represents the fluorescence increment, i.e., the amplification product increment, and Ct represents the cycle number

FIG. 10 is a comparison of results showing the detection of viral load of 16 samples of optimized primers and similar products in the market.

Detailed Description

In order to make the objects, technical solutions and advantages of the present application more apparent, the technical solutions of the present application will be described in detail and completely with reference to the following specific embodiments of the present application and the accompanying drawings. It should be apparent that the described embodiments are only some of the embodiments of the present application, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application.

The technical solutions provided by the embodiments of the present application are described in detail below with reference to the accompanying drawings.

According to the specific embodiment of the invention, the RNA of human immunodeficiency virus type I (HIV-1) is detected by using two pairs of specific primers and adopting a one-step real-time fluorescence quantitative PCR technology. Two amplification standard curves are obtained, and the two sets of standard curves are subjected to data analysis, so that the virus load detection accuracy is further improved. After nucleic acid extraction is carried out on HIV-1 positive serum samples, a reaction system is directly prepared for amplification, the preparation of the reaction system is convenient, the amplification procedure steps are simple and convenient, the amplification time is short, repeated circulation is not needed for many times, and product pollution is prevented.

The method is based on the SYBR Green I real-time fluorescent quantitative PCR principle, HIV-1RNA is used as a template, two pairs of virus genome specific primers are respectively utilized, reverse transcriptase and Taq-DNA polymerase are added, and the HIV-1RNA template is rapidly and accurately analyzed through a one-step fluorescent RT-PCR experiment. The reverse transcription to the real-time fluorescence quantitative PCR can be completed by one step, and the multi-step operation pollution can be effectively prevented. Therefore, the detection method and the kit have the advantages of high accuracy, strong specificity, high sensitivity, simple and convenient operation, clear result and high reliability, and can be used for quantitative detection of HIV-1 in serum.

In addition, the invention respectively selects two separated positions on the HIV-1 genome for amplification detection, obtains data by calculating the weighted average of the two load data, has stronger specificity than the fluorescence PCR amplification with a single locus, and can more truly reflect the load level of HIV in vivo.

The use method of the kit comprises the following steps:

negative control and No. 1-No. 5 of calibrator should be set up for each detection;

preparing a reaction solution according to a reaction sample number n (the reaction sample number is the number of samples to be detected, 1 reference substance, 5 calibration substances and 1);

taking nx10.0 mu L of RT-PCR reaction liquid and nx2 mu L, RT-PCR enzyme mixture nx3 mu L of primer nx2 mu L, RT to be mixed evenly in a centrifuge tube, centrifuging at low speed for a plurality of seconds, and subpackaging into reaction tubes according to 15 mu L/tube;

respectively adding 5 mu L of the sample extract, the negative control extract and the calibrator extract into a reaction tube, centrifuging at a low speed for several seconds, and taking out and placing on a full-automatic fluorescent quantitative PCR instrument;

the reaction procedure is as follows: reacting at 48 ℃ for 30min and at 95 ℃ for 10s, then circulating for 40 times according to the conditions that the temperature is 95 ℃ for 15s → 57 ℃ for 30s → 72 ℃ for 1min, collecting signals of FAM fluorescence channels at 72 ℃, and obtaining a melting curve through the conditions that the temperature is 95 ℃ for 15s, the temperature is 60 ℃ for 30s and the temperature is 95 ℃ for 1 s.

And after the instrument PCR program is operated, storing results and analyzing data according to the requirements of instruments and software. The analysis software automatically combined with the standard curve calculated HIV-1RNA content C (copies/mL) for each sample extract using fluorescence values above the sample noise line and negative control as detection thresholds.

According to a particular embodiment of the invention, the detection kit comprises: RT-PCR reaction liquid, RT-PCR enzyme mixture, primers, negative control and No. 1-No. 5 of calibrator. Directly carrying out real-time fluorescent quantitative RT-PCR detection on the extracted HIV-1RNA template, wherein the RT-PCR reaction solution comprises 20mM of Tris-HCl (pH 8.3), 100mM of KCl, 0.2mg/ml of gelatin, 0.4mM of each of dATP, dGTP, dCTP and dUTP, and MgCl₂6mM and SYBR Green I2 ×, wherein the enzyme mixture is a mixture of reverse transcriptase (3U/muL) and TaqDNA polymerase (2U/muL), the provided primers are two pairs of HIV-1 specific primers (1 muM each), the provided negative control is normal human serum without HIV-1RNA, and the provided calibrator No. 1-No. 5 is plasmid containing HIV-1 gene segments with known concentration gradient.

Example 1

RNA extracted from 16 parts of HIV-1 positive serum samples is detected by utilizing a human immunodeficiency virus type I one-step method fluorescent quantitative PCR detection kit.

Real-Time fluorescent quantitative PCR is carried out by using Applied Biosystems QuantStudio5 Real-Time PCR Systems, FAM channel fluorescent signals are collected at 72 ℃, and a melting curve step is carried out after the circulation process is finished.

And after the RT-PCR program of the instrument is operated, storing results and analyzing data according to the requirements of the instrument and software. Taking the fluorescence value higher than the noise line of the sample and the negative control as a detection threshold value, the analysis software automatically combines two standard curves to calculate the HIV-1RNA content C (copies/mL) of each sample extract, and the average value is taken as the final result. The melting curve was then analyzed to ensure that there was no primer dimer interference during the PCR process.

The amplification curve and the standard curve of the amplification standard using primer set 1 are shown in FIGS. 1-2, respectively. The amplification curve and the standard curve of the amplified standard using primer set 2 are shown in FIGS. 3 to 4, respectively.

Standard curve R²Are all larger than 0.99, and the Ct values of the samples are all smaller than 35, which meets the requirements. The analysis software automatically combined the two standard curves to calculate HIV-1RNA content C (copies/mL) for each sample extract, the results of which are shown in Table 1 below.

TABLE 1

Note: viral load units: (copies/mL)

As shown in Table 1, the amplification results of primer set 1 and primer set 2 were measured by QuantStaudio^TMDesign&Analysis SESoftware gives it automatically. The average value of the two is taken as the final viral load result, and the final viral load result is compared with the viral load result detected by the similar products in the market (as shown in figure 5), and the results of the two are similar, so that the kit disclosed by the invention is proved to have a good detection effect on the viral load of the tested 16 samples HIV-1.

Example 2 test results for various subtypes of HIV-1

Samples were sequenced one generation and the resulting sequences submitted to the Stanford university HIV resistance database (https:// hivdb. stanford. edu/hivdb) for subtype analysis. Thereafter, the viral load of each sample was detected using the kit of the present invention (the method and procedure were the same as in example 1), and the results are shown below.

(1) Sample number R16, sequencing result (SEQ ID No: 5).

HIV-1 subtype is B; the amplification result; ct 26.681

(2) Sample number T1516, sequencing result (SEQ ID No: 6).

HIV-1 subtype CRF01_ AE; and (3) amplification results: ct 23.259

(3) Sample number: y4, sequencing results (SEQ ID No: 7).

HIV-1 subtype CRF07_ BC; and (3) amplification results: ct 27.806

(4) Sample number: y10, sequencing results (SEQ ID No: 8).

HIV-1 subtype is B + C; and (3) amplification results: ct 26.935

In the HIV-1 viral load test for detecting 4 common subtypes in China, the Ct value of the test result is less than 35, and the primer pair provided by the invention has good detection effect on various subtypes of HIV-1.

Example 3, sensitivity and stability validation test:

1. sensitivity validation test template DNA was serially diluted in a 10-fold gradient from 5.92 × 10³～5.92×10⁹In the copies/mL interval, 5. mu.L of each order of dilution was used as the amplification template. The experimental conditions were the same as in example 1. The results show that: a clear amplification curve was seen at Ct-30 (see fig. 6), demonstrating the lowest dilution that could be detected<5.92×10³copies/mL (approximately equivalent to a minimum of 30 copies of DNA per reaction) with good sensitivity, a minimum of 30 copies of DNA per reaction can be detected.

2. And (3) stability verification test: three groups of primers and standard substances provided by the invention are packaged at one time and stored at the temperature of minus 20 ℃. RT-PCR amplification tests (the test method and procedure are the same as in example 1) were performed on

days

0, 3 and 6, respectively, and Ct values of three RT-PCR reactions were compared with the same set of standards to determine the stability of the primers. The results of the three tests are shown in FIGS. 7, 8 and 9, and the Ct value statistical results and the coefficient of variation are shown in Table 2 below.

TABLE 2

First PCR	Second PCR	Third PCR	Average Ct value	Coefficient of Variation (CV)
					11.017	11.193	11.189	11.133	0.74％
13.889	14.046	14.145	14.02667	0.75％
					16.939	16.939	17.116	16.998	0.49％
19.926	20.116	20.353	20.13167	0.87％
					23.668	23.992	24.204	23.95467	0.92％

And analyzing statistical results, wherein the coefficient of variation of the Ct value of each group is less than 1%, and the primers have good stability.

The viral load of the same set of 16 samples was tested using a pair of non-optimized primers (sequence: F1 ═ 5 'GGCAGCAATGCAAATGTTAAAR 1 ═ TCATCTGGCCTGGTGGAATA 3') (the validation method and procedure were the same as in example 1), and the results are shown in table 3 below.

TABLE 3

Sample number	Value of load	Detection result of similar products in market	Coefficient of Variation (CV)
				1	10694	255925	91.98％
3	14583	52183	56.32％
				4	97641	155173	22.76％
5	35719	157315	62.99％
				6	13647	166182	84.82％
7	65072	77126	8.48％
				8	104859	307952	49.20％
9	33671	107908	52.44％
				10	197425	291521	19.24％
11	79853	168476	35.69％
				12	16594	141945	79.07％
13	68504	79269	7.28％
				14	47203	72512	21.14％
15	12541	291521	91.75％
				16	15371	186718	84.79％

Note: viral load units: copies/mL

As shown in Table 2 and FIG. 10, comparing the results of detecting viral load with those of the same products in the market, the coefficient of variation of the detection results is very large, and it can be seen that the capability of detecting viral load of the pair of primers is not as good as that of the optimized primer pair.

The above description is only an example of the present application and is not intended to limit the present application. Various modifications and changes may occur to those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Sequence listing

<110> Beijing Liangxin Biotechnology development Co., Ltd

<120> HIV-1 viral load real-time fluorescence quantitative PCR detection specific primer pair and kit

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

agtgggggga caycargcag c 21

<210>2

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tactagtagt tcctgctatr tcacttcc 28

<210>3

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gacagcagag ayccamtttg g 21

<210>4

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

tgccccttca cctttcca 18

<210>5

<211>1086

<212>DNA

<213> human (human)

<400>5

tctttagctt ccctcagatc actctttggc aacgacccct cgtcacaata aagatagggg 60

ggcaattaaa ggaagctcta ttagatacag gagcagatga tacagtatta gaagacatgg 120

akttgccagg aagatggaaa ccaaaaatga tagggggaat tggaggtttt atcaaagtaa 180

gacagtatga tcagataccc atagaaattt gcggacacaa ggctgtaggt acagtattaa 240

taggacccac acctgtcaac ataattggaa gaaatctgtt gactcagcta ggttgcactt 300

taaattttcc cattagtcct attgaagctg taccagtaaa attaaagcca ggaatggatg 360

gcccaaaagt taaacaatgg ccattgacag aagaaaaaat aaaagcatta gtagaaattt 420

gtrcagaact ggaaaaggaa gggaaaattt caaaaattgg gcctgaaaat ccatacaata 480

ctccagtatt tgtcataaag aaaaaagaca gtactaaatg gagaaaatta gtagatttca 540

gggaacttaa taaaagaact caagacttct gggaagttca attaggaata ccacatccag 600

cagggttaaa aaagaacaga tcagtaacag tcctggatgt gggtgatgca tatttctcag 660

tccctctaga taaagacttc aggaagtata ctgcatttac catacctagt ataaacaatg 720

agacaccagg gatcagatat cagtacaatg tacttcccca gggatggaaa ggatcaccag 780

caatatttca aagtagcatg acaaaaatct tagagccttt tagaaaacaa aatccaaaca 840

tagttatcta tcaatacgtg gatgatttgt atgtaggatc tgacttagaa atagggcagc 900

atagagcaaa aatagaggaa ctgagacaac atctgttgaa gtggggattt ttcacaccag 960

acaaaaaaca tcagaaagaa tatccattcc tttggatggg ttatgagctc catcctgata 1020

gatggacaat acagcctata gtgctgccag aaaaggacag ctggactgtc aatgcattac 1080

agaaga 1086

<210>6

<211>1085

<212>DNA

<213> human (human)

<400>6

tcttctgtat acattgacag tccagctgtc tttttctggc agttctatag gctggactgt 60

ccatctgtca ggatggagtt cgtatcccat ccaaagaaat ggcggttcct tctgatgctt 120

tttgtctggt gtagtaaatc cccagctcaa tagatgagct ctcagctcat ctatttttat 180

tctgtgctgc cctatttcta aatcagatcc tacatacaag tcatccatgt attgatagat 240

aaccatctct ggattttttc ttctataggg ctctaagatt tttgtcatgc tacactggaa 300

tattgccgga gatcctttcc atccctgtgg tagcacattg tactggtatc tgattcctgg 360

tgtctcattg tttatactag gtatggtgaa tgcagtatac tttctaaagc tttcatctaa 420

ggggactgaa aaatatgcat ctcccacatc tagcaccgtt actgattttt tcttttttaa 480

tcctgctgga tgtggtattc ctaattgaac ttcccaaaag tcctgagttc ttttgttgag 540

ttctctgaaa tctactaatt tcctccattt ggtgctgtcc tttttcttta tagcaaatac 600

tggagtatta tatggatttt caggcccaat ttttgagatt tttccttcct cttccatttc 660

cttacaaatt tctgttaatg cttttatttt ttcttttgtc aatggccatt gtttaacctt 720

tgggccatcc attcctggct ttagttttac tggtatagtt tgaattggac tgattggaaa 780

atttaaagta caaccaattt gagtcaacat atttcgtcca attatgttga caggtgtagg 840

tcctactaac actgtaccta tagccttttt tccacaaatt tctataagta tctgatcata 900

ttgccttact ttgataaaac ctccaattcc ccctatcatt tttggtttcc atttccctgg 960

caaattyata tcttctaata ctgtatcatc tgctcctgta tctaatagag cctctctyaa 1020

ytgyccycct atttttatgg taacaagggg tcgttgccaa agagtgatct gagggaagct 1080

aaaga 1085

<210>7

<211>1075

<212>DNA

<213> human (human)

<400>7

tcattgacag tccatctatc ttgtactggc aactgtatag gctgtactgt ccatttgtca 60

ggatggagtt cataccccat ccaaagaaat ggaggttctt tctgatgttt cttgtctggt 120

gtggtaaatc cccacctcaa caaatgttgt ctcagttcct ctatttttgt tctatgctgc 180

cctatctcta agtcagatcc tacatacaaa tcatccatgt attgatagat gactatgtct 240

ggattttgtt ttctaaaagg ctctaagatt cttgtcatgc tactttgaaa tattgctggt 300

gatcctttcc atccctgtgg aagtacattg tactgatacc taatccctgg tgtttcattg 360

tttatactag gtatggtaaa tgcagtatay ttyctraagt yttcatataa aggaactgaa 420

aaatatgcat cycccacatc cagyactgty actgattttt tcttttttaa tcctgctgga 480

tgtggtattc ctaattgaac ttcccaaaag tcttgagttc ttttattgag ctcyctgaaa 540

tctactaatt tyctccattt rgtrctgtcy tttttyttta trgcaaaway tggagtrttr 600

tatggatttt caggcccaat ttttgwaatt tttccttcyt yttccatytc yttacaaatt 660

tctgttaatg ctyytatttt ytctyctgtc aatggccatt gtttaacctt tggkccatcc 720

attcctggyt ttarttttac tggyacagtt tcaataggac ttatkggaaa atttaaagta 780

caaccaagct gagtcaacaa atttcttcca attatgttga caggtgtagg tcctacyaay 840

actgtaccta tagctttwtk tccacagatt tctatgggta tctgttcata ctgtcttact 900

ttgataaaac ctccaattcc ccctatcatt tttggtttcc atttccctgg caaattcatg 960

tcttctaata ctgtatcatc tgctcctgta tctaatagag cttcctttaa ttgtccccct 1020

atctttattg taacaagggg tcgttgccaa agagtgattt gaggaaagct aaaga 1075

<210>8

<211>1078

<212>DNA

<213> human (human)

<400>8

ctttaacttt ccctcagatc actctttggc aacgacccct tgttaccata aagatagggg 60

ggcaattaaa agaagctcta ttagatacag gagcagatga tacagtatta gaagacatgg 120

atttgccagg gaaatggaaa ccaaaaatga tagggggaat tggaggtttt atcaaagtaa 180

gacagtatga acaggtaccc atagaaatct gtggacataa aactrtaggt acagtattaa 240

taggacctac accggtcaac ataattggga gaaatctgtt gacccagctt ggttgtactt 300

taaattttcc aatyagtcct attgaaactg trccagtaaa actaaagcca ggaatggatg 360

gcccaaaggt taaacaatgg ccattgacar aagagaaaat agaagcatta acagcaattt 420

gtgatgaaat ggagaaggaa ggaaaaatta caaaaattgg gcctgagaat ccatacaaca 480

ctccaatatt tgcaataaaa aagaaagaca gtactaagtg gagaaaatta gtagatttca 540

gggaactcaa taaaagaact caagattttt gggaagttca attaggaata ccacacccag 600

caggattaaa aaagaaaaaa tcagtgacag tgctggatgt gggggatgca tatttttcag 660

ttcctttaca tgaagacttc aggaaatata ctgcattyac catacctagt ataaacaatg 720

aaacaccagg gattaggtat cagtacaatg tacttccaca gggatggaaa ggatcaccag 780

caatatttca aagtagcatg acaaaaatct tagagccttt tagaaaacaa aatccagaca 840

tagtcatcta tcaatacatg gatgatttgt atgtaggatc tgatttagag atagggcagc 900

acagaacaaa aatagaagaa ctgagagaac atttgttgag gtggggattt accacaccag 960

acaaaaaaca tcagaaagaa cctccatttc tttggatggg ktatgaactc catcctgaca 1020

aatggacagt acagcctata cagctgccag aacaagatag ctggactgtc aatgacat 1078

Claims

The HIV-1 viral load real-time fluorescence quantitative PCR detection specific primer pair is characterized by comprising a primer pair 1 and a primer pair 2, wherein,

primer pair 1 included the following primers:

primer 1: 5 'AGTGGGGGGACAYCARGCAGC 3' of the composition,

primer 2: 5 'TACTAGTAGTTCCTGCTATRTCACTTCC 3';

the primer pair 2 comprises the following primers:

primer 3: 5 'GACAGCAGAGAYCCAMTTTGG 3'

Primer 4: 5 'TGCCCCTTCACCTTTCCA 3'.
The real-time fluorescent quantitative PCR detection kit for HIV-1 viral load is characterized by comprising a primer pair 1 and a primer pair 2, wherein,

primer pair 1 included the following primers:

primer 1: 5 'AGTGGGGGGACAYCARGCAGC 3' of the composition,

primer 2: 5 'TACTAGTAGTTCCTGCTATRTCACTTCC 3';

the primer pair 2 comprises the following primers:

primer 3: 5 'GACAGCAGAGAYCCAMTTTGG 3' of the composition,

primer 4: 5 'TGCCCCTTCACCTTTCCA 3'.
3. Use of the HIV-1 viral load real-time fluorescent quantitative PCR detection specific primer pair of claim 1 for the preparation of a reagent for identifying HIV-1 viral load.